Molecular Characterization and Nutrition Regulation of the Glutamine Synthetase Gene in Triploid Crucian Carp
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Tissue Preparation
2.2. Cloning of GS cDNA and Its Phylogenetic Analysis
2.3. Total RNA Isolation and Quantitative Real-Time PCR Analysis
2.4. Effects of Glutamate and Glutamine on GS Expression
2.4.1. In Vitro Study
2.4.2. In Vivo Study
2.5. Dietary Protein Levels and Resources for the Regulation of GS Expression
2.6. Statistical Analyses of Data
2.7. Ethics Statement
3. Results
3.1. Cloning and Sequence Analysis of GS cDNA from Triploid Crucian Carp
3.2. The Temporal and Spatial GS Gene Expressions of Triploid Crucian Carp
3.3. Effects of Glutamate, Glutamine and Lys-Glu Dipeptides on GS mRNA Expression of Triploid Crucian Carp
3.4. Effects of Dietary Protein Levels and Dietary Protein Sources on GS mRNA Expression in Muscle of Triploid Crucian Carp
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yoo, H.C.; Yu, Y.C.; Sung, Y.; Han, J.M. Glutamine reliance in cell metabolism. Exp. Mol. Med. 2020, 52, 1496–1516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumada, Y.; Benson, D.R.; Hillemann, D.; Hosted, T.J.; Rochefort, D.A.; Thompson, C.J.; Wohlleben, W.; Tateno, Y. Evolution of the glutamine synthetase gene, one of the oldest existing and functioning genes. Proc. Natl. Acad. Sci. USA 1993, 90, 3009–3013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, Q.; Shi, X.; Zhang, L.; Yi, C.; Zhang, X.; Zhang, X. De Novo Glutamine Synthesis: Importance for the Proliferation of Glioma Cells and Potentials for Its Detection With 13N-Ammonia. Mol. Imaging 2016, 15, 1536012116645440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bartl, M.; Pfaff, M.; Ghallab, A.; Driesch, D.; Henkel, S.G.; Hengstler, J.G.; Schuster, S.; Kaleta, C.; Gebhardt, R.; Zellmer, S.; et al. Optimality in the zonation of ammonia detoxification in rodent liver. Arch. Toxicol. 2015, 89, 2069–2078. [Google Scholar] [CrossRef] [Scilit]
- Eelen, G.; Dubois, C.; Cantelmo, A.R.; Goveia, J.; Brüning, U.; DeRan, M.; Jarugumilli, G.; van Rijssel, J.; Saladino, G.; Comitani, F.; et al. Role of glutamine synthetase in angiogenesis beyond glutamine synthesis. Nature 2018, 561, 63–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eid, T.; Lee, T.W.; Patrylo, P.; Zaveri, H.P. Astrocytes and Glutamine Synthetase in Epileptogenesis. J. Neurosci. Res. 2019, 97, 1345–1362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roth, E. Nonnutritive Effects of Glutamine1–3. J. Nutr. 2008, 138, 2025S–2031S. [Google Scholar] [CrossRef] [Scilit]
- Min-Hyun, K.; Hyeyoung, K. The Roles of Glutamine in the Intestine and Its Implication in Intestinal Diseases. Int. J. Mol. Sci. 2017, 18, 1051. [Google Scholar] [CrossRef] [Scilit]
- Anderson, P.M.; Broderius, M.A.; Fong, K.C.; Tsui, K.N.; Chew, S.F.; Ip, Y.K. Glutamine synthetase expression in liver, muscle, stomach and intestine of Bostrichthys sinensis in response to exposure to a high exogenous ammonia concentration. J. Exp. Biol. 2002, 205, 2053–2065. [Google Scholar] [CrossRef] [Scilit]
- Wicks, B.J.; Randall, D.J. The effect of sub-lethal ammonia exposure on fed and unfed rainbow trout: The role of glutamine in regulation of ammonia. Comp. Biochem. Physiol A Mol. Integr. Physiol. 2002, 132, 275–285. [Google Scholar] [CrossRef] [Scilit]
