Effects of Subacute Ammonia Nitrogen Stress on the Growth, Antioxidant Capability, and Immunity of Blunt Snout Bream (Megalobrama amblycephala) Juveniles
Abstract
1. Introduction
2. Materials and Methods
2.1. Fish and Experiment Design
2.2. Sample
2.3. Enzyme Activity Assay
2.4. Total RNA Extract, cDNA Synthesis, and RT-qPCR
2.5. Calculation
2.6. Statistical Analysis
3. Results
3.1. Effect of Subacute Ammonia Nitrogen Stress on the Growth of Blunt Snout Bream
3.2. Effect of Subacute Ammonia Nitrogen Stress on the Metabolic Enzyme Activities of Blunt Snout Bream
3.3. Effect of Subacute Ammonia Nitrogen Stress on the Antioxidant Capacity in the Liver of Blunt Snout Bream
3.4. Effect of Subacute Ammonia Nitrogen Stress on the Plasma Immune Enzyme Activity of Blunt Snout Bream
3.5. Effect of Subacute Ammonia Nitrogen Stress on the Growth-Related Genes of Blunt Snout Bream
3.6. Effect of Subacute Ammonia Nitrogen Stress on the Antioxidant-Related Genes of Blunt Snout Bream
3.7. Effect of Subacute Ammonia Nitrogen Stress on the Immunity-Related Genes of Blunt Snout Bream
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Armstrong, D.A.; Chippendale, D.; Knight, A.W.; Colt, J.E. Interaction of ionized and un-ionized ammonia on short-term survival and growth of prawn larvae, Macrobrachium rosenbergii. Biol. Bull. 1978, 154, 15–31. [Google Scholar] [CrossRef] [PubMed]
- Benli, A.C.K.; Koksal, G.; Ozkul, A. Sublethal ammonia exposure of Nile tilapia (Oreochromis niloticus L.): Effects on gill, liver and kidney histology. Chemosphere 2008, 72, 1355–1358. [Google Scholar] [CrossRef] [PubMed]
- Cong, M.; Wu, H.F.; Cao, T.F.; Ji, C.L.; Lv, J.S. Effects of ammonia nitrogen on gill mitochondria in clam Ruditapes philippinarum. Environ. Toxicol. Pharmacol. 2019, 65, 46–52. [Google Scholar] [CrossRef] [PubMed]
- Sitja-Bobadilla, A.; Alvarez-Pellitero, P. Experimental transmission of Sparicotyle chrysophrii (Monogenea: Polyopisthocotylea) to gilthead seabream (Sparus aurata) and histopathology of the infection. Folia Parasitol. 2009, 56, 143–151. [Google Scholar] [CrossRef] [PubMed]
- Cheng, C.H.; Ma, H.L.; Su, Y.L.; Deng, Y.Q.; Feng, J.; Xie, J.W.; Chen, X.L.; Guo, Z.X. Ammonia toxicity in the mud crab (Scylla paramamosain): The mechanistic insight from physiology to transcriptome analysis. Ecotoxicol. Environ. Saf. 2019, 179, 9–16. [Google Scholar] [CrossRef]
- Lang, T.; Peters, G.; Hoffmann, R.; Meyer, E. Experimental investigations on the toxicity of ammonia: Effects on ventilation frequency, growth, epidermal mucous cells, and gill structure of rainbow trout Salmo gairdneri. Dis. Aquat. Org. 1987, 3, 159–165. [Google Scholar] [CrossRef]
- Hang, Y.L.; Shang, Z.H.; Wang, G.Y.; You, K.; Mi, D. High concentrations of environmental ammonia induced changes in large-scale loach (Paramisgurnus dabryanus) immunity. Ecol. Evol. 2021, 11, 8614–8622. [Google Scholar] [CrossRef]
- Jiang, M.; Li, L.; Shen, X.Q.; Wu, Q.Y.; Niu, J.X. Effect of ammonia stress on immunity indicators of juvenile Mugil cephalus. Oceanol. Limnol. Sin. 2014, 45, 529–535. [Google Scholar]
- Hu, Y.; Huang, Y.; Zhong, L.; Xiao, T.Y.; Wen, H.; Huan, Z.L.; Mao, X.W.; Li, J.L. Effects of ammonia stress on the gill Na+/K+-ATPase, microstructure and some serum physiological-biochemical indices of juvenile black carp (Mylopharyngodon piceus). J. Fish. China 2012, 36, 538–545. [Google Scholar] [CrossRef]
