GmGGDR Gene Confers Abiotic Stress Tolerance and Enhances Vitamin E Accumulation in Arabidopsis and Soybeans

Abstract

Vitamin E, comprising tocopherols and tocotrienols, is a crucial fat-soluble antioxidant that helps maintain intracellular redox homeostasis in plants when they are under stress. Soybeans are a significant source of natural vitamin E. GGDR catalyzes the formation of phytyl diphosphate (PDP), a key vitamin E precursor, and it is involved in chlorophyll degradation. The GmGGDR gene, identified via RNA-seq in soybean germplasms with high and low vitamin E contents, encodes GGDR, a key enzyme involved in both vitamin E synthesis and chlorophyll degradation. This study shows that the GmGGDR-encoded protein is hydrophilic and stable, predominantly expressed in leaves, and markedly responsive to gibberellins. The GmGGDR gene enhances the tolerance of transgenic Arabidopsis and soybean plants to salt and drought stresses; transgenic soybeans overexpressing GmGGDR exhibited an approximately 8-fold increase in POD activity, with no significant changes in SOD and CAT activities. Moreover, the GmGGDR gene enhances the levels of α-, γ-, δ-, and total tocopherol content in transgenic soybean and Arabidopsis plants and also increases the chlorophyll a levels in the leaves of these transgenic plants. The increases in α-tocopherol, γ-tocopherol, and δ-tocopherol and total tocopherol in transgenic Arabidopsis seeds ranged from 177.8% to 600.0%, 42.9% to 90.0%, 17.6% to 292.9%, and 71.4% to 127.3% over the control, respectively. Similarly, transgenic soybeans exhibited a minimum increase of 42.9%, 27.8%, 7.1%, and 25.0% in these tocopherol fractions. Overexpression of GmGGDR also significantly elevated chlorophyll a levels in the leaves of these transgenic plants by 33.3–112.5%. This study preliminarily elucidated the function of the GmGGDR gene. It provides a theoretical foundation for further research. It presents a novel strategy for the genetic enhancement of soybean vitamin E content.

1. Introduction

Vitamin E, a crucial fat-soluble antioxidant, has extensive applications across the pharmaceutical, food, and cosmetics industries [1]. It plays roles in optimizing singlet oxygen quenching and preventing the propagation of lipid peroxidation within plant chloroplasts [2]. Owing to its antioxidant properties, vitamin E significantly contributes to enhancing tolerance against various abiotic stresses [3]. Based on the saturation level of their side chains, vitamin E compounds are categorized into tocopherols and tocotrienols. Furthermore, tocopherols and tocotrienols are differentiated into α, β, γ, and δ isomers based on the number and position of substituents on their aromatic rings [4]. Geranylgeranyl diphosphate reductase (GGDR) contributes to vitamin E biosynthesis through two primary pathways. One pathway involves the de novo synthesis of phytyl diphosphate (PDP), catalyzing the reduction in geranylgeranyl diphosphate (GGDP). The other pathway involves the degradation of chlorophyll, releasing free phytyl chains that can be used for PDP synthesis. In the second pathway, GGDR catalyzes the conversion of geranylgeranyl chlorophyll (Chlorophyllgg, Chlgg) to phyllophyll (Chlorophyllphy, Chlphy) [5]. The PDP derived from these two pathways serves as an essential substance involved in the third step of the vitamin E core synthesis pathway and is fully engaged in the synthesis of each type of tocopherol in soybeans.

The GGDR gene is predominantly expressed in leaves and is largely absent in mature tissues lacking chloroplasts. This suggests a correlation between gene transcript levels and the type of plastid and mature tissues [6]. Additionally, GGDR gene expression is induced by light and suppressed under abiotic stress conditions, including low and high temperatures, high salinity, and oxidative stress [7,8]. Giovanna [9] identified the mechanism underlying the light-induced expression of the GGDR gene in tomatoes, concluding that tocopherol accumulation is dependent on photosensitive pigments during fruit ripening under light conditions. The expression of the SlGGDR gene is mediated by phytochrome interaction factor SlPIF3. Under light-deprived conditions, SlPIF3 interacts with the SlGGDR gene promoter, downregulating its expression. Under light conditions, the activation of photosensitive pigments inhibits the interaction between SlPIF3 and the SlGGDR promoter, reducing the repressive effect of SlPIF3 on the SlGGDR gene and enhancing the expression of the SlGGDR gene and PDP availability.

