Effect of CRISPR/Cas9 Targets Associated with Iron Metabolism and Its Variation on Transcriptional Regulation of SHK-1 Cell Line as a Model for Iron Metabolism
Abstract
1. Introduction
2. Materials and Methods
2.1. CRISPR-Cas9 Target Selection and Guide Design
2.2. Cell Culture and Electroporation Protocol
2.3. DNA Editing Efficiency and KO Determination
2.4. RNA Sequencing, Raw Data Filtering, Mapping, and Differential Expression Analysis
2.5. GO Enrichment Analysis
3. Results
3.1. CRISPR-Cas9 Editing System for TIII and TVIII in SHK-1 Cells
3.2. Gene Expression of Transferrin-Related Transcripts
3.3. Differentially Expression in SHK-1 Cell Line in Response to CRISPR-Cas9 Target Guide
3.4. GO Enrichment and KEGG Pathway Analysis in SHK-1 Wild-Type and CRISPR Lines
4. Discussion
4.1. Fish Cell Lines and CRISPR-Cas9 System as Genome-Editing Tool for the Study on Iron-Related Gene
4.2. Considerations in Biological Variability in Response to CRISPR-Cas9 Edited Organism
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gratacap, R.L.; Wargelius, A.; Edvardsen, R.B.; Houston, R.D. Potential of Genome Editing to Improve Aquaculture Breeding and Production. Trends Genet. 2019, 35, 672–684. [Google Scholar] [CrossRef]
- Roy, S.; Kumar, V.; Behera, B.K.; Parhi, J.; Mohapatra, S.; Chakraborty, T.; Das, B.K. CRISPR/Cas Genome Editing—Can It Become a Game Changer in Future Fisheries Sector? Front. Mar. Sci. 2022, 9, 924475. [Google Scholar] [CrossRef]
- Goswami, M.; Yashwanth, B.S.; Trudeau, V.; Lakra, W.S. Role and Relevance of Fish Cell Lines in Advanced In Vitro Research. Mol. Biol. Rep. 2022, 49, 2393–2411. [Google Scholar] [CrossRef] [PubMed]
- Strømsnes, T.A.H.; Schmidke, S.E. CRISPR/Cas9-Mediated Gene Editing in Salmonids Cells and Efficient Establishment of Edited Clonal Cell Lines. Int. J. Mol. Sci. 2022, 23, 16218. [Google Scholar] [CrossRef] [PubMed]
- Dehler, C.E.; Boudinot, P.; Martin, S.A.M.; Collet, B. Development of an Efficient Genome Editing Method by CRISPR/Cas9 in a Fish Cell Line. Mar. Biotechnol. 2016, 18, 449–452. [Google Scholar] [CrossRef] [PubMed]
- Escobar-Aguirre, S.; Arancibia, D.; Escorza, A.; Bravo, C.; Andrés, M.E.; Zamorano, P.; Martínez, V. Development of a Bicistronic Vector for the Expression of a CRISPR/Cas9-mCherry System in Fish Cell Lines. Cells 2019, 8, 75. [Google Scholar] [CrossRef] [PubMed]
- Gratacap, R.L.; Jin, Y.H.; Mantsopoulou, M.; Houston, R.D. Efficient Genome Editing in Multiple Salmonid Cell Lines Using Ribonucleoprotein Complexes. Mar. Biotechnol. 2020, 22, 717–724. [Google Scholar] [CrossRef] [PubMed]
- Ferdous, M.A.; Islam, S.I.; Habib, N.; Almehmadi, M.; Allahyani, M.; Alsaiari, A.A.; Shafie, A. CRISPR-Cas Genome Editing Technique for Fish Disease Management: Current Study and Future Perspective. Microorganisms 2022, 10, 2012. [Google Scholar] [CrossRef] [PubMed]
- Brazelton, V.A., Jr.; Zarecor, S.; Wright, D.A.; Wang, Y.; Liu, J.; Chen, K.; Yang, B.; Lawrence-Dill, C.J. A Quick Guide to CRISPR sgRNA Design Tools. GM Crops Food 2015, 6, 266–276. [Google Scholar] [CrossRef]
- Qian, X.; Ba, Y.; Zhuang, Q.; Zhong, G. RNA-Seq Technology and Its Application in Fish Transcriptomics. OMICS J. Integr. Biol. 2014, 18, 98–110. [Google Scholar] [CrossRef]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. 2010. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc (accessed on 16 April 2024).
