Next Article in Journal
Economic Valuation of Fish Provision, Wastewater Treatment, and Coastal Protection in the Israeli Mediterranean Sea
Next Article in Special Issue
Host Habitat as a Dominant Role in Shaping the Gut Microbiota of Wild Crucian Carp (Carassius auratus)
Previous Article in Journal
Geographic Variation in Opisthonema oglinum (Lesueur, 1818) in the Southeastern Brazilian Bight Inferred from Otolith Shape and Chemical Signatures
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 8
Issue 5
10.3390/fishes8050235
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Isolation and Identification of Pathogenic Vibrio Species in Black Rockfish Sebastes schlegeli

by
Xiaoling Liu
,
Cuirong You
and
Yong Zeng
*
College of Life Sciences, Yantai University, 30 Qingquan Road, Yantai 264005, China
*
Author to whom correspondence should be addressed.
Fishes 2023, 8(5), 235; https://doi.org/10.3390/fishes8050235
Submission received: 7 March 2023 / Revised: 26 April 2023 / Accepted: 28 April 2023 / Published: 29 April 2023
(This article belongs to the Special Issue Diseases in Fish and Shellfish, 2nd Edition)
Browse Figures
Versions Notes

Abstract

:
Four pathogenic Vibrio species were isolated from three diseased black rockfish Sebastes schlegeli in Yantai, Shandong Province, China. The strains were identified based on physiological and biochemical characteristics and 16S rDNA sequencing and named SF-2, SF-3, SF-5, and SF-6, respectively. SF-2 was Vibrio scophthalmi, SF-3 was V. harveyi, SF-5 was V. alginolyticus, and SF-6 was V. parahaemolyticus. This is the first time that V. scophthalmi was isolated from black rockfish. The present research shows that V. scophthalmi is a potential pathogen. Detection of virulence genes using polymerase chain reaction showed that SF-3, SF-5, and SF-6 carried FlaB; SF-5 and SF-6 carried TcpA; and SF-2, SF-5, and SF-6 carried ToxS. Tdh, Trh, Tlh, ToxR, and Zot were not detected. SF-3, SF-5, and SF-6 all had protease, gelatinase, lipase, and lecithinase. They were all intermediately sensitive to erythromycin, whereas SF-2, SF-5, and SF-6 were sensitive to spectinomycin, and SF-3 was sensitive to cotrimoxazole and chloramphenicol. They were resistant to most antibiotics and multidrug resistance was obvious.
Keywords:
Sebastes schlegeli; virulence factors; Vibrio scophthalmi; opportunistic pathogen
Key Contribution: This is the first time that V. scophthalmi was isolated from S. schlegeli. Multiple pathogenic bacteria were found in fish disease.

1. Introduction

The black rockfish Sebastes schlegeli has become an important marine aquaculture species along the northeastern coasts of China, Japan, and South Korea [1]. Daqindao, Changdao City, Shandong Province is the largest sea-cage fish culture area in northern China [2]. In recent years, offshore marine fishery resources have gradually become scarce, and the output of wild black rockfish is unable to meet consumer demand. Now, a large proportion of black rockfish sold in the market is cultured in cages and has become one of the most important types of fish in sea-cage culture in China.
Owing to the high density of cages and high density of cultured fish, caged fish are prone to diseases. Nutritional levels, physiological stages, drugs, and environmental stress can alter their intestinal flora composition to varying degrees [3]. The health status of black rockfish is susceptible to these external factors.
Parasites and bacteria are the main pathogens isolated from black rockfish [4,5]. The parasites in black rockfish include Microcotyle sebastis, Heteraxine spp., Opecoelusnipponicus, and parasites from the Anisakidae family. Common pathogenic bacteria include Vibrio, Lactococcus garvieae, β-hemolytic Streptococcus, and Aeromonas salmonicida(A. salmonicida). The Vibrio core group consists of eight species including V. harveyi, V. alginolyticus, V. rotifer, V. parahaemolyticus, V. campbell, V. natrigens, V. mytili, and V. azureus [6]. These are recognized aquatic animal pathogens. Intensive farming is associated with problems such as bacterial diseases caused by various Vibrio spp. [7]. After being infected by Vibrio spp., black rockfish mainly exhibit symptoms such as a black body color, red and swollen epidermis, irregular swimming, poor feeding, and muscle rot in severe cases [8].
In the study, black rockfish were found to have died from a disease at a cage farm in Yantai, Shandong Province, China. Different pathogenic Vibrio spp. were isolated. In this study, the determination of bacterial morphology, identification of physiological and biochemical characteristics, 16S rDNA sequence amplification and sequencing analysis, identification of the virulence gene and virulence-related factors, and tests for antibiotic resistance were performed.

2. Materials and Methods

2.1. Fish and Clinical Signs

Diseased black rockfish were obtained from a farm in Yantai City, Shandong Province, China in September 2020. The mortality rate for diseased black rockfish was 30–40%. Three sick fish were randomly selected for the experiment. The diseased fish had skin ulcers and their eyes and mouth were congested. An autopsy revealed fluid accumulation in the abdominal cavity and liver congestion.

2.2. Isolation and Purification of Pathogenic Strains

Under aseptic operation, the liver tissues of three fish were smeared on the corresponding Thiosulfate–Citrate–Bile Salts–Sucrose (TCBS) medium with am inoculation ring and cultured at 28 °C. Colony morphology was observed after incubation for 24 h. Four dominant bacterial colonies were isolated and purified by repeated streaking on their corresponding agar plates and named SF-2, SF-3, SF-5, and SF-6.

2.3. Identification of Strains

2.3.1. Biochemical Characteristics

The purified strains were obtained for biochemical identification. Single colonies of different purified bacteria were inoculated into bacterial trace biochemical reaction tubes and cultured at 37 °C for between 24–48 h. The change in the reaction tube was observed after culturing.