Studies on the role of the GGDR gene in vitamin E synthesis have primarily focused on tobacco, rice, and tomatoes. All ggdr mutant lines derived from rice exhibited marked yellowing and photooxidation, along with a significant decrease in chlorophyll and α-tocopherol content. This underscores the pivotal role of the GGDR gene in high light response and tocopherol synthesis [10,11]. And an appropriate amount of copper promotes the synthesis of chlorophyll and total phenols in Spinacia oleracea and Avena sativa, thereby enhancing the plants’ photosynthetic efficiency and antioxidant capacity [12]. Studies on genes related to vitamin E biosynthesis in tomatoes have been more exhaustive than in other plants. Quadrana [13] constructed the expression profiles of vitamin E synthesis-related genes based on tomato leaves and fruits. These included 18 key genes from MEP, SK, and chlorophyll degradation and vitamin E core synthesis pathways. The results revealed that genes within the tocopherol core synthesis pathway were co-expressed with specific upstream genes. In the later stages of fruit development, the biosynthesis of tocopherol is impeded, primarily due to reduced transcript levels of GGDR genes, which limit the availability of GGDP/PDP.

Genotype, environment, and the interaction between genotype and environment all have an impact on the vitamin E content in soybean seeds. Although there are differences among studies in the magnitude of their influence, it can be ascertained that the genotype effect makes a significant contribution to the variation in vitamin E content in soybeans [14]. Consequently, cloning and transforming functional genes that influence the vitamin E metabolic pathway in soybeans represent the most effective strategies for enhancing vitamin E content in soybean seeds. The GmGGDR gene (Glyma.05G026200), identified as a candidate in this study, was selected based on differential expression data from the transcriptomic analyses of soybean germplasm with high and low vitamin E contents carried out by Vinutha [15]. It is speculated that the GmGGDR gene in soybeans participates in the vitamin E synthesis pathway by producing GGDR.

In this study, the GmGGDR gene from soybean was cloned and analyzed using bioinformatics and expression pattern analysis. Transgenic Arabidopsis and soybean plants were successfully obtained using the Arabidopsis Thaliana floral dip transformation method and the soybean half-seed Agrobacterium-mediated method. The gene’s functions were confirmed through the phenotypic characterization of transgenic lines, demonstrating that the GmGGDR gene significantly enhances stress tolerance and increases vitamin E content in the seeds of both Arabidopsis and soybean.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

The soybean materials used in the experiment included the Canadian variety Bayfield (a high vitamin E content variety), the Heilongjiang variety Hefeng 25 (a low vitamin E content variety), and the Heilongjiang variety Dongnong 50. The Arabidopsis materials included the Columbia-0 ecotype and the Arabidopsis ggdr mutant (SALK_135219C). All materials, including the transgenic materials obtained from the experiment, were cultivated on Murashige-Skoog medium in a growth chamber in 2023 and 2024. The environmental conditions were a 12 h light (25 °C) and 12 h dark (20 °C) cycle, with a moderate light intensity of 100 µmol m⁻² s⁻¹.

2.2. Analysis of GmGGDR Gene Expression Patterns

The soybean varieties Bayfield and He Feng 25 were planted in vermiculite. After the first set of trifoliate leaves fully expanded, leaves from uniformly grown plants were sprayed with 0.1 mM abscisic acid (ABA), 0.1 mM methyl jasmonate (MeJA), 1.5 mM gibberellin A₃ (GA₃), 0.6 mM indole acetic acid (IAA), and 0.5 mM salicylic acid (SA) (Shanghai yuanye Bio-Technology Co., Ltd., Shanghai, China). Samples were collected at 0, 2, 4, 8, 12, and 24 h post-treatment. Separately, 0.1 g samples of leaves, stems, and roots were collected for hormone-induced expression pattern analyses. Moreover, plants exhibiting uniform growth were selected for dynamic expression pattern analysis at the R5-R8 developmental stage.