- Bucking, C.; Wood, C.M. Digestion of a single meal affects gene expression of ion and ammonia transporters and glutamine synthetase activity in the gastrointestinal tract of freshwater rainbow trout. J. Comp. Physiol B 2012, 182, 341–350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, R.; Qu, F.; Tang, J.; Zhao, Q.; Yan, J.; Zhou, Z.; Zhou, Y.; Liu, Z. Cloning, expression, and nutritional regulation of the glutamine synthetase gene in Ctenopharyngodon idellus. Comp. Biochem. Physiol B Biochem. Mol. Biol. 2017, 212, 70–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, Y.; Hakvoort, T.B.M.; Köhler, S.E.; Vermeulen, J.L.M.; de Waart, D.R.; de Theije, C.; Ten Have, G.A.M.; van Eijk, H.M.H.; Kunne, C.; Labruyere, W.T.; et al. Glutamine synthetase in muscle is required for glutamine production during fasting and extrahepatic ammonia detoxification. J. Biol. Chem. 2010, 285, 9516–9524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Wang, L.; Yao, C.; Qiu, L.; Zhang, H.; Zhi, Z.; Song, L. Alternation of immune parameters and cellular energy allocation of Chlamys farreri under ammonia-N exposure and Vibrio anguillarum challenge. Fish Shellfish Immun. 2012, 32, 741–749. [Google Scholar] [CrossRef] [Scilit]
- Jia, S.; Li, X.; Zheng, S.; Wu, G. Amino acids are major energy substrates for tissues of hybrid striped bass and zebrafish. Amino Acids 2017, 49, 2053–2063. [Google Scholar] [CrossRef] [Scilit]
- Li, P.; Wu, G. Composition of amino acids and related nitrogenous nutrients in feedstuffs for animal diets. Amino Acids 2020, 52, 523–542. [Google Scholar] [CrossRef] [Scilit]
- Xu, H.; Zhu, Q.; Wang, C.A.; Zhao, Z.G.; Luo, L.; Wang, L.S.; Li, J.N.; Xu, Q.Y. Effect of Dietary Alanyl-glutamine Supplementation on Growth Performance, Development of Intestinal Tract, Antioxidant Status and Plasma Non-specific Immunity of Young Mirror Carp (Cyprinus carpio L.). J. Northeast Agric. Univ. 2014, 21, 37–46. [Google Scholar] [CrossRef] [Scilit]
- Zhelyazkov, G.; Stratev, D. Effect of monosodium glutamate on growth performance and blood biochemical parameters of rainbow trout (Oncorhynchus mykiss W.). Vet. World 2019, 12, 1008–1012. [Google Scholar] [CrossRef] [Scilit]
- Yan, L.; Xiao, Q.Z. Dietary glutamine supplementation improves structure and function of intestine of juvenile Jian carp (Cyprinus carpio var. Jian)-ScienceDirect. Aquaculture 2006, 256, 389–394. [Google Scholar] [CrossRef] [Scilit]
- Yoshida, C.; Maekawa, M.; Bannai, M.; Yamamoto, T. Glutamate promotes nucleotide synthesis in the gut and improves availability of soybean meal feed in rainbow trout. Springerplus 2016, 5, 1021. [Google Scholar] [CrossRef] [Scilit]
- Cheng, Z.; Gatlin III, D.M.; Buentello, A. Dietary supplementation of arginine and/or glutamine influences growth performance, immune responses and intestinal morphology of hybrid striped bass (Morone chrysops × Morone saxatilis). Aquaculture 2012, 362–363, 39–43. [Google Scholar] [CrossRef] [Scilit]
- Larsson, T.; Koppang, E.O.; Espe, M.; Terjesen, B.F.; Krasnov, A.; Moreno, H.M.; Rørvik, K.; Thomassen, M.; Mørkøre, T. Fillet quality and health of Atlantic salmon (Salmo salar L.) fed a diet supplemented with glutamate. Aquaculture 2014, 426, 288–295. [Google Scholar] [CrossRef] [Scilit]
- Jiang, J.; Wu, X.Y.; Zhou, X.Q.; Feng, L.; Liu, Y.; Jiang, W.D.; Wu, P.; Zhao, Y. Glutamate ameliorates copper-induced oxidative injury by regulating antioxidant defences in fish intestine. Br. J. Nutr. 2016, 116, 70–79. [Google Scholar] [CrossRef] [Scilit]
- Dai, S.F.; Wang, L.K.; Wen, A.Y.; Wang, L.X.; Jin, G.M. Dietary glutamine supplementation improves growth performance, meat quality and colour stability of broilers under heat stress. Bri. Poult. Sci. 2009, 50, 333–340. [Google Scholar] [CrossRef] [Scilit]
- Fuke, S.; Konosu, S. Taste-active components in some foods: A review of Japanese research. Physiol. Behav. 1991, 49, 863–868. [Google Scholar] [CrossRef] [Scilit]
- Hamada-Sato, N.; Usui, K.; Kobayashi, T.; Imada, C.; Watanabe, E. Quality assurance of raw fish based on HACCP concept. Food Control 2005, 16, 301–307. [Google Scholar] [CrossRef] [Scilit]
