ConsensusPrime—A Bioinformatic Pipeline for Efficient Consensus Primer Design—Detection of Various Resistance and Virulence Factors in MRSA—A Case Study
Abstract
1. Introduction
2. Materials and Methods
2.1. Function of the ConsensusPrime Pipeline
2.2. Experimental Evaluation Setup
2.2.1. Bacterial Strains
2.2.2. Genome Sequencing
2.2.3. Genomic DNA Dilution
2.2.4. qPCR Analysis
3. Results
3.1. Primer and Probe Design
3.1.1. Target Genes
3.1.2. Primer Design Parameters
3.1.3. Alignment Filter Thresholds
3.2. Example Case eno
consensus_prime.py --infile eno/eno.fas --primer3 eno/primer3_parameters.txt --outdir eno--consensusthreshold 1.0
3.3. Primer and Probe Evaluation
4. Discussion
4.1. Pitfalls and Challenges in Consensus Primer Design
4.2. Consensus Primer vs. Degenerate Primers
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yoon, H.; Leitner, T. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes. Bioinformatics 2015, 31, 1472–1474. [Google Scholar] [CrossRef]
- Wingo, T.S.; Kotlar, A.; Cutler, D.J. MPD: Multiplex primer design for next-generation targeted sequencing. BMC Bioinform. 2017, 18, 14. [Google Scholar] [CrossRef] [PubMed]
- Hendling, M.; Pabinger, S.; Peters, K.; Wolff, N.; Conzemius, R.; Barišić, I. Oli2go: An automated multiplex oligonucleotide design tool. Nucleic Acids Res. 2018, 46, W252–W256. [Google Scholar] [CrossRef] [PubMed]
- Collatz, M.; Braun, S.D.; Monecke, S.; Ehricht, R. ConsensusPrime—A Bioinformatic Pipeline for Ideal Consensus Primer Design. BioMedInformatics 2022, 2, 637–642. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
- Zielezinski, A.; Vinga, S.; Almeida, J.; Karlowski, W.M. Alignment-free sequence comparison: Benefits, applications, and tools. Genome Biol. 2017, 18, 186. [Google Scholar] [CrossRef] [PubMed]
- Fuda, C.; Fisher, J.; Mobashery, S. β-Lactam resistance in Staphylococcus aureus: The adaptive resistance of a plastic genome. Cell. Mol. Life Sci. 2005, 62, 2617–2633. [Google Scholar] [CrossRef] [PubMed]
- Tristan, A.; Ying, L.; Bes, M.; Etienne, J.; Vandenesch, F.; Lina, G. Use of multiplex PCR to identify Staphylococcus aureus adhesins involved in human hematogenous infections. J. Clin. Microbiol. 2003, 41, 4465–4467. [Google Scholar] [CrossRef]
- Roux, C.M.; DeMuth, J.P.; Dunman, P.M. Characterization of components of the Staphylococcus aureus mRNA degradosome holoenzyme-like complex. J. Bacteriol. 2011, 193, 5520–5526. [Google Scholar] [CrossRef]
- Shore, A.C.; Deasy, E.C.; Slickers, P.; Brennan, G.; O’Connell, B.; Monecke, S.; Ehricht, R.; Coleman, D.C. Detection of staphylococcal cassette chromosome mec type XI carrying highly divergent mecA, mecI, mecR1, blaZ, and ccr genes in human clinical isolates of clonal complex 130 methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2011, 55, 3765–3773. [Google Scholar] [CrossRef]
- García-Álvarez, L.; Holden, M.T.; Lindsay, H.; Webb, C.R.; Brown, D.F.; Curran, M.D.; Walpole, E.; Brooks, K.; Pickard, D.J.; Teale, C.; et al. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: A descriptive study. Lancet Infect. Dis. 2011, 11, 595–603. [Google Scholar] [CrossRef] [PubMed]
- O’neill, A.; McLaws, F.; Kahlmeter, G.; Henriksen, A.; Chopra, I. Genetic basis of resistance to fusidic acid in staphylococci. Antimicrob. Agents Chemother. 2007, 51, 1737–1740. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.-J.; Hung, W.-C.; Tseng, S.-P.; Tsai, J.-C.; Hsueh, P.-R.; Teng, L.-J. Fusidic acid resistance determinants in Staphylococcus aureus clinical isolates. Antimicrob. Agents Chemother. 2010, 54, 4985–4991. [Google Scholar] [CrossRef]