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Bray, N.L.; Pimentel, H.; Melsted, P.; Pachter, L. Near-optimal probabilistic RNA-seq quantification. Nat. Biotechnol. 2016, 34, 525–527. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Molina, A.; Dettleff, P.; Valenzuela-Muñoz, V.; Gallardo-Escarate, C.; Valdés, J.A. High-Temperature Stress Induces Autophagy in Rainbow Trout Skeletal Muscle. Fishes 2023, 8, 303. [Google Scholar] [CrossRef]
- Wang, H.; La Russa, M.; Qi, L.S. CRISPR/Cas9 in Genome Editing and Beyond. Annu. Rev. Biochem. 2016, 85, 227–264. [Google Scholar] [CrossRef] [PubMed]
- Gebre, M.; Nomburg, J.L.; Gewurz, B.E. CRISPR-Cas9 Genetic Analysis of Virus-Host Interactions. Viruses 2018, 10, 55. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.; Zhang, Q.M.; Zhao, M.Y.; Wang, X.; Zhang, Y.L.; Gan, B.Y.; Zhang, P.J. The deubiquitinase ZRANB1 is an E3 ubiquitin ligase for SLC7A11 and regulates ferroptotic resistance. J. Cell Biol. 2023, 222, e202212072. [Google Scholar] [CrossRef] [PubMed]
- Burgess, D.J. Genetic screens: Combining CRISPR perturbations and RNA-seq. Nat. Rev. Genet. 2017, 18, 67. [Google Scholar] [CrossRef] [PubMed]
- Lee, L.E.; Dayeh, V.R.; Schirmer, K.; Bols, N.C. Applications and potential uses of fish gill cell lines: Examples with RTgill-W1. In vitro cellular & developmental biology. Animal 2009, 45, 127–134. [Google Scholar] [CrossRef]
- Levican-Asenjo, J.; Soto-Rifo, R.; Aguayo, F.; Gaggero, A.; Leon, O. Salmon cells SHK-1 internalize infectious pancreatic necrosis virus by macropinocytosis. J. Fish Dis. 2019, 42, 1035–1046. [Google Scholar] [CrossRef]
- Leal, Y.; Valenzuela-Muñoz, V.; Gallardo-Escárate, C. Alternative splicing in Atlantic salmon head kidney and SHK-1 cell line during the Piscirickettsia salmonis infection: A comparative transcriptome survey. Fish Shellfish Immunol. 2023, 142, 109127. [Google Scholar] [CrossRef] [PubMed]
- Leal, Y.; Valenzuela-Munoz, V.; Casuso, A.; Benavente, B.P.; Gallardo-Escarate, C. Comparative Transcriptomics in Atlantic Salmon Head Kidney and SHK-1 Cell Line Exposed to the Sea Louse Cr-Cathepsin. Genes 2023, 14, 905. [Google Scholar] [CrossRef] [PubMed]
- Diaz, R.; Troncoso, J.; Jakob, E.; Skugor, S. Limiting access to iron decreases infection of Atlantic salmon SHK-1 cells with bacterium Piscirickettsia salmonis. BMC Vet. Res. 2021, 17, 155. [Google Scholar] [CrossRef] [PubMed]
- Gervais, O.; Penaloza, C.; Gratacap, R.; Papadopoulou, A.; Beltran, M.; Henderson, N.C.; Houston, R.D.; Hassan, M.A.; Robledo, D. Understanding host response to infectious salmon anaemia virus in an Atlantic salmon cell line using single-cell RNA sequencing. BMC Genom. 2023, 24, 161. [Google Scholar] [CrossRef] [PubMed]