2.3.2. 16S rDNA Amplification of the Isolated Strains

Purified bacteria isolated from each sample were identified using 16S rDNA gene sequencing and alignment. The forward primer (27F) was 5′-AGAGTTTGATCCTGGCTCAG-3′, and the reverse primer (1492R) was 5′-GGCTACCTTGTTACGACTT-3′. The polymerase chain reaction (PCR) mixture consisted of 5 µL of PCR buffer (10×), 3 µL of MgCl2 (25 mmol/L), 1.25 µL of dNTP (10 mmol/L), 1 µL of Taq enzyme (5 U/μL), 1 µL of DNA template, and 5 µL of each primer. Sterile nanopure water was added to bring the final reaction volume to 50 μL. PCR was performed as follows: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1.5 min for a total of 35 cycles, followed by a final extension step at 72 °C for 10 min.
PCR products were electrophoresed in 1.0% agarose gel. The 16S rDNA purification and sequencing of the strain were entrusted to General Biosystems (Anhui). The 16S rDNA was analyzed and compared using the BLAST search program (http://www.ncbi.nlm.nih.gov, accessed on 25 November 2021) of GenBank. The evolutionary tree was constructed using Mega 7. Using the Neighbor Joining method, it is a bootstrap analysis with 1000 repeats.

2.4. Determination of Virulence-Related Factors

2.4.1. Determination of Extracellular Enzyme Activity

Extracellular proteinases play an important role in the virulence of Vibrio spp. [9]. The determination of extracellular proteinases detection was according to the method reported by Bunpa et al. [10]. Extracellular enzymes were used in the agar plate assay. Four purified strains were inoculated on the corresponding detection plate and cultured at 28 °C for 24 h, and the changes around the colony were observed.

2.4.2. Detection of Virulence Genes

The virulence genes of four different isolates were amplified. Eight main virulence genes, including thermostable direct hemolysin (Tdh), Tdh-related hemolysin (Trh), thermolabile hemolysin (Tlh), flagella-related genes toxin-coregulated pilus major subunit A (TcpA), and flagellin B subunit (FlaB) and the virulence regulatory proteins ToxS, ToxR, and zonula occludens toxin (Zot), were targeted. The primers for these genes are listed in Table 1. The PCR mixture consisted of 1 µL of PCR buffer (10×), 0.6 µL of MgCl2 (25 mmol/L), 0.25 µL of dNTP (10 mmol/L), 0.2 µL of Taq enzyme (5 U/μL), 1 µL of DNA template, and 0.5 µL of each primer. Sterile nanopure water was added to make up the final reaction volume to 10 µL. PCR was performed as follows: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 1 min, annealing for 30 s, extension at 72 °C for 1 min for a total of 30 cycles, followed by a final extension step at 72 °C for 7 min. PCR products were identified using 1.0% agarose gel electrophoresis. The annealing temperatures are shown in Table 1.

2.5. Antibiotic Resistance Tests

The strains were tested for antibiotic resistance using the disc diffusion method. The antibiotics used in this experiment mainly included gentamicin, cotrimoxazole, ampicillin, penicillin G, erythromycin, norfloxacin, chloramphenicol, amikacin, ciprofloxacin, pioneer V, spectinomycin, enrofloxacin, cefotaxime, levofloxacin, cefoxitin, rifampicin, doxycycline, imipenem, clindamycin, metronidazole, amoxicillin, and bacitracin. The concentration of the bacterial suspension was adjusted to 107 colony-forming units/mL and spread on the surface of a 2216 E agar medium. Up to five sheets of antibiotic-containing paper disks were pasted per plate. The diameters of the bacteriostatic circles of each drug were measured after 24 h of culture at 28 °C. The test was performed three times, and the average value was calculated to determine the sensitivity of the strains to antibiotics.

3. Results

3.1. Isolation and Biochemical Identification of Strains

Four different bacteria were isolated, and all four isolates were Gram-negative, short, rod-shaped bacteria. All isolates could grow on TCBS medium, forming yellow, round colonies with neat edges. The growth cycle of SF-2 was longer than that of other bacteria, and the colony morphology gradually emerged after 18 h of culture. SF-6 colonies were cultured on TCBS medium, and the colonies were bluish green after about 14 h of culturing. The physiological and biochemical results are shown in Table 2.

3.2. 16S rDNA Amplification of the Isolated Strains

A 1448-bp fragment from all four isolates was identified using 16S rDNA PCR. Sequences of the isolated strains were compared using the blast search function of NCBI, and the results showed that all four isolates belonged to the Vibrio genus. Electrophoresis results of the isolated bacteria and the phylogenetic trees constructed with 16S rDNA sequences are shown in Figure 1 and Figure 2, respectively.
Based on the phenotypic characteristics, biochemical characteristics, and 16S rDNA analysis of the isolated strains, isolate SF-2 was determined to be V. scopthalmi; SF-3 was determined to be V. harveyi; SF-5 was determined to be V. alginolyticus; and SF-6 was determined to be V. parahaemolyticus.

3.3. Determination of Extracellular Enzyme Activity

Four extracellular enzymes were detected in this experiment, including caseinase, gelatinase, lipase, and lecithinase. The activity of extracellular enzymes was detected in SF-3, SF-5, and SF-6, whereas no extracellular enzyme activity was detected in SF-2. The results are shown in Table 3.

3.4. Detection of Virulence Genes

The flagella-related gene FlaB was found in SF-3, SF-5, and SF-6; toxic force regulatory protein ToxS was found in SF-2, SF-5, and SF-6; and the flagellum-related gene TcpA was found in SF-5 and SF-6. Other virulence genes such as Tdh, Trh, Tlh, ToxR, and Zot were not detected. The results are shown in Figure 3.

3.5. Antibiotic Resistance Tests

CLSI documents are the documents of the Clinical Microbiology Laboratory of the United States research center and reflect the regulatory requirements of the United States. It is different from the verification method of the domestic drug sensitivity test system. The sensitivity was determined according to the criteria for inhibition zones of the disk-method test provided by the Hangzhou Tianhe microbial reagent Company. All Vibrio spp. showed multidrug resistance, with SF-2, SF-5, and SF-6 being sensitive to only one antibiotic. SF-3 was sensitive to only two of the 22 antibiotics tested; SF-5 was intermediately sensitive to two antibiotics; SF-2 and SF-6 were intermediately sensitive to three antibiotics; and SF-3 was intermediately sensitive to five antibiotics. All four Vibrio spp. showed intermediate sensitivity to erythromycin. Test results for antibiotic resistance are shown in Table 4.

