Astrocyte-Conditioned Medium Induces Protection Against Ischaemic Injury in Primary Rat Neurons
Abstract
1. Introduction
2. Experimental Procedures
2.1. Materials
2.2. Cell Culture
2.2.1. Primary Rat Astrocyte Culture Preparation
2.2.2. Primary Cortical Rat Neurons Culture
2.3. Oxygen and Glucose Deprivation (OGD)
2.4. Applying Astrocyte-Conditioned Media onto Primary Rat Neuron Culture
2.5. Assessment of Cell Viability
2.5.1. 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) Assays
2.5.2. Lactate Dehydrogenase (LDH) Release Assay
2.6. Immunofluorescence
2.7. Protein Extraction and Western Immunoblotting
2.8. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.9. Data Analysis
3. Results
3.1. Primary Rat Astrocytes Culture
3.2. Effect of ACM on Primary Rat Neurons Following 6 h Oxygen and Glucose Deprivation
4. Discussion
5. Limitations and Future Directions
6. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknolwdegments
Conflicts of Interest
References
- Patabendige, A.; Singh, A.; Jenkins, S.; Sen, J.; Chen, R. Astrocyte Activation in Neurovascular Damage and Repair Following Ischaemic Stroke. Int. J. Mol. Sci. 2021, 22, 4280. [Google Scholar] [CrossRef] [PubMed]
- O’Shea, T.M.; Ao, Y.; Wang, S.; Fiacco, T.A.; Chen, K.; Zamanian, J.L.; Bonnah, R.A.; Eyo, U.B.; Sofroniew, M.V. Derivation and transcriptional reprogramming of border-forming wound repair astrocytes after spinal cord injury or stroke in mice. Nat. Neurosci. 2024, 27, 1505–1521. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Chopp, M. Astrocytes, therapeutic targets for neuroprotection and neurorestoration in ischemic stroke. Prog. Neurobiol. 2016, 144, 103–120. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Gao, K.; Wang, L.; Wang, J.; Qin, M.; Wang, X.; Lian, K.; Li, C.; Gao, S.; Sun, C. Astrocytes: Therapeutic targets for stroke. Neural Regen. Res. 2025, 21, 1074–1088. [Google Scholar] [CrossRef]
- Becerra-Calixto, A.; Cardona-Gómez, G.P. The Role of Astrocytes in Neuroprotection after Brain Stroke: Potential in Cell Therapy. Front. Mol. Neurosci. 2017, 10, 88. [Google Scholar] [CrossRef]
- Bylicky, M.A.; Mueller, G.P.; Day, R.M. Mechanisms of Endogenous Neuroprotective Effects of Astrocytes in Brain Injury. Oxid. Med. Cell. Longev. 2018, 2018, 6501031. [Google Scholar] [CrossRef]
- Vangeison, G.; Carr, D.; Federoff, H.J.; Rempe, D.A. The good, the bad, and the cell type-specific roles of hypoxia inducible factor-1 alpha in neurons and astrocytes. J. Neurosci. 2008, 28, 1988–1993. [Google Scholar] [CrossRef]
- Chen, R.L.; Lai, U.H.; Zhu, L.L.; Singh, A.; Ahmed, M.; Forsyth, N.R. Reactive Oxygen Species (ROS) formation in the brain at different oxygen Levels: Role of hypoxia inducible factors. Front. Cell Dev. Biol. 2018, 6, 132. [Google Scholar] [CrossRef]
- Hassan, H.; Chen, R.L. Hypoxia in Alzheimer’s disease: Effects of hypoxia inducible factors. Neural Regen. Res. 2021, 16, 310–311. [Google Scholar]
- Chen, B.Y.; Wang, X.; Wang, Z.Y.; Wang, Y.Z.; Chen, L.W. GDNF: A key molecule for modulating neurogenesis and neuronal survival in the adult brain. Int. J. Mol. Sci. 2013, 14, 8103–8120. [Google Scholar]
- Zhou, Y.; Wang, Y.; Wang, J.; Anne Stetler, R.; Yang, Q.W. The roles of glial cells in ischemic stroke. Front. Cell. Neurosci. 2019, 13, 242. [Google Scholar]