Young leaves from normally growing soybean plants were selected for total DNA extraction. The total RNA was extracted following the instructions of the RNA Easy Fast Plant Tissue Kit (Tengen, Beijing, China). The reverse transcription reaction was performed using the ReverTra Ace qPCR RT Master Mix with a gDNA Remover (TOYOBO, Shanghai, China). The primers for the candidate GmGGDR gene were designed using Primer Premier 5. Quantitative real-time PCR (qRT-PCR) was conducted with the GmActin4 gene as the endogenous reference. The GmActin4 gene utilized forward primer 5′ GTTTCAAGCTC TTGCTCGTAATCA 3′ and reverse primer 5′ GTGTCAGCCATACTGTCCCCATTT 3′. The qGGDR gene utilized forward primer 5′ CTCTCTCATTCTCTCACTCGTC 3′ and reverse primer 5′ CTTGCAGTTGTCCATCTTTCG 3′.

2.3. Construction of GmGGDR Gene Overexpression Vectors

The GmGGDR gene was cloned using the RT-PCR method, with the forward primer being 5′ ATGAACTCCATAGCCTTCAAATC 3′ and the reverse primer being 5′ TCATACGTTAAGTTTGTTCATCT 3′. The plasmid of the pCAMBIA3300 vector was extracted following the TIANprep Mini Plasmid Kit’s (Tiangen, Beijing, China) protocol, and it was digested with XbaI restriction endonuclease (Tengen, Beijing, China). The target fragment was ligated into the linearized vector using the ClonExpress Ultra One Step Cloning Kit (Novozymes, Nanjing, China). For the GmGGDR-3300, the forward primer was 5′ agaacacgggggactATGAACTCCATAGCC TTCAAATC 3′, and the reverse primer was 5′ atcctctgtttctagTCATACGTTAAGTTTGTTC ATCT 3′. The product of the successful ligation process was transformed into E.coli DH5α competent cells. The bacterial samples exhibiting the correct amplified fragment size were sequenced. The sequences of the sequencing results were opened using DNAMAN 8 software (Lynnon Biosoft Corporation, San Ramon, CA, USA), and strains with correct sequences were selected for subsequent experiments.

2.4. Genetic Transformation of A. thaliana and Glycine max

Floral dipping with Agrobacterium tumefaciens containing the GmGGDR-pCAMBIA3300 recombinant vector was employed for the genetic transformation of A. thaliana. The T0-generation Arabidopsis seeds were screened on an MS medium containing 8 mg/L phosphinothricin (PPT) (Shanghai yuanye Bio-Technology Co., Ltd., Shanghai, China) and cultured in a long-daylight incubator for 7 days. T1-generation DNA was extracted using the CTAB small-volume method. Gene-specific primers for the 35S-GmGGDR, designed based on the partial sequences of the 35S promoter and the GmGGDR gene, were used alongside the Bar primers from the pCAMBIA3300 vector for PCR detection of T1 Arabidopsis plants. For the 35S-GmGGDR, the forward primer was 5′ GCGGTACCGGCAGGCTGAAG 3′, and the reverse primer was 5′ CCGCAGGAACCGCAGGAGTG 3′. For the 3300-bar, the forward primer was 5′ CATTGCCCAGCTATCTGTCACTT 3′, and the reverse primer was 5′ TACTCGTGCGGC TTCAGCGTCCT 3′. Transgenic Arabidopsis plants from the T1 to T3 generations were subjected to successive screening, and ultimately, homozygous T3 transgenic Arabidopsis plants were selected for subsequent experiments.

A. tumefaciens containing the GmGGDR-pCAMBIA3300 recombinant vector was transformed into cotyledons following the soybean half-seed method [16]. DNA-level detection of T0-T2 transgenic soybean plants was performed using the 35S-GmGGDR and 3300-bar primers. Transgenic plants were tested using a bar test strip (Sangon Biotech, Shanghai, China). Positive plants were selected for propagation to successfully obtain transgenic soybean plants.