4. Discussion

In this study, we identified V. scophthalmi, V. harveyi, V. alginolyticus, and V. parahaemolyticus. V. alginolyticus and V. parahaemolyticus were isolated from the same diseased fish. Various bacteria have been isolated during similar disease outbreaks. Such co-infections often cause more serious economic losses than single infections with either pathogen [13]. V. anguillarum and V. scophthalmi can jointly cause ascites disease in turbot larvae (Scophthalmus maximus) [14]. In addition, the presence of two pathogens was also found in striped mullet Mugil cephalus that died of septicemia. A. hydrophila and V. parahaemolyticus were isolated from diseased striped mullet [15]. Co-infection is one of the reasons for the high mortality rate of striped mullet in summer. Erythematous dermatitis, necrotizing dermatitis, and dermal ulcers in fish have also been caused by a combination of pathogens, including Aeromonas spp., Alcaligenes spp., Pseudomonas spp., and Vibrio spp. However, no genus was consistently dominant in cultures obtained from any of the lesion types [16]. Co-infections by two or more pathogens often occur in fish culture. Experimentally infected zebrafish showed significantly higher mortality after co-infection with A. hydrophila and A. veronii [17]. Numerous pathogenic bacteria, including Enterovibrio nigricans, Photobacterium swingsii, V. owensii, V. harveyi, and V. rotiferianus, have also been isolated from diseased fish with hemorrhaging and festering fins and skin and swollen internal organs [18]. The presence of multiple pathogenic bacteria in a single diseased fish is common and more likely to cause outbreaks.
Both extracellular protease and virulence genes are virulence factors of Vibrio. The pathogenicity of Vibrio depends on the presence of virulence factors. The potential pathogenicity of Vibrio was determined by detecting its virulence factor [19]. Various extracellular enzymes are important factors contributing to the virulence of Vibrio. Extracellular proteases including caseinase, gelatinase, lipase, and lecithinase are common in bacteria and play an important role in bacterial virulence [10]. Caseinase and gelatinase can decompose the collagen protein component to facilitate the dissemination of the hemolytic toxin throughout the body. The hemolysis factor causes blood cells to rupture, disabling oxygen transport in the body and leading to tissue necrosis; death can occur in severe cases. Lecithinase and lipase decompose host tissue elements, such as cell membranes, causing widespread tissue damage [20]. The presence of these extracellular enzymes can cause host tissue damage, leading to disease. V. fluvialis secretes extracellular enzymes such as protease and lipase. Extracellular toxins, including protease, are the main factors of V. fluvialis responsible for pustule disease and death in abalone [21]. Vibrio spp. that are pathogenic to black rockfish can produce extracellular enzymes and cause hemorrhage and ascites [11]. Similar results were observed in our study; four extracellular enzymes were detected in V. harveyi, V. alginolyticus, and V. parahaemolyticus, but not in V. scopthalmi. Thus, Vibrio spp. secreting these extracellular enzymes are pathogenic to black rockfish.
The pathogenicity of Vibrio depends on several virulence factors encoded by their virulence genes [22]. The presence of virulence genes also helps judge the pathogenicity of Vibrio. Tdh is thermostable direct hemolysin, Trh is Tdh-related hemolysin, and Tlh is thermolabile hemolysin [11]. V. parahaemolyticus has also been found to be pathogenic in the absence of the Tdh and Tlh genes [23]. Thus, these two genes are not the only criteria responsible for the pathogenicity of V. parahaemolyticus. Zot can affect the tight junction structure or bond bridge between cells, thereby enhancing the permeability of the small intestinal mucosa [12]. FlaB-encoding flagellin regulates the ability of bacteria to attach to the surface and enables strong adhesion of Vibrio spp. Flagella are responsible for conferring virulence in some Vibrio spp [24]. In V. cholerae, motile isolates have been reported to be more virulent than the nonmotile mutants [25]. TcpA toxin co-regulates the pilus-encoded protein to regulate the main subunits of toxin-coregulated pilus (TCP). TCP helps in microcolony formation on the epithelial surface [26]. ToxR is a transmembrane regulatory protein that plays a key role in the virulence expression system of V. cholerae. ToxR activity is dependent on the inner membrane protein ToxS [27,28], and ToxS has been detected in pathogenic V. alginolyticus and V. cholera [26]. The existence and expression of virulence genes can affect the pathogenicity of bacteria to the host. Vibrio spp. with virulence genes are more likely to cause disease in black rockfish. While identifying virulence genes, FlaB and TcpA were detected in V. harveyi, V. alginolyticus, and V. parahaemolyticus, whereas ToxS was detected in V. alginolyticus and V. parahaemolyticus. These three Vibrio spp. have been found as pathogens in black rockfish and reported to contain several extracellular virulence factors and virulence genes. Vibrio spp. that carry FlaB genes are more likely to attach to their hosts. The excretion of extracellular products contributes to successful bacterial colonization and host invasion. Therefore, it is concluded that they may have certain toxicity.
The current study is the first report of V. scophthalmi in black rockfish. V. scophthalmi has earlier been reported to be one of the main bacterial species in the diseased olive flounder Paralichthys olivaceus [29]. V. scophthalmi isolated in our study did not secrete extracellular enzymes. There was evidence of the pathogenicity of V. scophthalmi without the secretion of extracellular enzymes. High-virulence V. scophthalmi strains were found to produce lipase and gelatinase but not caseinase and lecithinase. Some strains were found to produce extracellular enzymes, similar to those observed in the case of high-virulence strains, but caused fewer incidences of olive flounder death. Other moderately virulent strains did not produce these enzymes but were still pathogenic to the olive flounder. Thus, they suggest that some toxins in V. scophthalmi were not produced during experimental conditions, or that these extracellular enzymes were not the only virulence factors [29,30]. V. scophthalmi may also be considered an opportunistic disease-causing pathogen in