- Jia, R.; Liu, B.L.; Han, C.; Huang, B.; Lei, J.L. Effects of ammonia exposure on stress and immune response in juvenile turbot (Scophthalmus maximus). Aquac. Res. 2017, 48, 3149–3162. [Google Scholar] [CrossRef]
- Mckenzie, D.; Shingles, A.; Taylor, E. Sub-lethal plasma ammonia accumulation and the exercise performance of salmonids. Comp. Biochem. Physiol. A 2003, 135, 515–526. [Google Scholar] [CrossRef] [PubMed]
- Roumieh, R.; Barakat, A.; Abdelmeguid, N.E.; Ghanawi, J.; Patrick, S.I. Acute and chronic effects of aqueous ammonia on marbled spinefoot rabbitfish, Siganus rivulatus (Forsskål 1775). Aquac. Res. 2013, 44, 1777–1790. [Google Scholar] [CrossRef]
- Reinecke, M.; Björnsson, B.T.; Dickhoff, W.W.; McCormick, S.D.; Navarro, I.; Power, D.M.; Gutiérrez, J. Growth hormone and insulin-like growth factors in fish: Where we are and where to go. Gen. Comp. Endocrinol. 2005, 142, 20–24. [Google Scholar] [CrossRef] [PubMed]
- Hou, J.; Su, Y.J.; Lin, W.; Guo, H.H.; Xie, P.; Chen, J.; Gu, Z.M.; Li, L. Microcystin-LR retards gonadal maturation through disrupting the growth hormone/insulin-like growth factors system in zebrafish. Ecotoxicol. Environ. Saf. 2017, 139, 27–35. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Dong, Y.W.; Wang, F.; Dong, S.F. The effect of high ammonia concentration on gill structure alternation and expression of SOD and HSP90 genes in grass carp, Ctenopharyngodon idella. Acta Hydrobiol. Sin. 2013, 37, 321–330. [Google Scholar]
- Zhang, J.; Shen, H.; Wang, X.; Wu, J.; Xue, Y. Effects of chronic exposure of 2,4-dichlorophenol on the antioxidant system in liver of freshwater fish Carassius auratus. Chemosphere 2004, 55, 167–174. [Google Scholar] [CrossRef]
- Lu, K.L.; Wang, L.N.; Zhang, D.D.; Liu, W.B.; Xu, W.N. Berberine attenuates oxidative stress and hepatocytes apoptosis via protecting mitochondria in blunt snout bream (Megalobrama amblycephala) fed high-fat diets. Fish Physiol. Biochem. 2017, 43, 65–76. [Google Scholar] [CrossRef]
- Sheikhzadeh, N.; Tayefi-Nasrabadi, H.; Oushani, A.K.; Enferadi, M.H. Effects of Haematococcus pluvialis supplementation on antioxidant system and metabolism in rainbow trout (Oncorhynchus mykiss). Fish Physiol. Biochem. 2012, 38, 413–419. [Google Scholar] [CrossRef]
- Yuan, X.Y.; Wang, C.L.; Liu, W.B.; Jiang, G.Z.; Dai, Y.J. Evaluation of yeast hydrolysate as a substitute to dietary fish meal of juvenile Jian carp (Cyprinus carpio var. Jian): Protein synthesis via TOR pathway. Aquac. Nutr. 2021, 27, 1853–1860. [Google Scholar] [CrossRef]
- El-Shafai, S.A.; El-Gohary, F.A.; Nasr, F.A.; Steen, N.P.V.D.; Gijzen, H.J. Chronic ammonia toxicity to duckweed-fed tilapia (Oreochromis niloticus). Aquaculture 2004, 232, 117–127. [Google Scholar] [CrossRef]
- Rietman, S.; Frankel, S.A. A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am. J. Clin. Pathol. 1957, 28, 56–63. [Google Scholar] [CrossRef] [PubMed]
- Marklund, S.; Marklund, G. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem. 1974, 47, 469–474. [Google Scholar] [CrossRef] [PubMed]
- Sinha, A.K. Colorimetric assay of catalase. Anal. Biochem. 1972, 47, 389–394. [Google Scholar] [CrossRef] [PubMed]