- Chen, C.-M.; Huang, M.; Chen, H.-F.; Ke, S.-C.; Li, C.-R.; Wang, J.-H.; Wu, L.-T. Fusidic acid resistance among clinical isolates of methicillin-resistant Staphylococcus aureus in a Taiwanese hospital. BMC Microbiol. 2011, 11, 98. [Google Scholar] [CrossRef] [PubMed]
- Farrell, D.J.; Castanheira, M.; Chopra, I. Characterization of global patterns and the genetics of fusidic acid resistance. Clin. Infect. Dis. 2011, 52 (Suppl. S7), S487–S492. [Google Scholar] [CrossRef]
- Ito, T.; Katayama, Y.; Asada, K.; Mori, N.; Tsutsumimoto, K.; Tiensasitorn, C.; Hiramatsu, K. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2001, 45, 1323–1336. [Google Scholar] [CrossRef]
- Oliveira, D.C.; Wu, S.W.; de Lencastre, H. Genetic organization of the downstream region of the mecA element in methicillin-resistant Staphylococcus aureus isolates carrying different polymorphisms of this region. Antimicrob. Agents Chemother. 2000, 44, 1906–1910. [Google Scholar] [CrossRef]
- Elements IWGotCoSCC. Classification of staphylococcal cassette chromosome mec (SCCmec): Guidelines for reporting novel SCCmec elements. Antimicrob. Agents Chemother. 2009, 53, 4961. [Google Scholar] [CrossRef]
- Spaan, A.N.; Henry, T.; Van Rooijen, W.J.; Perret, M.; Badiou, C.; Aerts, P.C.; Kemmink, J.; de Haas, C.J.; van Kessel, K.P.; Vandenesch, F.; et al. The staphylococcal toxin Panton-Valentine Leukocidin targets human C5a receptors. Cell Host Microbe 2013, 13, 584–594. [Google Scholar] [CrossRef] [PubMed]
- Zou, D.; Kaneko, J.; Narita, S.; Kamio, Y. Prophage, φPV83-pro, carrying Panton-Valentine leukocidin genes, on the Staphylococcus aureus P83 chromosome: Comparative analysis of the genome structures of φPV83-pro, φPVL, φ11, and other phages. Biosci. Biotechnol. Biochem. 2000, 64, 2631–2643. [Google Scholar] [CrossRef]
- Yamada, T.; Tochimaru, N.; Nakasuji, S.; Hata, E.; Kobayashi, H.; Eguchi, M.; Kaneko, J.; Kamio, Y.; Kaidoh, T.; Takeuchi, S. Leukotoxin family genes in Staphylococcus aureus isolated from domestic animals and prevalence of lukM–lukF-PV genes by bacteriophages in bovine isolates. Vet. Microbiol. 2005, 110, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Kaneko, J.; Muramoto, K.; Kamio, Y. Gene of LukF-PV-like component of Panton-Valentine leukocidin in Staphylococcus aureus P83 is linked with lukM. Biosci. Biotechnol. Biochem. 1997, 61, 541–544. [Google Scholar] [CrossRef]
- Betley, M.J.; Mekalanos, J.J. Nucleotide sequence of the type A staphylococcal enterotoxin gene. J. Bacteriol. 1988, 170, 34–41. [Google Scholar] [CrossRef] [PubMed]
- Borst, D.W.; Betley, M.J. Phage-associated differences in staphylococcal enterotoxin A gene (sea) expression correlate with sea allele class. Infect. Immun. 1994, 62, 113–118. [Google Scholar] [CrossRef]
- Kohler, P.L.; Greenwood, S.D.; Nookala, S.; Kotb, M.; Kranz, D.M.; Schlievert, P.M. Staphylococcus aureus isolates encode variant staphylococcal enterotoxin B proteins that are diverse in superantigenicity and lethality. PLoS ONE 2012, 7, e41157. [Google Scholar] [CrossRef]
- Johler, S.; Sihto, H.-M.; Macori, G.; Stephan, R. Sequence variability in staphylococcal enterotoxin genes seb, sec, and sed. Toxins 2016, 8, 169. [Google Scholar] [CrossRef] [PubMed]
- Abril, A.; Gonzalez-Villa, T.; Barros-Velázquez, J.; Cañas, B.; Sánchez-Pérez, A.; Calo-Mata, P.; Carrera, M. Staphylococcus aureus exotoxins and their detection in the dairy industry and mastitis. Toxins 2020, 12, 537. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3–new capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef]