- van der Wal, Y.A.; Nordli, H.; Akandwanaho, A.; Greiner-Tollersrud, L.; Kool, J.; Jorgensen, J.B. CRISPR-Cas- induced IRF3 and MAVS knockouts in a salmonid cell line disrupt PRR signaling and affect viral replication. Front. Immunol. 2023, 14, 1214912. [Google Scholar] [CrossRef] [PubMed]
- Edvardsen, R.B.; Leininger, S.; Kleppe, L.; Skaftnesmo, K.O.; Wargelius, A. Targeted mutagenesis in Atlantic salmon (Salmo salar L.) using the CRISPR/Cas9 system induces complete knockout individuals in the F0 generation. PLoS ONE 2014, 9, e108622. [Google Scholar] [CrossRef] [PubMed]
- Datsomor, A.K.; Zic, N.; Li, K.; Olsen, R.E.; Jin, Y.; Vik, J.O.; Edvardsen, R.B.; Grammes, F.; Wargelius, A.; Winge, P. CRISPR/Cas9-mediated ablation of elovl2 in Atlantic salmon (Salmo salar L.) inhibits elongation of polyunsaturated fatty acids and induces Srebp-1 and target genes. Sci. Rep. 2019, 9, 7533. [Google Scholar] [CrossRef] [PubMed]
- Gutasi, A.; Hammer, S.E.; El-Matbouli, M.; Saleh, M. Review: Recent Applications of Gene Editing in Fish Species and Aquatic Medicine. Animals 2023, 13, 1250. [Google Scholar] [CrossRef] [PubMed]
- Puthumana, J.; Chandrababu, A.; Sarasan, M.; Joseph, V.; Singh, I.S.B. Genetic improvement in edible fish: Status, constraints, and prospects on CRISPR-based genome engineering. 3 Biotech 2024, 14, 44. [Google Scholar] [CrossRef]
- Gotesman, M.; Menanteau-Ledouble, S.; Saleh, M.; Bergmann, S.M.; El-Matbouli, M. A new age in AquaMedicine: Unconventional approach in studying aquatic diseases. BMC Vet. Res. 2018, 14, 178. [Google Scholar] [CrossRef]
- Pulgar, R.; Hodar, C.; Travisany, D.; Zuniga, A.; Dominguez, C.; Maass, A.; Gonzalez, M.; Cambiazo, V. Transcriptional response of Atlantic salmon families to Piscirickettsia salmonis infection highlights the relevance of the iron-deprivation defence system. BMC Genom. 2015, 16, 495. [Google Scholar] [CrossRef] [PubMed]
- Dettleff, P.; Bravo, C.; Patel, A.; Martinez, V. Patterns of Piscirickettsia salmonis load in susceptible and resistant families of Salmo salar. Fish Shellfish Immunol. 2015, 45, 67–71. [Google Scholar] [CrossRef] [PubMed]
- Agapito-Tenfen, S.Z.; Okoli, A.S.; Bernstein, M.J.; Wikmark, O.G.; Myhr, A.I. Revisiting Risk Governance of GM Plants: The Need to Consider New and Emerging Gene-Editing Techniques. Front. Plant Sci. 2018, 9, 1874. [Google Scholar] [CrossRef] [PubMed]
- Okoli, A.S.; Blix, T.; Myhr, A.I.; Xu, W.; Xu, X. Sustainable use of CRISPR/Cas in fish aquaculture: The biosafety perspective. Transgenic Res. 2022, 31, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Al-Khayyat, W.; Pirkkanen, J.; Dougherty, J.; Laframboise, T.; Dickinson, N.; Khaper, N.; Lees, S.J.; Mendonca, M.S.; Boreham, D.R.; Tai, T.C.; et al. Overexpression of FRA1 (FOSL1) Leads to Global Transcriptional Perturbations, Reduced Cellular Adhesion and Altered Cell Cycle Progression. Cells 2023, 12, 2344. [Google Scholar] [CrossRef]