aquatic animals. Early studies have reported that V. scophthalmi was a common microorganism present in the intestine of turbot larvae. However, it has recently been found that V. scophthalmi can cause diseases in marine animals and is an opportunistic pathogen in olive flounder and turbot larvae. Hosts that are immune-suppressed or stressed because of physiological or environmental factors are more likely to be infected and suffer from severe disease. The stress factors here include water temperature and invasion by pathogenic bacteria [30,31,32,33]. Studies suggest that the physiological mechanisms of V. scophthalmi may be complex. Changes in the culture environment or invasion by other bacteria can affect the virulence expression of V. scophthalmi. The main symptom of the Japanese eel Anguilla japonica infected with V. scophthalmi was skin and peritoneal hemorrhage [34]. This is similar to the symptoms exhibited by black rockfish infected with V. scophthalmi and is likely because the medium used for laboratory culture is rich in nutrients and quite different from the natural growth environment of bacteria. The laboratory environment weakens bacterial competitiveness and reduces their ability to secrete extracellular proteins. In our study, although no extracellular enzymes were detected, the complex aquaculture environment might be stressful to fish, allowing even a low pathogenic strain of V. scophthalmi to infect and cause disease. At the same time, virulence regulatory proteins of ToxS were also detected. V. alginolyticus and V. parahaemolyticus, which produce extracellular enzymes, were also found to have ToxS genes. Thus, the V. scophthalmi isolated in our study may have had potential toxicity. Experiments showed that all four Vibrio spp. carried certain extracellular enzymes or virulence genes, which are the virulence factors of Vibrio. Virulence factor is closely related to the incidence of vibrio [35]. Vibrio carrying flagella genes are more likely to attach to the host tissue and break host cells and tissues by secreting extracellular enzymes, followed by proliferation and invasion into the internal organ systems via blood circulation. Vibrio spp. are a group of common bacteria that are natural constituents of freshwater, estuarine, and marine environments [36]. The presence of a variety of Vibrio spp. in the bodies of fish indicates the presence of numerous Vibrio spp. in the aquaculture environment. The presence of multiple Vibrio strains is more likely to cause disease than the presence of a single pathogenic strain [12,37].
The antibiotic resistance test revealed all four Vibrio strains to be multidrug resistant. SF-2, SF-5, and SF-6 were sensitive to spectinomycin, whereas SF-3, SF-5, and SF-6 were intermediately sensitive to gentamicin. All four species of Vibrio were intermediately sensitive to erythromycin. The unreasonable use of antibiotics in aquaculture has led to the emergence of antibiotic resistance in Vibrio spp. [38,39]. The multidrug-resistant phenotype has been found in V. scophthalmi [40]. V. alginolyticus strains were found to have multiple antimicrobial-resistance genes [41]. Additionally, bacteria were isolated from aurus and Penaeus indicus collected from local markets in Hail region, Saudi Arabia. Drug sensitivity tests showed that there was multidrug resistance [42]. The use and misuse of antimicrobials can lead to a rapid increase in the frequency of bacterial resistance; antibiotic resistance has become a major problem in veterinary and human medicine [43,44,45]. The emergence of bacterial resistance in aquaculture has led to the reduced ability of drugs to control diseases in aquatic animals [46]. Drug susceptibility is related to the region, temperature, salinity, and culture conditions, as well as to the use of drugs in the farm. The extensive use of antibiotics leads to residues in the environment. This, in turn, will lead to the selection of resistant bacteria and promote the evolution of antibiotic resistance mechanisms, such as reduced intracellular drug concentrations, alternative or protective targets, and direct inactivation of antibiotics, eventually leading to multidrug resistance [47]. This poses a huge challenge in disease prevention and control in the aquaculture industry.
In our study, none of the antibiotics were active against all four Vibrio spp. New methods to treat diseases in fish need to be designed. The immune system of fish depends on their nutrition and diet [48], and dietary changes can affect their functional responses. For example, adding methylmercury to the black rockfish diet promotes an active diet, whereas uptake of methylmercury chloride in black rockfish led to higher oxidative stress, which was reflected by significantly increased plasma SOD activity at all tested levels [49]. Some experiments have found that dietary Chlorella peruviana could improve the growth and innate immune response of the juvenile rainbow trout Oncorhynchus mykiss, which is beneficial in improving production efficiency and resisting bacterial infections [50]. Vaccination is also a useful approach to preventing diseases and is considered one of the most effective tools to combat bacterial and viral diseases, thereby enhancing the survival of fish. Vaccines protect fish from certain diseases by producing antibodies that stimulate their immune systems. Several vaccines including inactivated vaccines, live attenuated vaccines, subunit vaccines, DNA vaccines, and live vector vaccines against Vibrio are available [51,52,53]. Vaccination of fish against vibriosis is one of the most comprehensive and successful developments in disease prevention in modern aquaculture [54]. The injection or immersion of olive flounder with inactivated V. anguillarum can stimulate the response and production of the polymeric immunoglobulin receptor [55]. A A. salmonicida-emulsified vaccine can protect turbot larvae without severe side effects on fish growth under field conditions and can also protect fish from chronic infections, which, in turn, reduces infection probability by other pathogens or parasites [56]. In addition to antibiotics, better feed or vaccination are effective approaches to prevent and treat aquatic diseases. These techniques not only improve the survival rate of fish but also protect the environment. Therefore, healthy breeding methods should be implemented, and appropriate farming methods should be sought during the breeding process to reduce disease occurrence.