- Dabas, A.; Nagpure, N.; Kumar, R.; Kushwaha, B.; Kumar, P.; Lakra, W. Assessment of tissue-specific effect of cadmium on antioxidant defense system and lipid peroxidation in freshwater murrel, Channa punctatus. Fish Physiol. Biochem. 2012, 38, 469–482. [Google Scholar] [CrossRef]
- Satho, K. Serum lipid peroxidation in cerebrovascular disorders determined by a new colorimetric method. Clin. Chim. Acta 1978, 190, 37–43. [Google Scholar] [CrossRef]
- Chen, Q.Q.; Liu, W.B.; Zhou, M.; Dai, Y.J.; Xu, C.; Tian, H.Y.; Xu, W.N. Effects of berberine on the growth and immune performance in response to ammonia stress and high-fat dietary in blunt snout bream Megalobrama amblycephala. Fish Shellfish Immunol. 2016, 55, 165–172. [Google Scholar] [CrossRef]
- Obach, A.; Quentel, C.; Laurencin, F.B. Effects of alpha-tocopherol and dietary oxidized fish oil on the immune response of sea bass Dicentrarchus labrax. Dis. Aquat. Org. 1993, 15, 175–185. [Google Scholar] [CrossRef]
- Yuan, X.Y.; Jiang, G.Z.; Cheng, H.H.; Cao, X.F.; Shi, H.J.; Liu, W.B. An evaluation of replacing fish meal with cottonseed meal protein hydrolysate in diet for juvenile blunt snout bream (Megalobrama amblycephala): Growth, antioxidant, innate immunity and disease resistance. Aquac. Nutr. 2019, 25, 1334–1344. [Google Scholar] [CrossRef]
- Sun, S.; Ge, X.; Zhu, J.; Xuan, F.; Jiang, X. Identification and mRNA expression of antioxidant enzyme genes associated with the oxidative stress response in the Wuchang bream (Megalobrama amblycephala Yih) in response to acute nitrite exposure. Comp. Biochem. Physiol. C 2014, 159, 69–77. [Google Scholar] [CrossRef]
- Zhao, Z.; Xie, J.; Liu, B.; Ge, X.P.; Song, C.Y.; Ren, M.C.; Zhou, Q.L.; Miao, L.H.; Zhang, H.M.; Shan, F.; et al. The effects of emodin on cell viability, respiratory burst and gene expression of Nrf2-Keap1 signaling molecules in the peripheral blood leukocytes of blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol. 2017, 62, 75–85. [Google Scholar] [CrossRef]
- Paust, L.O.; Foss, A.; Imsland, A.K. Effects of chronic and periodic exposure to ammonia on growth, food conversion efficiency and blood physiology in juvenile Atlantic halibut (Hippoglossus hippoglossus L.). Aquaculture 2011, 315, 400–406. [Google Scholar] [CrossRef]
- Peng, R.B.; Wang, P.S.; Le, K.X.; Wang, Y.; Jiang, X.M. Acute and chronic effects of ammonia on juvenile cuttlefish, Sepia pharaonis. J. World Aquac. Soc. 2017, 48, 602–610. [Google Scholar] [CrossRef]
- Figueiredo, M.D.A.; Lanes, C.F.C.; Almeida, D.V.; Proietti, M.C.; Marins, L.F. The effect of GH overexpression on GHR and IGF-I gene regulation in different genotypes of GH-transgenic zebrafish. Comp. Biochem. Physiol. D 2007, 2, 228–233. [Google Scholar] [CrossRef]
- Cai, L.S.; Wang, L.; Song, K.; Lu, K.L.; Zhang, C.X.; Rahimnejad, S. Evaluation of protein requirement of spotted seabass (Lateolabrax maculatus) under two temperatures, and the liver transcriptome response to thermal stress. Aquaculture 2020, 516, 734615. [Google Scholar] [CrossRef]
- Kim, W.R.; Flamm, S.L.; Di Bisceglie, A.M.; Bodenheimer, H.C. Serum activity of alanine aminotransferase (ALT) as an indicator of health and disease. Hepatology 2008, 47, 1363–1370. [Google Scholar] [CrossRef]