- Li, X.; Zhang, L.; Guo, X.; Xu, J.; Zhang, Q.; Liu, Y.; Wang, Q.; Zhao, J. Astrocytes protect human brain microvascular endothelial cells from hypoxia injury by regulating VEGF expression. J. Cereb. Blood Flow Metab. 2024, 44, 254–266. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.H.; Lee, S.H. Regulation of neurotrophic factors by HIFs and their role in neurogenesis under hypoxia. Front. Neurosci. 2018, 12, 706. [Google Scholar]
- Hollingworth, B.Y.A.; Pallier, P.N.; Jenkins, S.I.; Chen, R. Hypoxic Neuroinflammation in the Pathogenesis of Multiple Sclerosis. Brain Sci. 2025, 15, 248. [Google Scholar] [CrossRef]
- Dhandapani, K.M.; Hadman, M.; De Sevilla, L.; Wade, M.F.; Mahesh, V.B.; Brann, D.W. Astrocyte protection of neurons: Role of transforming growth factor-beta signaling via a c-Jun-AP-1 protective pathway. J. Biol. Chem. 2003, 278, 43329–43339. [Google Scholar] [CrossRef]
- Lu, X.; Al-Aref, R.; Zhao, D.; Shen, J.; Yan, Y.; Gao, Y. Astrocyte-conditioned medium attenuates glutamate-induced apoptotic cell death in primary cultured spinal cord neurons of rats. Neurol. Res. 2015, 37, 803–808. [Google Scholar] [CrossRef]
- Song, C.; Wu, Y.; Yang, Z.; Kalueff, A.; Tsao, Y.; Dong, Y.; Su, K. Astrocyte-Conditioned Medium Protects Prefrontal Cortical Neurons from Glutamate-Induced Cell Death by Inhibiting TNF-α Expression. Neuroimmunomodulation 2019, 26, 33–42. [Google Scholar] [CrossRef]
- Singh, A.; Wilson, J.W.; Schofield, C.J.; Chen, R.L. Hypoxia-inducible factor (HIF) prolyl hydroxylase inhibitors induce autophagy and have a protective effect in an in-vitro ischaemia model. Sci. Rep. 2020, 10, 1597. [Google Scholar] [CrossRef]
- Paquet, M.; Ribeiro, F.M.; Guadagno, J.; Esseltine, J.L.; Ferguson, S.S.G.; Cregan, S.P. Role of metabotropic glutamate receptor 5 signaling and homer in oxygen glucose deprivation-mediated astrocyte apoptosis. Mol. Brain 2013, 6, 9–21. [Google Scholar] [CrossRef]
- Singh, A.; Chow, O.; Jenkins, S.J.; Zhu, L.L.; Rose, E.; Astbury, K.; Chen, R.L. Characterizing ischaemic tolerance in PC 12 Cells and primary rat neurons. Neuroscience 2021, 453, 17–31. [Google Scholar] [CrossRef]
- Li, L.; Zhang, J. Astrocytes in ischemic stroke: Physiological and pathophysiological responses and therapeutic implications. Neurochem. Int. 2016, 107, 37–49. [Google Scholar]
- Bakleh, M.Z.; Al Haj Zen, A. The Distinct Role of HIF-1α and HIF-2α in Hypoxia and Angiogenesis. Cells 2025, 14, 673. [Google Scholar] [CrossRef]
- Ruscher, K.; Wieloch, T. The involvement of hypoxia-inducible factor-1α (HIF-1α) in the inflammatory response following ischemic stroke. Acta Physiol. 2015, 213, 722–729. [Google Scholar]
- Rankin, E.B.; Giaccia, A.J. The duration of oxygen and glucose deprivation (OGD) determines astrocyte fate: BNIP3 is significantly upregulated only by prolonged (24 h) OGD (~32-fold), triggering astrocyte apoptosis. PLoS ONE 2023, 18, e10138834. [Google Scholar]
- Bernaudin, M.; Bellail, A.; Marti, H.H.; Yvon, A.; Vivien, D.; Duchatelle, I.; Mackenzie, E.T.; Petit, E. Neurons and astrocytes express hypoxia-inducible factor-1α (HIF-1α) and vascular endothelial growth factor (VEGF) in response to hypoxia: Effect of exogenous VEGF on ischemic brain injury. J. Cereb. Blood Flow Metab. 2002, 22, 393–403. [Google Scholar] [CrossRef] [PubMed]
- Dang, J.; Liu, C.; Cheng, X.; Zhang, X.; Li, Y.; Xiao, Q.; Wang, Y.; Zhang, J. Astrocytes are a major source of erythropoietin (EPO) in the ischemic brain, and astrocyte-derived EPO reduces neuronal apoptosis. Front. Cell. Neurosci. 2021, 15, 755955. [Google Scholar]