5. Conclusions

By isolation on agar plates, several types of pathogenic Vibrio spp. were found in black rockfish with skin ulcer disease. This is the first study that reports V. scophthalmi in black rockfish. After investigating the presence of virulence genes and enzymes, a pathogenic potential was determined in all four isolates. The existence of a variety of Vibrio spp. will lead to cross-infection and increase the incidence of disease outbreaks. In the drug sensitivity test, four Vibrio spp. exhibited multidrug resistance. This finding makes the prevention and control of fish diseases face greater challenges, thereby urging us to find novel methods to solve the problem.

Author Contributions

Conceptualization, X.L. and Y.Z.; methodology, X.L.; software, X.L.; validation, Y.Z. and C.Y.; data curation, X.L.; writing—original draft preparation, X.L.; writing—review and editing, X.L.; visualization, X.L.; supervision, Y.Z.; project administration, Y.Z.; funding acquisition, C.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was approved by Laboratory animal welfare ethics review committee on 20 September 2020. Approval code: YTU2020SKY09.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Acknowledgments

This work was supported by the Special Fund for the Shellfish Industry Technology System in Shandong (SDAIT-14-05).

Conflicts of Interest

There are no conflict of interest.

References

  1. Zhang, Z.; Yu, Y.; Jiang, Y.; Wang, Y.; Liao, M.; Rong, X.; Wang, K.; Zhang, H.; Chen, J. First report of isolation and complete genome of Vibrio rotiferianus strain SSVR1601 from cage-cultured black rockfish (Sebastes schlegelii) associated with skin ulcer. J. Fish Dis. 2019, 42, 623–630. [Google Scholar] [CrossRef] [PubMed]
  2. Zheng, Z.; Yu, Y.X.; Wang, K.; Wang, Y.G.; Jiang, Y.; Liao, M.J.; Rong, X.J. First report of skin ulceration caused by Photobacterium Damselae Subsp. damselae in net-cage cultured black rockfish (Sebastes Schlegeli). Aquaculture 2019, 503, 1–7. [Google Scholar] [CrossRef]
  3. Jiang, Y.; Cao, Y.N.; Liu, X.Z.; Xu, Y.J.; Li, D.J.; Shi, B.; Wang, B. Structural characteristics of intestinal microbiota in black rockfish Sebastes schlegelii during early life stage. Aquat. Sci. 2020, 38, 200–208. [Google Scholar] [CrossRef]
  4. Lee, D.-Y.; Lee, C.-H.; Kim, K.-D.; Lim, H.J.; Kim, H.S. Effects of diet supplementation with plant juice processing by-products on juvenile black rockfish (Sebastes schlegelii) growth performance, feed utilization, non-specific immunity, and disease resistance against Vibrio harveyi. Aquac. Rep. 2021, 21, 100831. [Google Scholar] [CrossRef]
  5. Madusanka, R.K.; Priyathilaka, T.T.; Janson, N.; Kasthuriarachchi, T.; Jung, S.; Tharuka, M.N.; Lee, J. Molecular, transcriptional and functional delineation of Galectin-8 from black rockfish (Sebastes schlegelii) and its potential immunological role. Fish Shellfish. Immunol. 2019, 93, 449–462. [Google Scholar] [CrossRef]
  6. Lin, B.; Wang, Z.; Malanoski, A.; O’Grady, E.A.; Wimpee, C.F.; Vuddhakul, V.; Alves, N., Jr.; Thompson, F.L.; Gomez-Gil, B.; Vora, G.J. Comparative genomic analyses identify the Vibrio harveyi genome sequenced strains BAA-1116 and HY01 as Vibrio campbellii. Environ. Microbiol. Rep. 2009, 2, 81–89. [Google Scholar] [CrossRef]
  7. Nurhafizah, W.W.I.; Lee, K.L.; Laith A., A.R.; Nadirah, M.; Danish-Daniel, M.; Zainathan, S.C.; Najiah, M. Virulence properties and pathogenicity of multidrug-resistant Vibrio harveyi associated with luminescent vibriosis in Pacific white shrimp, Penaeus vannamei. J. Invertebr. Pathol. 2021, 186, 107594. [Google Scholar] [CrossRef]
  8. Li, Y.; Xu, Y.; Chen, W.B.; Zhang, S.S.; Sun, Y.; Ding, Y. Pathogen Identification of bacterial disease in marine cage cultured Sebastes Schlegeli and the study of pathogenicity. Aquaculture 2021, 02, 18–23. [Google Scholar] [CrossRef]
  9. Osei-Adjei, G.; Huang, X.; Zhang, Y. The extracellular proteases produced by Vibrio parahaemolyticus. World J. Microbiol. Biotechnol. 2018, 34, 68. [Google Scholar] [CrossRef]
  10. Bunpa, S.; Sermwittayawong, N.; Vuddhakul, V. Extracellular Enzymes Produced by Vibrio alginolyticus Isolated from Environments and Diseased Aquatic Animals. Procedia Chem. 2016, 18, 12–17. [Google Scholar] [CrossRef] [Green Version]
  11. Oh, E.-G.; Son, K.-T.; Yu, H.; Lee, T.-S.; Lee, H.-J.; Shin, S.; Kwon, J.-Y.; Park, K.; Kim, J. Antimicrobial resistance of Vibrio parahaemolyticus and Vibrio alginolyticus strains isolated from farmed fish in Korea from 2005 through 2007. J. Food Prot. 2011, 74, 380–386. [Google Scholar] [CrossRef]
  12. Wang, L.; Zhang, J.P.; Liu, M.R. Virulence genes detection and BOX-PCR identification of Vibrio harveyi strains isolated from Takifugu rubripes. Mod. Agric. Sci. Technol. 2018, 2, 237–239. [Google Scholar]
  13. Kotob, M.H.; Menanteau-Ledouble, S.; Kumar, G.; Abdelzaher, M.; El-Matbouli, M. Erratum to: The impact of co-infections on fish: A review. Vet-Res. 2017, 48, 26. [Google Scholar] [CrossRef] [Green Version]
  14. Wang, L.; Wang, Y.G.; Zhang, Z.; Chen, G.H.; Liao, M.J.; Chen, X.; Guo, W.L. Diversity and drug resistance of bacterial pathogens isolated from bacterial ascetic disease in cultured turbot Scophthalmus maximus. Prog. Fish. Sci. 2017, 38, 17–24. [Google Scholar]