- Cui, R.; Choi, S.E.; Kim, T.H.; Lee, H.J.; Lee, S.J.; Kang, Y.; Jeon, J.Y.; Kim, H.J.; Lee, K.W. Iron overload by transferrin receptor protein 1 regulation plays an important role in palmitate-induced insulin resistance in human skeletal muscle cells. FASEB J. 2019, 33, 1771–1786. [Google Scholar] [CrossRef] [PubMed]
- Pan, Q.; Luo, Y.; Xia, Q.; He, K. Ferroptosis and Liver Fibrosis. Int. J. Med. Sci. 2021, 18, 3361–3366. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Howell, J.; Manning, B. mTOR couples cellular nutrient sensing to organismal metabolic homeostasis. Trends Endocrinol. Metab. 2011, 22, 94–102. [Google Scholar] [CrossRef]
- Bayeva, M.; Khechaduri, A.; Puig, S.; Chang, H.C.; Patial, S.; Blackshear, P.J.; Ardehali, H. mTOR regulates cellular iron homeostasis through tristetraprolin. Cell Metab. 2012, 16, 645–657. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Nakatsu, F.; Hase, K.; Ohno, H. The Role of the Clathrin Adaptor AP-1: Polarized Sorting and Beyond. Membranes 2014, 4, 747–763. [Google Scholar] [CrossRef]
- Promchan, K.; Natarajan, V. Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1. PLoS ONE 2020, 15, e0226298. [Google Scholar] [CrossRef] [PubMed]
- Valenzuela-Muñoz, V.; Valenzuela-Miranda, D.; Gonçalves, A.T.; Novoa, B.; Figueras, A.; Gallardo-Escárate, C. Induced iron overdose modulate the immune response in Atlantic salmon increasing the susceptibility to Piscirickettsia salmonis infection. Aquaculture 2020, 521, 735058. [Google Scholar] [CrossRef]
- Pantopoulos, K. Iron metabolism and the IRE/IRP regulatory system: An update. Ann. N. Y. Acad. Sci. 2004, 1012, 1–13. [Google Scholar] [CrossRef] [PubMed]






| Target | crRNA Sequences (5′−3′) | Primers (5′−3′) | Size (bp) | Tm (°C) | Exon |
|---|---|---|---|---|---|
| tfa TIII | ACGGAGGGTTTTGAACCCAA | TGAATCTGGTTTCTGAACTC GGTTTGAGATGTTGATTATTACGC | 329 | 60 | 4 |
| tfa TVIII | CCTGCAGCCCATCATTGCAG | GACTTGTCACTTCTGACTTGTGC GAGTTCAGAAACCAGATTCA | 1009 | 60 | 3 |
| tf2 TVIII | CCTGCAGCCCATCATTGCAG | GTGACTTTTGTCATTTCTGACGTG GCGTTCAGAAACCAGATTCA | 938 | 64 | 3 |
| Sample | Raw Reads | Filtered Reads | Both Surviving (%) | Mapped Reads | Mapping (%) |
|---|---|---|---|---|---|
| C1 | 23,439,298 | 22,614,436 | 96.5 | 19,223,083 | 85.0 |
| C2 | 39,584,463 | 38,460,041 | 97.2 | 32,153,768 | 83.6 |
| TIII3 | 26,389,306 | 25,592,500 | 97.0 | 21,340,470 | 83.4 |
| TIII4 | 30,249,727 | 28,892,108 | 95.5 | 24,562,934 | 85.0 |
| TVIII5 | 31,496,927 | 30,214,480 | 95.9 | 25,884,881 | 85.7 |