2.5. Phenotypic Characterization of Transgenic Arabidopsis thaliana and Glycine max

Three replicates of T3 generation A. thaliana lines with the GmGGDR gene, ggdr mutant lines, backcross lines, and Col-0 lines were planted in three types of media containing 75 mM NaCl, 150 mM mannitol (Fuchen Chemical Reagent Co., Ltd., Tianjin, China), and blank MS, and their responses to salt stress were observed on the 5th day after sowing.

The tocopherol contents in Dongnong 50, T2-generation transgenic soybean, Hefeng25, and Bayfield, as well as the wild-type and overexpression lines of Arabidopsis, were determined following Qin Ning’s method [17]. Liquid chromatography conditions were established according to Zhao Xia’s method [18]. Antioxidant enzyme activities, including those of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), were measured. The content of photosynthetic pigments was assessed using the acetone method [19]. Lines 2, 3, and 5, which exhibited significantly higher expression levels, were selected for phenotypic analyses and named Ox-1, Ox-2, and Ox-3, respectively.

2.6. GmGGDR Promoter Transient Expression in Transgenic Tobacco Leaves

Primers for cloning the promoter sequence were designed based on the upstream sequence of the GmGGDR gene obtained from the Phytozome database. XbaI and BglII (New England Biolabs, Inc., Beijing, China) restriction sites from the pCAMBIA3301 vector were introduced at the 5′ ends of the forward and reverse primers, respectively. For the 3301-ggdrpro, the forward primer was 5′-GTACCCGGGGATCCTGAAGTAAGATACAAAT-3′, and the reverse primer was 5′-ATTTACCCTCAGATCTACCATGGTGACGAGTG-3′. DNA was extracted from leaves of the soybean cultivar Bayfield, and the PCR product was cloned. The product was ligated into the pCAMBIA3301 vector using a homologous recombination enzyme and transformed into Agrobacterium tumefaciens GV3101.

Agrobacterium strains containing the 35S::GUS (positive control) and pGmGGDR::GUS recombinant plasmids were cultured to an OD₆₀₀ of 1.0 and infiltrated into the leaves of four-week-old Nicotiana benthamiana plants. After infiltration, the plants were kept in the dark at room temperature for 12 h and then exposed to light for 24 h. The infiltrated plants were then sprayed with 0.1 mM ABA, 0.1 mM MeJA, 1.5 nM GA₃, 0.6 nM IAA, 0.5 mM SA, and distilled water, respectively. After 8 h of hormone treatment, the N. benthamiana leaves were stained for GUS activity. The stained leaves were incubated at 37 °C in the dark for 12 h and then destained with 75% ethanol until the negative control leaf tissues turned white.

2.7. Subcellular Localization of GmGGDR Gene

The GmGGDR-GFP fusion expression vector was constructed using the homologous recombination method. The pCAMBIA1302 vector (GmGGDR-1302) used forward primers 5′ CGGGGGACTCTTGACATGAACTCCATAGCCTTCAAATC 3′ and reverse primer 5′ GTCAGATCTACCATGACGTTAAGTTTGTTCATCTC 3′. Arabidopsis plants were cultivated for 3–4 weeks, and those without shoots were selected. The experiment was performed according to the instructions of the Arabidopsis Protoplast Preparation and Transformation Kit (Coolaber, Beijing, China). After the transformation, an appropriate amount of liquid was aspirated onto a slide, and the fluorescence signal was observed under a laser confocal microscope.

3. Results

3.1. Expression Pattern Analysis of GmGGDR Gene

Analyses of the relative expression levels of the GmGGDR gene in leaves, roots, and stems, along with the total tocopherol content, were conducted in soybean varieties Bayfield (high vitamin E content) and Hefeng 25 (low vitamin E content). The expression patterns of the GmGGDR gene were consistent across different tissues in both varieties, yet Bayfield exhibited higher overall expressions than Hefeng 25. The highest relative expression was detected in leaves, while the lowest was detected in roots. The total tocopherol content mirrored the relative expression levels, with Bayfield showing higher contents than Hefeng 25. The total tocopherol content was higher in Bayfield than in Hefeng 25. The highest total tocopherol content was observed in leaves, and no contents were detected in roots (Figure 1A).