  15. El-Son, M.A.; Nofal, M.I.; Abdel-Latif, H.M. Co-infection of Aeromonas hydrophila and Vibrio parahaemolyticus isolated from diseased farmed striped mullet (Mugil cephalus) in Manzala, Egypt–A case report. Aquaculture 2020, 530, 735738. [Google Scholar] [CrossRef]
  16. Callinan, R.B.; Keep, J.A. Bacteriology and parasitology of red spot disease in sea mullet, Mugil cephalus L., from eastern Australia. J. Fish Dis. 1989, 12, 349–356. [Google Scholar] [CrossRef]
  17. Chandrarathna, H.; Nikapitiya, C.; Dananjaya, S.; Wijerathne, C.; Wimalasena, S.; Kwun, H.J.; Heo, G.-J.; Lee, J.; De Zoysa, M. Outcome of co-infection with opportunistic and multidrug resistant Aeromonas hydrophila and A. veronii in zebrafish: Identification, characterization, pathogenicity and immune responses. Fish Shellfish. Immunol. 2018, 80, 573–581. [Google Scholar] [CrossRef]
  18. Zhang, Y.; Gong, C.; Zhao, Y.; Wang, G.; Liu, Y.; He, Z.; Ren, Y.; Cao, W.; Zhao, H.; Wang, Y.; et al. Isolation and characterization of nidovirus and bacterial co-infection from cultured turbot (Scophthalmus maximus) in China. Aquaculture 2022, 561, 738652. [Google Scholar] [CrossRef]
  19. Álvarez-Contreras, A.K.; Quiñones-Ramírez, E.I.; Vázquez-Salinas, C. Prevalence, detection of virulence genes and antimicrobial susceptibility of pathogen Vibrio species isolated from different types of seafood samples at “La Nueva Viga” market in Mexico City. Antonie Van Leeuwenhoek 2021, 114, 1417–1429. [Google Scholar] [CrossRef]
  20. Cai, J.P.; Chen, H.; Lin, A.-Q.; Zhong, X.M. Extra-cellular Enzyme-producing Abilities of Vibrios and Heterotrophic Bacteria Isolated from Hybrid Abalone In testiness and the Abalone Culture Waters. Fish. Sci. 2008, 27, 129–134. [Google Scholar] [CrossRef]
  21. Li, T.W.; Ding, M.J.; Zhang, J.; Xiang, J.H.; Liu, R.Y. Studies on the pustule disease of abalone (Haliotis discus hannai Ino) on the Dalian coast. J. Shellfish Res. 1998, 17, 707–711. Available online: http://ir.qdio.ac.cn/handle/337002/32953 (accessed on 1 March 2023).
  22. Yang, Q.; Defoirdt, T. Quorum sensing positively regulates flagellar motility in pathogenic vibrio harveyi. Environ. Microbiol. 2014, 17, 960–968. [Google Scholar] [CrossRef] [PubMed]
  23. Obaidat, M.M.; Salman, A.E.B.; Roess, A.A. Virulence and antibiotic resistance of Vibrio parahaemolyticus isolates from seafood from three developing countries and of worldwide environmental, seafood, and clinical isolates from 2000 to 2017. J. Food Prot. 2017, 80, 2060–2067. [Google Scholar] [CrossRef] [PubMed]
  24. Khan, F.; Tabassum, N.; Anand, R.; Kim, Y.-M. Motility of Vibrio spp.: Regulation and controlling strategies. Appl. Microbiol. Biotechnol. 2020, 104, 8187–8208. [Google Scholar] [CrossRef]
  25. Ruwandeepika, H.; Defoirdt, T.; Bhowmick, P.; Shekar, M.; Bossier, P.; Karunasagar, I. Presence of typical and atypical virulence genes in vibrio isolates belonging to the Harveyi clade. J. Appl. Microbiol. 2010, 109, 888–899. [Google Scholar] [CrossRef]
  26. Khouadja, S.; Suffredini, E.; Baccouche, B.; Croci, L.; Bakhrouf, A. Occurrence of virulence genes among Vibrio cholerae and Vibrio parahaemolyticus strains from treated wastewaters. Environ. Monit. Assess. 2014, 186, 6935–6945. [Google Scholar] [CrossRef]
  27. Wang, S.-Y.; Lauritz, J.; Jass, J.; Milton, D.L. A ToxR Homolog from Vibrio anguillarum Serotype O1 Regulates Its Own Production, Bile Resistance, and Biofilm Formation. J. Bacteriol. 2002, 184, 1630–1639. [Google Scholar] [CrossRef] [Green Version]
  28. Gubensäk, N.; Wagner, G.E.; Schrank, E.; Falsone, F.S.; Berger, T.M.I.; Pavkov-Keller, T.; Reidl, J.; Zangger, K.; Wagner-Lichtenegger, G.E. The periplasmic domains of Vibriocholerae ToxR and ToxS are forming a strong heterodimeric complex independent on the redox state of ToxR cysteines. Mol. Microbiol. 2020, 115, 1277–1291. [Google Scholar] [CrossRef]
  29. Qiao, G.; Jang, I.-K.; Won, K.M.; Woo, S.H.; Xu, D.-H.; Park, S.I. Pathogenicity comparison of high- and low-virulence strains of Vibrio scophthalmi in olive flounder Paralichthys olivaceus. Fish. Sci. 2012, 79, 99–109. [Google Scholar] [CrossRef]
  30. Qiao, G.; Lee, D.C.; Woo, S.H.; Li, H.; Xu, D.H.; Park, S.I. Microbiological characteristics of Vibrio scophthalmi isolates from diseased olive flounder Paralichthys olivaceus. Fish. Sci. 2012, 78, 853–863. [Google Scholar] [CrossRef]
  31. Qiao, G.; Li, H.; Xu, D.-H.; Park, S.I. Modified a colony forming unit microbial adherence to hydrocarbons assay and evaluated cell surface hydrophobicity and biofilm production of Vibrio scophthalmi. J. Bacteriol. Parasitol. 2012, 3, 1000130. [Google Scholar] [CrossRef] [Green Version]
  32. Ruwandeepika, H.; Jayaweera, T.; Bhowmick, P.P.; Karunasagar, I.; Bossier, P.; Defoirdt, T. Pathogenesis, virulence factors and virulence regulation of vibrios belonging to the harveyi clade. Rev. Aquac. 2012, 4, 59–74. [Google Scholar] [CrossRef]
  33. Manchanayake, T.; Salleh, A.; Amal, M.N.A.; Yasin, I.S.M.; Zamri-Saad, M. Pathology and pathogenesis of Vibrio infection in fish: A review. Aquac. Rep. 2023, 28, 101459. [Google Scholar] [CrossRef]