| TVIII6 | 29,231,090 | 28,113,528 | 96.2 | 23,513,449 | 83.6 |
| Average | 30,065,135 | 289,81,182 | 96.4 | 244,46,430 | 84.4 |
| Total | 180,390,811 | 173,887,093 | 146,678,585 |
| Category | Term | p-Value | Fold Enrichment |
|---|---|---|---|
| BP | L-lysine catabolic process to acetyl-CoA via saccharopine | 0.013 | 148.2 |
| BP | Positive regulation of transcription. DNA-templated | 0.019 | 13.7 |
| BP | Ubiquitin-dependent protein catabolic process | 0.023 | 6.4 |
| CC | Nucleus | 0.0021 | 2 |
| CC | Kinesin complex | 0.038 | 50.5 |
| CC | Cytoplasm | 0.044 | 1.8 |
| MF | DNA binding | 0.037 | 2.2 |
| MF | Histone binding | 0.04 | 48.8 |
| Category | Term | p-Value | Fold Enrichment |
|---|---|---|---|
| BP | Cilium assembly | 0.036 | 9.9 |
| CC | Nucleus | 0.0035 | 1.8 |
| CC | Cytoplasm | 0.0041 | 2 |
| CC | AP-1 adaptor complex | 0.041 | 47.7 |
| CC | Microtubule organizing center | 0.043 | 9 |
| MF | Protein serine/threonine/tyrosine kinase activity | 0.035 | 3.3 |
| MF | Gamma-tubulin binding | 0.037 | 52.1 |
| MF | RNA binding | 0.048 | 2.4 |
| Category | Term | p-Value | Fold Enrichment |
|---|---|---|---|
| BP | Positive regulation of GTPase activity | 0.05 | 8.3 |
| CC | Cytoplasm | 0.0086 | 1.9 |
| CC | AP-1 adaptor complex | 0.038 | 51.7 |
| MF | RNA binding | 0.0019 | 3.3 |
| MF | Gamma-tubulin binding | 0.038 | 51.6 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dettleff, P.; Jin, Y.; Peñaloza, C.; Pulgar, R.; Sáez, A.; Robledo, D.; Escobar-Aguirre, S. Effect of CRISPR/Cas9 Targets Associated with Iron Metabolism and Its Variation on Transcriptional Regulation of SHK-1 Cell Line as a Model for Iron Metabolism. Fishes 2024, 9, 198. https://doi.org/10.3390/fishes9060198
Dettleff P, Jin Y, Peñaloza C, Pulgar R, Sáez A, Robledo D, Escobar-Aguirre S. Effect of CRISPR/Cas9 Targets Associated with Iron Metabolism and Its Variation on Transcriptional Regulation of SHK-1 Cell Line as a Model for Iron Metabolism. Fishes. 2024; 9(6):198. https://doi.org/10.3390/fishes9060198
Chicago/Turabian StyleDettleff, Phillip, Yehwa Jin, Carolina Peñaloza, Rodrigo Pulgar, Alejandro Sáez, Diego Robledo, and Sebastian Escobar-Aguirre. 2024. "Effect of CRISPR/Cas9 Targets Associated with Iron Metabolism and Its Variation on Transcriptional Regulation of SHK-1 Cell Line as a Model for Iron Metabolism" Fishes 9, no. 6: 198. https://doi.org/10.3390/fishes9060198
APA StyleDettleff, P., Jin, Y., Peñaloza, C., Pulgar, R., Sáez, A., Robledo, D., & Escobar-Aguirre, S. (2024). Effect of CRISPR/Cas9 Targets Associated with Iron Metabolism and Its Variation on Transcriptional Regulation of SHK-1 Cell Line as a Model for Iron Metabolism. Fishes, 9(6), 198. https://doi.org/10.3390/fishes9060198