- Dabertrand, F.; Armand, A.S.; Knoepfel, A.K.; Morel, S.; Kubis, N.; Gauthier, V.; Besse, A.; Tissier, F.; Aussedat, A.; Frei, R.; et al. Effects of oxygen–glucose deprivation and reperfusion on barrier properties of a co-culture blood–brain barrier model. PLoS ONE 2019, 14, e0209610. [Google Scholar]
- Qiu, J.; Zhang, C.; Lv, Y.; Zhang, Y.; Zhu, C.; Wang, X.; Yao, W. Cdh1 inhibits reactive astrocyte proliferation after oxygen-glucose deprivation and reperfusion. Neurochem. Int. 2013, 63, 87–92. [Google Scholar] [CrossRef]
- Zhang, J.; Zhang, Y.; Sun, W.; Ren, H. Hypoxia-inducible factor-1α (HIF-1α) promotes lactate production and astrocyte survival under hypoxia by regulating LDHA expression. J. Mol. Neurosci. 2017, 63, 351–359. [Google Scholar]
- Samy, Z.A.; Al-Abdullah, L.; Turcani, M.; Craik, J.; Redzic, Z. Rat astrocytes during anoxia: Secretome profile of cytokines and chemokines. Brain Behav. 2018, 8, 13–27. [Google Scholar] [CrossRef]
- Hao, H.; Hou, Y.; Li, A.; Niu, L.; Li, S.; He, B.; Zhang, X.; Song, H.; Cai, R.; Zhou, Y.; et al. Astrocytic HIF-1α drives production of macrophage migration inhibitory factor (MIF) after spinal cord injury. CNS Neurosci. Ther. 2023, 29, 84–95. [Google Scholar] [CrossRef]
- Gougeon, P.; Lourenssen, S.; Han, T.Y.; Nair, D.G.; Ropeleski, M.J.; Blennerhassett, M.G. The pro-inflammatory cytokines IL-1β and TNFα are neurotrophic for enteric neurons. J. Neurosci. 2013, 33, 3339–3351. [Google Scholar] [CrossRef] [PubMed]
- Lau, L.T.; Yu, A.C. Astrocytes Produce and Release Interleukin-1, Interleukin-6, Tumor Necrosis Factor Alpha and Interferon-Gamma Following Traumatic and Metabolic Injury. J. Neurotrauma 2001, 18, 351–359. [Google Scholar] [CrossRef] [PubMed]
- Fontaine, R.H.; Massillon, L.; Margaill, I.; Garnier, P.; Kadota, S.; Gressens, P.; Baud, O. Tumor necrosis factor-α and ischemic injury: Mechanisms of protection and injury. Neurochem. Res. 2002, 27, 653–663. [Google Scholar]
- Diniz, L.P.; Tortelli, V.; Matias, I.; Morgado, J.; Bérgamo de Queiroz, S.; Melo, H.M.; Seixas da Silva, G.S.; Alves-Leon, S.V.; de Souza, J.M.; De Felice, F.G.; et al. Astrocyte-induced synaptogenesis is mediated by transforming growth factor β signaling through modulation of D-serine levels in cerebral cortex neurons. J. Biol. Chem. 2014, 289, 6834–6845. [Google Scholar] [CrossRef]
- Hur, Y.; Levison, S.W. Neuroprotective effects of delayed TGF-β1 receptor antagonist administration on perinatal hypoxic-ischemic brain injury. Dev. Neurosci. 2023, 46, 188–198. [Google Scholar]
- Li, C.; Cheng, Y.; Liu, C.; Xu, J.; Zheng, Z. TGF-β1 confers protection against mechanical injury-induced autophagy and apoptosis in cortical neurons. Front. Cell. Neurosci. 2024, 18, 1381279. [Google Scholar] [CrossRef]
- Alqawlaq, S.; Livine-Bar, I.; Chan, D.; Sivak, J.M. Retinal astrocytes protect neurons against metabolic stress by inducing the PI3K pathway. Invest. Ophthalmol. Vis. Sci. 2016, 57, 4213–4230. [Google Scholar]
- Li, Y.N.; Fang, Y.; Zhu, G.L.; Wang, X.T.; Huang, F.L.; Li, X. Astrocyte-conditioned medium containing VEGF increases autophagy marker LC3-II in primary neurons after oxygen–glucose deprivation, reducing cell death. J. Neurochem. 2022, 160, 321–334. [Google Scholar]
- Zhang, Y.H.; Chen, R.L.; Liu, Y.J.; Xu, X.L.; Sun, Y.; Li, Z.P. IL-10 and TGF-β from activated astrocytes cooperate to enhance autophagic clearance of damaged mitochondria in neurons, protecting against ischemic apoptosis. Neurosci. Lett. 2023, 789, 136–942. [Google Scholar]