The dynamic expression pattern of the GmGGDR gene and total tocopherol content during the R5-R8 stage were also analyzed for both varieties. The results showed that in both soybean varieties, the GmGGDR gene had a similar expression pattern during the R5-R8 stage. The expression level of the GmGGDR gene showed increasing tendencies, while the contents of the total tocopherol were the highest in the R7 stage (Figure 1B).

The GmGGDR gene’s expression pattern in response to GA₃, ABA, IAA, SA, and MeJA induction was also assessed. In Bayfield, the gene’s expression increased and then decreased under these treatments, peaking at 8 h. In Hefeng 25, peak expression occurred 12 h, 8 h, 8 h, and 8 h post-treatment with respect to GA₃, ABA, IAA, and SA, respectively. Bayfield’s expression level under the GA₃ treatment was 20 times higher than Hefeng 25 (Figure 1C). No significant differences in GmGGDR gene expression were observed between the two varieties after the MeJA treatment. The results showed that the GmGGDR gene was induced by GA₃, ABA, IAA, and SA. GA₃ induced the most significant expression change, while there was no significant difference in the induction effect of MeJA. The transient transformation of tobacco leaves with the GmGGDR promoter resulted in a significant increase in GUS expression upon GA₃ induction (Figure 1H). This suggests that the GmGGDR gene may participate in the GA₃ signaling response.

3.2. GmGGDR Gene Confers Tolerance of Abiotic Stress in Arabidopsis and Soybeans

The subcellular localization of GmGGDR was predicted using the UniProt online tool, suggesting a chloroplast-like vesicle membrane location (Appendix A). The GmGGDR-GFP fusion expression vector was introduced into Arabidopsis protoplasts. Confocal laser microscopy revealed green fluorescence in the nucleus, cytoplasm, and cell membrane in protoplasts containing only GFP under merged light. In contrast, protoplasts with the GmGGDR-GFP fusion vector displayed punctate, intense fluorescence in chloroplasts, confirming GmGGDR’s localization to chloroplasts (Figure 2A).

Transgenic Arabidopsis T0-generation seeds were germinated on an 8 mg/L MS medium containing phosphinothricin for initial screening, and the transgenic T0-generation-positive plants were able to grow normally until all true leaves were fully expanded, unlike non-transgenic Arabidopsis leaves, which died (Appendix B—Figure A2). PCR detection was performed on T1 Arabidopsis plants using the 3300-bar-F/R primers and the GmGGDR gene-specific primers (35S-GGDR-F/R), with three different templates employed: the overexpressing recombinant plasmid as the positive control (P), wild-type Arabidopsis as the negative control (N), and sterile ddH₂O as the blank control (W). The correct PCR product sizes should be around 733 bp and 402 bp (Appendix B—Figure A3 and Figure A4). T1–T3 generations of transgenic Arabidopsis were screened. The homozygous T3 transgenic Arabidopsis plants were obtained and grown under the stress of 75 mM NaCl and 150 mM mannitol.

The growth of the T3 generation of transgenic Arabidopsis (OX) was observed with respect to the GmGGDR gene and wild-type (WT), mutant (M), and complemented (C) lines under the control and 75 mM NaCl salt stress. On the 5th day post-sowing, all four lines grew normally in a blank MS medium; the germination rates of the WT, OX, M, and C lines were 97.22%, 97.22%, 97.22%, and 100%, respectively. However, in an MS medium with 75 mM NaCl, growth retardation and leaf whitening were observed at varying degrees; the germination rates of the WT, OX, M, and C lines were 72.22%, 91.67%, 63.89%, and 88.89%, respectively. Mutants were the most severely affected, with some seeds failing to germinate, primary roots ceasing elongation, and true leaves failing to unfold. In contrast, transgenic GmGGDR lines maintained a relatively high germination rate. The embryonic roots significantly elongated, and the complemented lines mitigated the salt-sensitive phenotype of the ggdr mutants (Figure 2B). These results suggest that the heterologous expression of the GmGGDR gene enhances Arabidopsis tolerance to salt stress.