- Li, J.Y.; Zhang, D.D.; Xu, W.N.; Jiang, G.Z.; Zhang, C.N.; Li, X.F.; Liu, W.B. Effects of dietary choline supplementation on growth performance and hepatic lipid transport in blunt snout bream (Megalobrama amblycephala) fed high-fat diets. Aquaculture 2014, 434, 340–347. [Google Scholar] [CrossRef]
- Rahimnejad, S.; Yuan, X.Y.; Liu, W.B.; Jiang, G.Z.; Cao, X.F.; Dai, Y.J.; Wang, C.C.; Hesham, E.D. Evaluation of antioxidant capacity and immunomodulatory effects of yeast hydrolysates for hepatocytes of blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immun. 2020, 106, 142–148. [Google Scholar] [CrossRef]
- Kiron, V. Fish immune system and its nutritional modulation for preventive health care. Anim. Feed. Sci. Technol. 2012, 173, 111–133. [Google Scholar] [CrossRef]
- Zhang, W.X.; Xia, S.L.; Zhu, J.; Miao, L.H.; Ren, M.C.; Lin, Y.; Ge, X.P.; Sun, S.M. Growth performance, physiological response and histology changes of juvenile blunt snout bream, Megalobrama amblycephala exposed to chronic ammonia. Aquaculture 2019, 506, 424–436. [Google Scholar] [CrossRef]
- Han, C.Y.; Zheng, Q.M.; Chen, G.D.; Liu, L.X. Effect of ammonia-nitrogen stress on non-specific immunity of hybrid Tilapia (Oreochromis niloticus × Oreochromis areus). Anim. Husb. Feed. Sci. 2015, 7, 226–229. [Google Scholar]
- Parvez, S.; Raisuddin, S. Protein carbonyls: Novel biomarkers of exposure to oxidative stress-inducing pesticides in freshwater fish Channa punctata (Bloch). Environ. Toxicol. Pharmacol. 2005, 20, 112–117. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.H.; Gong, J.S.; Xu, Z.H.; Duh, E.J. Nrf2 promotes reparative angiogenesis through regulation of NADPH oxidase-2 in oxygen-induced retinopathy. Free Radic. Biol. Med. 2016, 99, 234–243. [Google Scholar] [CrossRef] [PubMed]
- Ellis, A.E. Innate host defense mechanisms of fish against viruses and bacteria. Dev. Comp. Immunol. 2001, 25, 827–839. [Google Scholar] [CrossRef]
- Gómez, G.D.; Balcázar, J.L. A review on the interactions between gut microbiota and innate immunity of fish. FEMS Immunol. Med. Microbiol. 2008, 52, 145–154. [Google Scholar] [CrossRef]
- Yang, W.L.; Jiang, S.; Yang, Q.B.; Huang, J.H.; Shi, J.Z.; Li, Y.D.; Yang, Y.K.; Zhou, F.L. Effects of partial substitution of fish meal with soybean products and chicken meal on growth, antioxidant capacity and intestinal microbiota of Penaeus monodon. Fishes 2024, 9, 42. [Google Scholar] [CrossRef]
- Wu, D.L.; Huang, Y.H.; Chen, Q.; Jiang, Q.C.; Li, Y.M.; Zhao, Y.L. Effects and transcriptional responses in the hepatopancreas of red claw crayfish Cherax quadricarinatus under cold stress. J. Therm. Biol. 2019, 85, 102404. [Google Scholar] [CrossRef] [PubMed]
- Yue, F.; Pan, L.Q.; Xie, P.; Zheng, D.B.; Li, J. Immune responses and expression of immune-related genes in swimming crab Portunus trituberculatus exposed to elevated ambient ammonia-N stress. Comp. Biochem. Physiol. A 2010, 157, 246–251. [Google Scholar] [CrossRef]
- Liang, T.; Ji, W.; Zhang, G.R.; Wei, K.J.; Feng, K.; Wang, W.M.; Zou, G.W. Molecular cloning and expression analysis of liver-expressed antimicrobial peptide 1 (LEAP-1) and LEAP-2 genes in the blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol. 2013, 35, 553–563. [Google Scholar] [CrossRef]