  34. Lee, N.-S.; Kim, D.-J.; Lee, B.-I.; Kim, S.K.; Kim, M.S.; Kim, Y.C. Vibrio scophthalmi infection in Japanese eel Anguilla japonica during seawater adaption. J. Fish Pathol. 2012, 25, 173–180. [Google Scholar] [CrossRef] [Green Version]
  35. Li, L.; Meng, H.; Gu, D.; Li, Y.; Jia, M. Molecular mechanisms of Vibrio parahaemolyticus pathogenesis. Microbiol. Res. 2019, 222, 43–51. [Google Scholar] [CrossRef]
  36. Baker-Austin, C.; Oliver, J.D.; Alam, M.; Ali, A.; Waldor, M.K.; Qadri, F.; Martinez-Urtaza, J. Vibrio spp. infections. Nat. Rev. Dis. Primers 2018, 4, 1–19. [Google Scholar] [CrossRef]
  37. Sohn, H.; Kim, J.; Jin, C.; Lee, J. Identification of Vibrio species isolated from cultured olive flounder (Paralichthys olivaceus) in Jeju Island, South Korea. Fish. Aquat. Sci. 2019, 22, 1–8. [Google Scholar] [CrossRef] [Green Version]
  38. Castello, A.; Alio, V.; Sciortino, S.; Oliveri, G.; Cardamone, C.; Butera, G.; Costa, A. Occurrence and Molecular Characterization of Potentially Pathogenic Vibrio spp. in Seafood Collected in Sicily. Microorganisms 2022, 11, 53. [Google Scholar] [CrossRef]
  39. Loo, K.; Letchumanan, V.; Law, J.W.; Pusparajah, P.; Goh, B.; Ab Mutalib, N.; He, Y.; Lee, L. Incidence of antibiotic resistance in Vibrio spp. Rev. Aquac. 2020, 12, 2590–2608. [Google Scholar] [CrossRef]
  40. Yu, Y.; Liu, X.; Wang, Y.; Liao, M.; Tang, M.; Rong, X.; Wang, C.; Li, B.; Zhang, Z. Antimicrobial Resistance and Genotype Characteristics of Vibrio scophthalmi Isolated from Diseased Mariculture Fish Intestines with Typical Inter-Annual Variability. Front. Mar. Sci. 2022, 9, 924130. [Google Scholar] [CrossRef]
  41. Yasir, M.; Ullah, R.; Bibi, F.; Khan, S.B.; Al-Sofyani, A.; Stingl, U.; Azhar, E. Draft genome sequence of a multidrug-resistant emerging pathogenic isolate of Vibrio alginolyticus from the Red Sea. New Microbes New Infect. 2020, 38, 100804. [Google Scholar] [CrossRef] [PubMed]
  42. Abdulhakeem, M.A.; Alreshidi, M.; Bardakci, F.; Hamadou, W.S.; De Feo, V.; Noumi, E.; Snoussi, M. Molecular Identification of Bacteria Isolated from Marketed Sparus aurata and Penaeus indicus Sea Products: Antibiotic Resistance Profiling and Evaluation of Biofilm Formation. Life 2023, 13, 548. [Google Scholar] [CrossRef] [PubMed]
  43. Kang, Y.J.; Wakabayashi, C.; Kim, K.H. Antihelminthic potential of quinacrine and oxyclozanide against gill parasite Microcotyle sebastis in black rockfish Sebastes schlegeli. Dis. Aquat. Org. 2016, 119, 259–263. [Google Scholar] [CrossRef] [PubMed]
  44. Torres-Corral, Y.; Girons, A.; González-Barreiro, O.; Seoane, R.; Riaza, A.; Santos, Y. Effect of Bivalent Vaccines against Vibrio anguillarum and Aeromonas salmonicida Subspecie achromogenes on Health and Survival of Turbot. Vaccines 2021, 9, 906. [Google Scholar] [CrossRef] [PubMed]
  45. Kim, A.; Kim, N.; Roh, H.J.; Chun, W.-K.; Ho, D.T.; Lee, Y.; Kim, D.-H. Administration of antibiotics can cause dysbiosis in fish gut. Aquaculture 2019, 512, 734330. [Google Scholar] [CrossRef]
  46. Sony, M.; Sumithra, T.; Anusree, V.; Amala, P.; Reshma, K.; Alex, S.; Sanil, N. Antimicrobial resistance and virulence characteristics of Vibrio vulnificus, Vibrio parahaemolyticus and Vibrio harveyi from natural disease outbreaks of marine/estuarine fishes. Aquaculture 2021, 539, 736608. [Google Scholar] [CrossRef]
  47. Deng, Y.; Xu, L.; Liu, S.; Wang, Q.; Guo, Z.; Chen, C.; Feng, J. What drives changes in the virulence and antibiotic resistance of Vibrio harveyi in the South China Sea? J. Fish Dis. 2020, 43, 853–862. [Google Scholar] [CrossRef]
  48. Lee, M.J.; Kim, J.; Baek, S.I.; Cho, S.H. Substitution effect of fish meal with meat meal in diet on growth performance, feed consumption, feed utilization, chemical composition, hematology, and innate immune responses of rockfish (Sebastes schlegeli). Aquaculture 2023, 571, 739467. [Google Scholar] [CrossRef]
  49. Jang, J.-W.; Lee, S.; Lee, B.-J.; Hur, S.-W.; Son, M.-H.; Kim, K.-W.; Kim, K.-D.; Han, H.-S. A comparative study of effects of dietary mercuric chloride and methylmercury chloride on growth performance, tissue accumulation, stress and immune responses, and plasma measurements in Korean rockfish, Sebastes schlegeli. Chemosphere 2020, 260, 127611. [Google Scholar] [CrossRef]
  50. Quico, C.A.; Astocondor, M.M.; Ortega, R.A. Dietary supplementation with Chlorella peruviana improve the growth and innate immune response of rainbow trout Oncorhynchus mykiss fingerlings. Aquaculture 2021, 533, 736117. [Google Scholar] [CrossRef]
  51. Ji, Q.; Wang, S.; Ma, J.; Liu, Q. A review: Progress in the development of fish Vibrio spp. vaccines. Immunol. Lett. 2020, 226, 46–54. [Google Scholar] [CrossRef]
  52. Aly, S.M.; Eissa, A.E.; ElBanna, N.I.; Albutti, A. Efficiency of monovalent and polyvalent Vibrio alginolyticus and Vibrio Parahaemolyticus vaccines on the immune response and protection in gilthead sea bream, Sparus aurata (L.) against vibriosis. Fish Shellfish. Immunol. 2020, 111, 145–151. [Google Scholar] [CrossRef]
  53. Raju, T.; Manchanayake, T.; Danial, A.; Zamri-Saad, M.; Azmai, M.N.A.; Yasin, I.S.M.; Nor, N.M.; Salleh, A. Evaluating the Intestinal Immunity of Asian Seabass (Lates calcarifer, Bloch 1790) following Field Vaccination Using a Feed-Based Oral Vaccine. Vaccines 2023, 11, 602. [Google Scholar] [CrossRef]