- Giegerich, R.; Meyer, F.; Schleiermacher, C. (Eds.) GeneFisher-Software Support for the Detection of Postulated Genes; ISMB: San Diego, CA, USA, 1996. [Google Scholar]
- Rose, T.M.; Henikoff, J.G.; Henikoff, S. CODEHOP (COnsensus-DEgenerate hybrid oligonucleotide primer) PCR primer design. Nucleic Acids Res. 2003, 31, 3763–3766. [Google Scholar] [CrossRef]
- Gahoi, S.; Arya, L.; Anil, R. DPPrimer–A Degenerate PCR Primer Design Tool. Bioinformation 2013, 9, 937. [Google Scholar] [CrossRef] [PubMed]

| Organism | Strain ID | Accession Number |
|---|---|---|
| Staphylococcus aureus | Jena-IPHT-124322 | CP155060 |
| Staphylococcus aureus | MW2 | BA000033.2 |
| Staphylococcus aureus | NRS158 | SRS3408576 |
| Staphylococcus aureus | Jena-IPHT-124622 | CP155059 |
| Staphylococcus aureus | Jena-IPHT-97437 | CP155061 |
| Staphylococcus aureus | Jena-IPHT-124982 | CP155058 |
| Staphylococcus aureus | Jena-IPHT-124984 | CP155057 |
| Staphylococcus aureus | Jena-IPHT-94881 | CP155063 |
| Staphylococcus aureus | Jena-IPHT-95377 | CP155062 |
| Staphylococcus aureus | M10/0061 | FR823292.1 |
| Staphylococcus aureus | N315 | BA000018.3 |
| Staphylococcus aureus | NCTC8325 | CP000253.1 |
| Staphylococcus aureus | TCH1516 | CP000730.1 |
| Staphylococcus aureus | MSSA476 | BX571857.1 |
| Staphylococcus epidermidis | RP62A | NC_002976.3 |
| eno | mecC | fusC | lukF-PV | lukF-PV(P83) | entA | entB (SEB) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| (Human) | (Bovine) | |||||||||||||||||||||
| Strain ID | Species | Exp. | Ct avg. | Res. | Exp. | Ct avg. | Res. | Exp. | Ct avg. | Res. | Exp. | Ct avg. | Res. | Exp. | Ct avg. | Res. | Exp. | Ct avg. | Res. | Exp. | Ct avg. | Res. |
| 124322 | Staphylococcus aureus | POS | 34.9 | TP | NEG | N/A | TN | NEG | N/A | TN | POS | 37.6 | TP | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN |
| 124664 | Staphylococcus aureus | POS | 33.7 | TP | NEG | N/A | TN | NEG | N/A | TN | POS | 37.7 | TP | NEG | N/A | TN | POS | 33.8 | TP | NEG | N/A | TN |
| 124670 | Staphylococcus aureus | POS | 35.1 | TP | NEG | N/A | TN | NEG | N/A | TN | POS | 38.2 | TP | NEG | N/A | TN | NEG | N/A | TN | POS | 34.6 | TP |
| 124622 | Staphylococcus aureus | POS | 34.5 | TP | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | POS | 34.2 | TP | NEG | N/A | TN | NEG | N/A | TN |
| 97437 | Staphylococcus aureus | POS | 34.8 | TP | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | POS | 35.5 | TP | NEG | N/A | TN | NEG | N/A | TN |
| 124982 | Staphylococcus aureus | POS | 34.8 | TP | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | POS | 33.9 | TP | NEG | N/A | TN | NEG | N/A | TN |
| 124984 | Staphylococcus aureus | POS | 34.6 | TP | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | POS | 33.7 | TP | NEG | N/A | TN | NEG | N/A | TN |
| 94881 | Staphylococcus aureus | POS | 34.2 | TP | POS | 34.9 | TP | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN |
| 95377 | Staphylococcus aureus | POS | 34.2 | TP | POS | 34.8 | TP | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN |
| 95422 | Staphylococcus aureus | POS | 35.4 | TP | POS | 35.1 | TP | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN |
| 95424 | Staphylococcus aureus | POS | 33.5 | TP | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN |
| 95427 | Staphylococcus aureus | POS | 34.8 | TP | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN |
| 95430 | Staphylococcus aureus | POS | 34.7 | TP | NEG | N/A | TN | NEG | N/A | TN | POS | 38.3 | TP | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN |
| 124717 | Staphylococcus aureus | POS | 38.1 | TP | NEG | N/A | TN | POS | 33.2 | TP | NEG | N/A | TN | NEG | N/A | TN | POS | 33.9 | TP | NEG | N/A | TN |
| 95428 | Staphylococcus epidermidis | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN | NEG | N/A | TN |
| Fasta/Alignment | Number of Sequences |
|---|---|
| Input sequences | 304 |
| Unique sequences | 46 |
| Unique similar sequences | 45 |
| PRIMER_LEFT_1_SEQUENCE_FWD (5′-3′) | TGCCAATTATTACAGATGTTTACGC |
| PRIMER_RIGHT_1_SEQUENCE_REV | CCATCAGGTGCTTCAACTGG |
| PRIMER_RIGHT_1_SEQUENCE_REVCOMP (5′-3′) | CCAGTTGAAGCACCTGATGG |
| PRIMER_INTERNAL_1_SEQUENCE | CGCGAAGTCTTAGACTCTCGTGGTAACCCAACTGT |
| Name | Sequence 5′-3′ | Tm-Value | Product Size |
|---|---|---|---|
| eno_0_fwd | TGCCAATTATTACAGATGTTTACGC | 55.8 | 130 |
| eno_1_rev | CCAGTTGAAGCACCTGATGG | 56.15 | 130 |
| eno_0_probe | CGCGAAGTCTTAGACTCTCGTGGTAACCCAACTGT | 68.54 | 130 |
| mecC_4_fwd | TTTGCCCGCATTGCATTAGC | 57.8 | 178 |
| mecC_4_rev | CTAGTATCTCGCCTTGGCCA | 56.26 | 178 |
| mecC_4_probe | TGCAAGATTTGGGAATCGGTGAAAATATCCCG | 64.59 | 178 |
| fusC_0_fwd | CGGACTTTATTACATCGATTGACG | 55.46 | 281 |
| fusC_0_rev | TGAAATTTCGCCATATATACCTTCG | 54.93 | 281 |
| fusC_0_probe | CCAAGATTTTGAAATACCTTCATCAAGTCAACTGG | 62.12 | 281 |
| entA_0_fwd | CCACCCGCACATTGATAACC | 56.6 | 300 |
| entA_0_rev | TGGTAGCGAGAAAAGCGAAG | 55.66 | 300 |
| entA_0_probe | TGCCTAAAGCTGTTCCCTGCAATTCAGACT | 65.34 | 300 |
| lukF-PV_P83_0_fwd | TGCCCATATTAGCACGTGGT | 56.73 | 191 |
| lukF-PV_P83_0_rev | TGATGTGTGTGTTGCTCTCT | 54.39 | 191 |
| lukF-PV_P83_0_probe 1 | GGATCGGTATGAAAATTTTTGGAACAACTTGCACTGG | 65.5 | 191 |
| lukF-PV_2_fwd 2 | CAATTGCATTGCTTTTGCTATCC | 55.18 | 111 |
| lukF-PV_6_rev | TGATGTTGCAGTTGTTTTGTACA | 54.97 | 111 |
| lukF_PV_2_probe 3 | GATGCAGCTCAACATATCACACCTGTAAGTGAG | 64.17 | 111 |
| entB_0_fwd | ACGTAGATGTGTTTGGAGCTAA | 54.76 | 266 |
| entB_0_rev | CACCAAATAGTGACGAGTTAGGT | 55.47 | 266 |
| entB_0_probe | TGTATGGTGGTGTAACTGAGCATAATGGAAACCA | 64.65 | 266 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Collatz, M.; Reinicke, M.; Diezel, C.; Braun, S.D.; Monecke, S.; Reissig, A.; Ehricht, R. ConsensusPrime—A Bioinformatic Pipeline for Efficient Consensus Primer Design—Detection of Various Resistance and Virulence Factors in MRSA—A Case Study. BioMedInformatics 2024, 4, 1249-1261. https://doi.org/10.3390/biomedinformatics4020068
Collatz M, Reinicke M, Diezel C, Braun SD, Monecke S, Reissig A, Ehricht R. ConsensusPrime—A Bioinformatic Pipeline for Efficient Consensus Primer Design—Detection of Various Resistance and Virulence Factors in MRSA—A Case Study. BioMedInformatics. 2024; 4(2):1249-1261. https://doi.org/10.3390/biomedinformatics4020068
Chicago/Turabian StyleCollatz, Maximilian, Martin Reinicke, Celia Diezel, Sascha D. Braun, Stefan Monecke, Annett Reissig, and Ralf Ehricht. 2024. "ConsensusPrime—A Bioinformatic Pipeline for Efficient Consensus Primer Design—Detection of Various Resistance and Virulence Factors in MRSA—A Case Study" BioMedInformatics 4, no. 2: 1249-1261. https://doi.org/10.3390/biomedinformatics4020068
APA StyleCollatz, M., Reinicke, M., Diezel, C., Braun, S. D., Monecke, S., Reissig, A., & Ehricht, R. (2024). ConsensusPrime—A Bioinformatic Pipeline for Efficient Consensus Primer Design—Detection of Various Resistance and Virulence Factors in MRSA—A Case Study. BioMedInformatics, 4(2), 1249-1261. https://doi.org/10.3390/biomedinformatics4020068