Drought stress, simulated using 150 mM mannitol, significantly reduced the germination rate of all four Arabidopsis types compared to those in the blank MS medium; the germination rates of the WT, OX, M, and C lines were 88.89%, 94.44%, 66.67%, and 80.56%, respectively. Under drought conditions, compared with wild-type Arabidopsis, the germination rate of transgenic Arabidopsis lines carrying the GmGGDR gene was significantly increased, and the true leaves of some seedlings were able to expand. The ggdr mutant was the most sensitive to drought stress. In contrast, the complementation of the GmGGDR gene partially improved the mutants’ drought tolerance (Figure 2B). These findings indicate that the GmGGDR gene enhanced drought tolerance in Arabidopsis.

In T2 transgenic soybean leaves, the antioxidant enzyme activities of SOD, POD, and CAT were measured. POD activity was significantly increased at the p < 0.01 level in transgenic soybean leaves, increasing by 23.6–38.9% compared to the control. In contrast, the activities of SOD and CAT did not change significantly (Figure 2C). The results indicated that the overexpression of the GmGGDR gene could enhance the antioxidant capacity of soybean leaves.

The photosynthetic pigment contents of the leaves in the T3-generation transgenic Arabidopsis thaliana were determined (Figure 2D). Compared with wild-type Arabidopsis, the chlorophyll content in the leaves of transgenic Arabidopsis thaliana was significantly increased, while chlorophyll a was significantly reduced in the ggdr mutant line. However, the complementation of the GmGGDR gene in the ggdr mutant line could partially increase the contents of chlorophyll a. No significant differences in chlorophyll b and carotenoids were detected among the four lines. These results suggest that GmGGDR primarily increases chlorophyll a content in Arabidopsis leaves.

The chlorophyll content in T2 transgenic soybean lines was significantly increased by approximately 55.6–66.7% compared to the control, while chlorophyll b and carotenoid contents were not significantly different from the control. The GmGGDR gene may be associated with chlorophyll a content in soybean leaves (Figure 2E).

3.3. GmGGDR Gene Enhances Vitamin E Accumulation in Arabidopsis and Soybeans

The tocopherol contents in T3-generation transgenic Arabidopsis thaliana seeds with the GmGGDR gene were determined. The results showed that the α-tocopherol, γ-tocopherol, and δ-tocopherol contents of transgenic plants were, respectively, approximately 177.8–600.0%, 42.9–90.0%, and 17.6–292.9% higher than the control. The total tocopherol content of transgenic Arabidopsis thaliana was about 71.4–127.3% higher than that of wild-type Arabidopsis thaliana, indicating that the GmGGDR gene can significantly increase α-tocopherol, γ-tocopherol, δ-tocopherol, and total tocopherol contents (Figure 3A). This suggests that the heterologous expression of the GmGGDR gene could affect the accumulation of α-tocopherol, γ-tocopherol, δ-tocopherol, and total tocopherol in Arabidopsis seeds.

Five transgenic T0-generation plants were obtained, and three T0-generation plants exhibited a positive detection signal (Appendix C). Three PCR replicates were conducted on T1-generation soybean plants, yielding six plants with stable and positive PCR outcomes (Appendix D). Five T2 transgenic plants with stable performances in the above DNA-level assays were subjected to qRT-PCR in order to verify whether they could be overexpressed in transgenic lines. Dongnong 50, from the same period, was used as a control to compare the relative expression levels of GmGGDR genes (Figure 3B). Finally, lines 2, 3, and 5 with significantly higher expression levels were selected for phenotypic analyses.

The protein and oil contents of three transgenic plants and the control group were measured. The results showed that there were no differences in the protein and oil contents between the transgenic soybeans and the control. This demonstrates that the GmGGDR gene affects the vitamin E content without impacting the quality of protein and oil in soybeans (Figure 3C). α-tocopherol, γ-tocopherol, δ-tocopherol, and total tocopherol contents were at least 42.9%, 27.8%, 7.1%, and 25.0% more than that of the control, indicating that the overexpression of the GmGGDR gene could significantly increase tocopherol contents in soybean seeds (Figure 3D).