  54. Colquhoun, D.J.; Lillehaug, A. Vaccination against vibriosis. Fish Vaccin. 2014, 15, 172–184. [Google Scholar] [CrossRef]
  55. Sheng, X.; Chai, B.; Wang, Z.; Tang, X.; Xing, J.; Zhan, W. Polymeric immunoglobulin receptor and mucosal igm responses elicited by immersion and injection vaccination with inactivated vibrio anguillarum in flounder (Paralichthys olivaceus). Aquaculture 2019, 505, 1–11. [Google Scholar] [CrossRef]
  56. Yan, Y.; Liu, Y.; Mo, Z.; Li, J.; Liu, S.; Gao, Y.; Li, G. Development of Aeromonas salmonicida subsp. masoucida vaccine in turbot and evaluation of protection efficacy under field conditions. Aquaculture 2021, 544, 737035. [Google Scholar] [CrossRef]
Fishes 08 00235 g001 550
Figure 1. Results from 16S rDNA PCR. Lane 0, DNA bp ladder (100–2000 bp). The 1448-bp fragments of the isolates are represented accordingly: Lane 1 SF-2, Lane 2 SF-3, Lane 3 SF-5, Lane 4 SF-6.
Figure 1. Results from 16S rDNA PCR. Lane 0, DNA bp ladder (100–2000 bp). The 1448-bp fragments of the isolates are represented accordingly: Lane 1 SF-2, Lane 2 SF-3, Lane 3 SF-5, Lane 4 SF-6.
Fishes 08 00235 g001
Fishes 08 00235 g002 550
Figure 2. Neighbor-joining phylogenetic trees based on 16S rDNA gene sequences showing the relationship between isolates. The numbers at the nodes indicate the levels of bootstrap based on 1000 replicates. Sequences from related species were obtained from the GenBank database, and their accession numbers are indicated after the species name.
Figure 2. Neighbor-joining phylogenetic trees based on 16S rDNA gene sequences showing the relationship between isolates. The numbers at the nodes indicate the levels of bootstrap based on 1000 replicates. Sequences from related species were obtained from the GenBank database, and their accession numbers are indicated after the species name.
Fishes 08 00235 g002
Fishes 08 00235 g003 550
Figure 3. PCR results for virulence genes. (a) Virulence gene Flab; (b) virulence gene ToxS; (c) virulence gene TcpA. Lane 0, negative control; Lane 1: SF-2, Lane 2: SF-3, Lane 3: SF-5, Lane 4: SF-6, and DNA bp ladder (100–2000 bp).
Figure 3. PCR results for virulence genes. (a) Virulence gene Flab; (b) virulence gene ToxS; (c) virulence gene TcpA. Lane 0, negative control; Lane 1: SF-2, Lane 2: SF-3, Lane 3: SF-5, Lane 4: SF-6, and DNA bp ladder (100–2000 bp).
Fishes 08 00235 g003
Table
Table 1. Primer sequences for the detection of virulence genes in Vibrio spp.
Table 1. Primer sequences for the detection of virulence genes in Vibrio spp.
virulence GenePrimer SequencePrimer
Sequence (bp)		Product
Size (°C)		Reference
TdhGTAAAGGTCTCTGACTTTTGGAC
TGGAATAGAACCTTCATCTTCACC		26960[11]
TrhTTGGCTTCGATATTTTCAGTATCT
CATAACAAACATATGCCCATTTCCG		50060[11]
TlhGCTACTTTCTAGCATTTTCTCTGC
AAAGCGGATTATGCAGAAGCACTG		45060[11]
ZotCACTGGGCGAGAAAGGAC
CGCCCATAGACCACGATA		73758[12]
TcpAACCGTGGTCTAGGTAATT
CAACGCCGAATGGAGCAG		43158[12]
ToxSCCACTGGCGGACAAAATAACC
AACAGTACCGTAGAACCGTGA		64052[12]
ToxRGTCTTCTGACGCAATCGTTG
ATACGAGTGGTTGCTTCATG		36852[11]
FlaBAACGTATCAGCGATGACC
TTGAAACGGTTCTGGAAT		92850[12]
Table
Table 2. Physiological and biochemical findings.
Table 2. Physiological and biochemical findings.
Physiological IdentificationSF-2SF-3SF-5SF-6
Gram stain−−−−
Oxidase enzyme++++
Methyl red++−−
VP+−+−
H2S−+−−
Citrate−+−+
Glucose gas production−−−−
Salt-free tryptone water−−−−
6% tryptone water−+++
8% tryptone water−−++
10% tryptone water−−++
“+” positive; “−” negative.
Table
Table 3. Extracellular enzyme activity.
Table 3. Extracellular enzyme activity.
EnzymesSF-2SF-3SF-5SF-6
Caseinase−+++
Lecithinase−+++
Lipase−+++
Gelatinase−+++
“+” extracellular enzyme activity detected, “−” extracellular enzyme activity not detected.
Table
Table 4. Disk diffusion test results for the four Vibrio isolates from black rockfish.
Table 4. Disk diffusion test results for the four Vibrio isolates from black rockfish.
AntibioticSF-2SF-3SF-5SF-6
GentamicinRIII
CotrimoxazoleRSRR
AmpicillinRRRR
Penicillin GRRRR
ErythromycinIIII
NorfloxacinRIRR
ChloramphenicolRSRR
AmikacinRRRR
CiprofloxacinRRRR
Pioneer VRRRR
SpectinomycinSRSS
EnrofloxacinIIRR
CefotaximeIRRI
LevofloxacinRIRR
CefoxitinRRRR
RifampicinRRRR
DoxycyclineRRRR
ImipenemRRRR
ClindamycinRRRR
MetronidazoleRRRR
AmoxicillinRRRR
BacitracinRRRR
“S” sensitive, “I” intermediate sensitivity, “R” resistant.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, X.; You, C.; Zeng, Y. Isolation and Identification of Pathogenic Vibrio Species in Black Rockfish Sebastes schlegeli. Fishes 2023, 8, 235. https://doi.org/10.3390/fishes8050235

AMA Style

Liu X, You C, Zeng Y. Isolation and Identification of Pathogenic Vibrio Species in Black Rockfish Sebastes schlegeli. Fishes. 2023; 8(5):235. https://doi.org/10.3390/fishes8050235

Chicago/Turabian Style

Liu, Xiaoling, Cuirong You, and Yong Zeng. 2023. "Isolation and Identification of Pathogenic Vibrio Species in Black Rockfish Sebastes schlegeli" Fishes 8, no. 5: 235. https://doi.org/10.3390/fishes8050235

APA Style

Liu, X., You, C., & Zeng, Y. (2023). Isolation and Identification of Pathogenic Vibrio Species in Black Rockfish Sebastes schlegeli. Fishes, 8(5), 235. https://doi.org/10.3390/fishes8050235

Article Metrics

Back to TopTop