- Kim, K.; Shin, D.; Kim, J.; Shin, Y.; Rajanikant, G.K.; Majid, A.; Baek, S.; Bae, O. Role of Autophagy in Endothelial Damage and Blood-Brain Barrier Disruption in Ischemic Stroke. Stroke 2018, 49, 1571–1579. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Zhang, X.; Chen, X.; Wang, L.; Yang, G. Exosome Mediated Delivery of miR-124 Promotes Neurogenesis after Ischemia. Mol. Ther. Nucleic Acids 2017, 7, 278–287. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Cao, H.; Xie, Y.; Zhang, Y.; Du, M.; Xu, X.; Ye, R.; Liu, X. Exosome-shuttled miR-92b-3p from ischemic preconditioned astrocytes protects neurons against oxygen and glucose deprivation. Brain Res. 2019, 1717, 66–73. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Liang, C.; Guo, S.; Huang, Y.; Liang, G. Therapeutic potential of astrocyte-derived extracellular vesicles in ischemic stroke: Mechanisms and future prospects. Aging Dis. 2024, 15, 1227–1254. [Google Scholar]
- Díaz-Guerra, M.; Velasco, A.; Avila, J.; Hernández, F. Inflammatory response in preconditioning: A new approach to a classical mechanism. Int. J. Mol. Sci. 2020, 21, 556. [Google Scholar]
- Lee, H.; Yoon, Y.; Lee, M. Neuroprotective role of astrocyte-derived exosomes in oxygen-glucose deprivation-induced neuronal injury. Biochem. Biophys. Res. Commun. 2022, 606, 110–117. [Google Scholar]
- Liddelow, S.A.; Guttenplan, K.A.; Clarke, L.E.; Bennett, F.C.; Bohlen, C.J.; Schirmer, L.; Bennett, M.L.; Münch, A.E.; Chung, W.S.; Peterson, T.C.; et al. Neurotoxic reactive astrocytes are induced by activated microglia. Nature 2017, 541, 481–487. [Google Scholar] [CrossRef]
- Jha, M.K.; Morrison, B.M. Lactate transporters mediate glia-neuron metabolic crosstalk in homeostasis and disease. Front. Cell. Neurosci. 2020, 14, 589582. [Google Scholar] [CrossRef]
- Wu, Q.; Zhang, X.; Shao, M.; Zhang, C.; Sun, Y.; Liu, J.; Wang, Q.; Huang, Y.; Wang, T. Dysfunctional autophagy in astrocytes contributes to chronic stress-induced cognitive impairments. Cell Death Dis. 2021, 12, 760. [Google Scholar]








| HIF1α | FW TCAAGTCAGCAACGTGGAAG RV TATCGAGGCTGTGTCGACTG |
| Glut1 | FW GGTGTGCAGCAGCCTGTGTA RV GACGAAC AGCGACACCACAGT |
| Bnip3 | FW TTTAAACACCCGAAGCGCACAG RV GTTGTCAGACGCCTTCCAATGTAGA |
| Phd2 | FW TGCATACGCCACAAGGTACG RV GTAGGTGACGCGGGTACTGC |
| Vegf | FW TTACTGCTGTACCTCCAC RV ACAGGACGGCTTGAAGATA |
| Bnip3 | FW TTTAAACACCCGAAGCGCACAG RV TTGTCAGACGCCTTCCAATGTAGA |
| Pfkfb1 | FW AACCGCAACATGACCTTCCT RV CAACACAGAGGCCCAGCTTA |
| Pfkfb3 | FW CTGTCCAGCAGAGGCAAGAA RV CGCGGTCTGGATGGTACTTT |
| Ldh-a | FW AAGGTTATGGCTCCCTTGGC RV TAGTGACGTGTGACAGTGCC |
| Actin | FW TGCCCTAGACTTCGAGCAAGA RV CATGGATGCCACAGGATTCCATAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Singh, A.; Chen, R. Astrocyte-Conditioned Medium Induces Protection Against Ischaemic Injury in Primary Rat Neurons. Neuroglia 2025, 6, 27. https://doi.org/10.3390/neuroglia6030027
Singh A, Chen R. Astrocyte-Conditioned Medium Induces Protection Against Ischaemic Injury in Primary Rat Neurons. Neuroglia. 2025; 6(3):27. https://doi.org/10.3390/neuroglia6030027
Chicago/Turabian StyleSingh, Ayesha, and Ruoli Chen. 2025. "Astrocyte-Conditioned Medium Induces Protection Against Ischaemic Injury in Primary Rat Neurons" Neuroglia 6, no. 3: 27. https://doi.org/10.3390/neuroglia6030027
APA StyleSingh, A., & Chen, R. (2025). Astrocyte-Conditioned Medium Induces Protection Against Ischaemic Injury in Primary Rat Neurons. Neuroglia, 6(3), 27. https://doi.org/10.3390/neuroglia6030027