4. Discussion

The experiments demonstrated that the GmGGDR gene is involved in plant responses to abiotic stresses. In general, when abiotic and biotic stresses occur in plants, they are often accompanied by an increase in reactive oxygen species (ROS) levels within the plant [20]. To maintain their morphology and physiological functions under adverse conditions, plants employ various mechanisms to scavenge the ROS they produce. Plant antioxidant systems that scavenge ROS can be categorized into two groups: One comprises enzymatic antioxidant systems, primarily involving enzymes such as SOD, POD, and CAT; the other is the non-enzymatic antioxidant system, which primarily targets peroxides, which includes tocopherols that were extensively investigated in this study, as well as ascorbic acid and glutathione. The synergistic action of these two antioxidant systems—targeting the neutralization and scavenging of free radicals to interrupt chain reactions involving free radicals—can efficiently scavenge excess ROS, thereby maintaining intracellular redox homeostasis [21,22,23,24].

In this study, the shoot phenotypes of transgenic Arabidopsis thaliana overexpressing the GmGGDR gene were analyzed under abiotic stress conditions. The overexpression of the GmGGDR gene significantly enhanced the resistance of transgenic lines to salt and drought stress compared to the control. Combining these findings with the determination of tocopherol content, it was hypothesized that the enhanced abiotic stress resistance at the seedling stage of transgenic Arabidopsis thaliana was primarily due to the increased tocopherol content in seeds. Further analyses of antioxidant enzyme activities revealed that POD activity was significantly higher in transgenic soybean leaves than in the control. Concurrently, there was no significant change in SOD and CAT activities, suggesting that the increases in tocopherol contents in the plants may specifically enhance POD activity. The α-tocopherol content in plants was oxidized to tocopherol peroxyl radicals after exerting antioxidant effects and can be reduced back to tocopherol via the Halliwell–Asada cycle (H-A cycle), a process catalyzed via ascorbic acid peroxidase (APX) within the POD enzyme family [25]. Thus, the flux through the H-A cycle increased with elevated tocopherol contents in transgenic plants, resulting in enhanced POD enzyme activity in this study.

The involvement of the GmGGDR gene in tocopherol content was accumulated in soybeans. Vitamin E, an important natural antioxidant, exhibits antioxidant effects in various plant tissues and reproductive stages due to its multiple isomers [26]. Among these isomers, α-tocopherol possesses the highest physiological activity; it is a component of the cell membrane and efficiently scavenges lipid free radicals and reactive oxygen species, playing an essential role in plant stress resistance [27,28]. The GGDR gene family encodes geranylgeranyl diphosphate reductases, which catalyze the conversion of GGDP to PDP, an essential precursor for tocopherol synthesis [29]. Additionally, GGDR is involved in the chlorophyll degradation pathway, in which free phytol can be converted to PDP under the catalytic action of various kinases [30].

The screening of differentially expressed GmGGDR genes in soybean germplasms with high and low tocopherol contents, along with subcellular localization and bioinformatics analyses, revealed that the GmGGDR gene was localized in chloroplasts and lacked transmembrane domains and signal peptides. Bioinformatics analysis confirmed that plastids were the primary site for vitamin E synthesis. Most genes related to vitamin E biosynthesis were localized in plastids, consistent with the results obtained in this study. It is suggested that the protein encoded by the GmGGDR gene may play a role in chloroplasts, which in turn could be involved in the synthesis of vitamin E in soybeans [31,32]. To verify whether the GmGGDR gene was involved in chloroplast-related biological processes, photosynthetic pigments were determined in the leaves of transgenic Arabidopsis and transgenic soybeans. The results showed that the overexpression of the GmGGDR gene could increase the chlorophyll content in leaves. This was consistent with previous results reporting that the deletion of the GGDR gene in tobacco and rice could decrease chlorophyll contents in leaves [11,33]. Analyses of the dynamic expression pattern of the GmGGDR gene in seeds indicated that the relative expression level of the GmGGDR gene in Bayfield tended to keep increasing significantly from R5 to R8. In Hefeng 25, the relative expression level of the GmGGDR gene increased slowly from R5 to R7, and then, it declined at the R8 stage. The R7 stage was a relatively important stage. It was hypothesized that soybean seeds in pods were still partially photosynthesizing during the R5-R7 stage. The tocopherol content of seeds was mainly derived from the de novo synthesis pathway and from the chlorophyll degradation pathway during the R7-R8 stage when chlorophyll began to degrade in immature seeds. The overexpression of the GmGGDR gene in both Arabidopsis and soybean resulted in elevated levels of α-tocopherol, γ-tocopherol, and δ-tocopherol, and a significant enhancement was observed in the total tocopherol content within soybean seeds. Considering the dynamic expression pattern of the GmGGDR gene, it is hypothesized that the GmGGDR gene may modulate tocopherol contents in transgenic plant seeds through distinct metabolic pathways across various reproductive stages.