- Liu, T.; Gao, Y.; Wang, R.; Xu, T. Characterization, evolution and functional analysis of the liver-expressed antimicrobial peptide 2 (LEAP-2) gene in miiuy croaker. Fish Shellfish Immunol. 2014, 41, 191–199. [Google Scholar] [CrossRef]






| Items | G1 | G2 | G3 |
|---|---|---|---|
| TA-N/mg L−1 | 0.05 ± 0.01 | 3.57 ± 0.04 | 7.14 ± 0.04 |
| Actual unionized NH3/mg L−1 | 0.00 ± 0.00 | 0.06 ± 0.04 | 0.12 ± 0.05 |
| Water temperature/°C | 27.0 ± 0.50 | 27.0 ± 0.50 | 27.0 ± 0.50 |
| pH | 7.44 ± 0.06 | 7.43 ± 0.04 | 7.42 ± 0.05 |
| Dissolved oxygen/mg L−1 | 7.51 ± 0.02 | 7.50 ± 0.01 | 7.51 ± 0.02 |
| Function | Genes | Sequence (5′-3′) | Genbank No. |
|---|---|---|---|
| Housekeeping gene | EF-1α | CTTCTCAGGCTGACTGTGC | ×77,689.1 |
| CCGCTAGCATTACCCTCC | |||
| Antioxidant genes | SOD | AGTTGCCATGTGCACTTTTCT | [29] |
| AGGTGCTAGTCGAGTGTTAGG | |||
| CAT | ACCGAGGTGCTGAACGAAGC | XM_048158628 | |
| GAACGGCCATCAGGTTTTGC | |||
| NOX2 | TCACTGGATGGGACCAGAGT | [30] | |
| CCAGTTCGGTCGGCCATAAT | |||
| Bach1 | TTACAGCAGCGAAGTGAGCA | [30] | |
| CGGGCTGCAATACGGTTTTT | |||
| Immunity genes | Leap1 | CAGACCGCAGCCGTTCCCTT | JQ308841 |
| AGCAGTATCCACAGCCTTTG | |||
| Leap2 | GTGCCTACTGCCAGAACCAT | JQ344324 | |
| GAACATTACCTATTGCCTCC | |||
| Growth genes | GHRa | AGCCTCCTCCTGAATCCT | JN896373.1 |
| TTCCAGCAGTGAGAAGGTAT | |||
| GHRb | GCAAAGCGGCAGAGGAGA | JN896374.1 | |
| GCCACAGCACCAGTGAACA | |||
| IGF1 | CCGATTTAAGGTCCGTATT | JQ398496 | |
| GTGCAGCCGTAGTTCAGTT | |||
| IGF2 | TGTTTGCCATACCTGCTTG | JQ398497.1 | |
| ACGCCGACTGTTCGACCTA |
| Items | G1 | G2 | G3 |
|---|---|---|---|
| Initial body weight/g | 6.52 ± 0.10 | 6.50 ± 0.02 | 6.51 ± 0.09 |
| Final body weight/g | 14.33 ± 2.55 a | 13.03 ± 0.34 b | 10.30 ± 1.39 c |
| Weight gain rate/% | 120.19 ± 40.36 a | 100.39 ± 3.32 b | 55.49 ± 2.16 c |
| Specific growth rate/% d−1 | 2.61 ± 0.07 a | 2.28 ± 0.09 b | 1.48 ± 0.07 c |
| Feed conversion ratio | 1.93 ± 0.09 a | 2.46 ± 0.08 b | 2.47 ± 0.07 b |
| Survival rate/% | 91.00 ± 2.00 a | 86.00 ± 3.00 ab | 81.00 ± 2.00 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yuan, X.; Wang, Q.; Dai, M.; Xiong, X.; Wang, H.; Wang, C. Effects of Subacute Ammonia Nitrogen Stress on the Growth, Antioxidant Capability, and Immunity of Blunt Snout Bream (Megalobrama amblycephala) Juveniles. Fishes 2024, 9, 502. https://doi.org/10.3390/fishes9120502
Yuan X, Wang Q, Dai M, Xiong X, Wang H, Wang C. Effects of Subacute Ammonia Nitrogen Stress on the Growth, Antioxidant Capability, and Immunity of Blunt Snout Bream (Megalobrama amblycephala) Juveniles. Fishes. 2024; 9(12):502. https://doi.org/10.3390/fishes9120502
Chicago/Turabian StyleYuan, Xiangyang, Qian Wang, Mengyang Dai, Xinyu Xiong, Hengjie Wang, and Canli Wang. 2024. "Effects of Subacute Ammonia Nitrogen Stress on the Growth, Antioxidant Capability, and Immunity of Blunt Snout Bream (Megalobrama amblycephala) Juveniles" Fishes 9, no. 12: 502. https://doi.org/10.3390/fishes9120502
APA StyleYuan, X., Wang, Q., Dai, M., Xiong, X., Wang, H., & Wang, C. (2024). Effects of Subacute Ammonia Nitrogen Stress on the Growth, Antioxidant Capability, and Immunity of Blunt Snout Bream (Megalobrama amblycephala) Juveniles. Fishes, 9(12), 502. https://doi.org/10.3390/fishes9120502