The exogenous application of GA₃ induced the expression of the GmGGDR gene, thereby promoting tocopherol synthesis in soybeans. Gibberellins (GAs), key endogenous hormones derived from diterpenoids, regulate plant growth and mitigate the effects of water and salt stress during germination and seedling emergence [34,35]. The biosynthesis pathway of gibberellins is divided into three stages: the formation of GGDP, the synthesis of GA₁₂ aldehyde, and the conversion of GA₁₂ aldehyde to other GA forms [36]. GGDP serves as a metabolic nexus for the synthesis of essential isoprenoids, including chlorophylls, tocopherols, luteolin quinones, gibberellins, and carotenoids, with competition among various downstream branches for this substrate [37,38]. In this study, the treatment of soybean plants with high and low vitamin E contents with exogenous GA₃ resulted in a significant upregulation of GmGGDR gene expressions. It is hypothesized that exogenous GA₃ enhances soybean tocopherol synthesis by inducing the upregulation of the GmGGDR gene, facilitating an increased conversion of GGDP to PDP. Quantitative data suggest that GA₃-induced GGDR expression may be elevated, although further experimental evidence is required to substantiate this hypothesis. Concurrently, exogenous GA₃ may perturb the dynamic equilibrium among isoprenoids in plants, channeling more GGDP substrates into the tocopherol synthesis pathway (Figure 4).

5. Conclusions

The candidate gene GmGGDR was subjected to bioinformatics analysis in this experiment. The coding sequence (CDS) of the GmGGDR gene, isolated from the high-vitamin E soybean cultivar Bayfield, is 1389 bp in length. The GmGGDR gene encodes a protein comprising 462 amino acids with a relative molecular mass of 51,200.12, classifying it as a stable hydrophilic protein. This protein is localized to chloroplasts lacking both transmembrane domains and signal peptides.

The tissue-specific and hormone-induced expression patterns of the candidate gene GmGGDR were analyzed. The GmGGDR gene exhibited the highest relative expression levels in leaves. The gene was induced via GA₃, ABA, IAA, and SA. Moreover, GA₃ induces an approximately 8-fold increase in GmGGDR gene expression. The expression levels of the GmGGDR gene displayed a biphasic pattern, increasing initially and then decreasing during the R5-R8 developmental stages of soybeans.

The study thoroughly investigated the role of the GmGGDR gene in enhancing stress resistance in soybean and Arabidopsis. Pure transgenic Arabidopsis thaliana lines harboring the GmGGDR gene were obtained during T3 generation. Under salt and drought stress conditions, the germination rate of these overexpressing lines was significantly higher compared to wild-type, mutant, and complemented lines. This indicates that the heterologous expression of the GmGGDR gene enhances Arabidopsis’s resistance to salt and drought stresses. Three T2 transgenic soybean lines overexpressing the GmGGDR gene were generated using the half-seed genetic transformation method. Antioxidant enzyme POD activity in these transgenic soybean leaves was significantly higher at 23.6–38.9% compared to that of the control.

Moreover, the study thoroughly investigated the role of the GmGGDR gene in enhancing vitamin E biosynthesis in soybean and Arabidopsis. This study demonstrated that the overexpression of the GmGGDR gene significantly increased chlorophyll a contents in the leaves and the tocopherol contents in the seeds of both Arabidopsis and soybeans. The contents of α-tocopherol, γ-tocopherol, δ-tocopherol, and total tocopherol in transgenic Arabidopsis seeds and transgenic soybeans were at least 7.1% to 177.8% higher than those in the control. The elucidation of the function of the GmGGDR gene has laid a theoretical foundation for subsequent research and provided a novel genetic approach for enhancing vitamin E content in soybeans.