- Holecek, M.; Sispera, L.; Skalska, H. Enhanced Glutamine Availability Exerts Different Effects on Protein and Amino Acid Metabolism in Skeletal Muscle from Healthy and Septic Rats. Jpen-Parenter. Enter. 2014, 39, 847. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanderson, L.A.; Wright, P.A.; Robinson, J.W.; Ballantyne, J.S.; Bernier, N.J. Inhibition of glutamine synthetase during ammonia exposure in rainbow trout indicates a high reserve capacity to prevent brain ammonia toxicity. J. Exp. Biol. 2010, 213, 2343–2353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramos, A.R.P.; Campelo, D.A.V.; da Silva Carneiro, C.L.; Zuanon, J.A.S.; da Matta, S.L.P.; Furuya, W.M.; Salaro, A.L. Optimal dietary L-glutamine level improves growth performance and intestinal histomorphometry of juvenile giant trahira (Hoplias lacerdae), a Neotropical carnivorous fish species. Aquaculture 2022, 547, 737469. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Wu, G. Oxidation of energy substrates in tissues of Largemouth bass (Micropterus salmoides). J. Anim. Sci. 2019, 97, 68–69. [Google Scholar] [CrossRef] [Scilit]
- Yao, Z.; Dubois, D.C.; Almon, R.R.; Jusko, W.J. Modeling Circadian Rhythms of Glucocorticoid Receptor and Glutamine Synthetase Expression in Rat Skeletal Muscle. Pharm. Res. 2006, 23, 670–679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Zheng, S.; Wu, G. Nutrition and metabolism of glutamate and glutamine in fish. Amino Acids 2020, 52, 671–691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Q.H.; Zhou, Q.C.; Tan, B.P.; Chi, S.Y.; Dong, X.H.; Chang-Qian, D.U.; Wang, X.F. Effects of dietary glutamine on growth performance, feed utilization and anti-disease ability of hybrid tilapia (Oreochromis niloticus ♀ × O. aureus ♂). J. Fish. Sci. China 2008, 15, 1016–1023. [Google Scholar]
- Cruzat, V.F.; Pantale, O.L.C.; Donato, J.; Bittencourt, P.D.; Tirapegui, J. Oral supplementations with free and dipeptide forms of l-glutamine in endotoxemic mice: Effects on muscle glutamine-glutathione axis and heat shock proteins. J. Nutr. Biochem. 2014, 25, 345–352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bo, F.; Shiber, S.K.; Max, S.R. Glutamine regulates glutamine synthetase expression in skeletal muscle cells in culture. J. Cell. Physiol. 1990, 145, 376–380. [Google Scholar] [CrossRef] [Scilit]
- Meng, L.; Zhang, B.; Yu, C.; Li, J.; Lin, Z.; Sun, H.; Feng, G.; Zhou, G. L-Glutamate Supplementation Improves Small Intestinal Architecture and Enhances the Expressions of Jejunal Mucosa Amino Acid Receptors and Transporters in Weaning Piglets. PLoS ONE 2014, 9, e111950. [Google Scholar] [CrossRef] [Scilit]
- Mccauley, R.; Kong, S.E.; Heel, K.; Hall, J.C. The role of glutaminase in the small intestine. Int. J. Biochem. Cell B 1999, 31, 405–413. [Google Scholar] [CrossRef] [Scilit]
- Hashimoto, S.I. Occurrence, Biosynthesis, and Biotechnological Production of Dipeptides. In Amino Acid Biosynthesis, Pathways, Regulation and Metabolic Engineering; Wendisch, V.F., Ed.; Springer: Berlin/Heidelberg, Germany, 2007; Volume 5, pp. 327–348. [Google Scholar] [CrossRef] [Scilit]
- Leung, K.; Chu, J.; Wu, R. Effects of body weight, water temperature and ration size on ammonia excretion by the areolated grouper (Epinephelus areolatus) and mangrove snapper (Lutjanus argentimaculatus). Aquaculture 1999, 170, 215–227. [Google Scholar] [CrossRef] [Scilit]
- Grove, K. Effects of feeding frequency on growth and food utilisation of rainbow trout (Oncorhynchus mykiss) fed low-fat herring or dry pellets. Aquaculture 1998, 165, 111–121. [Google Scholar] [CrossRef] [Scilit]




| Primer Name | Primer Sequence | Usage |
|---|---|---|
| GS F: | 5′ GAATGAGAGAATACCGAACACA 3′ | CDS |
| GS R: | 5′ GAGGGAAGTTCAGTCCAGAAG 3′ | CDS |
| GS qPCR F: | 5′ GAGTAAAGTGGTAAAACGGCA 3′ | Real-time PCR |
| GS qPCR R: | 5′ TCAATGCTTTTAGGCTCCGA 3′ | Real-time PCR |
| β-actin qPCR F: | 5′ GAAACTGGAAAGGGAGGTAGC 3′ | Real-time PCR |
| β-actin qPCR R: | 5′ CTGTGAGGGCAGAGTGGTAGA 3′ | Real-time PCR |
| Ingredients | Supplementation of Glutamate or Glutamine | ||||||
|---|---|---|---|---|---|---|---|
| Control | 0.5% | 1.0% | 1.5% | 2.0% | 2.5% | 3.0% | |
| Glutamate or Glutamine | 0.00 | 0.50 | 1.00 | 1.50 | 2.00 | 2.50 | 3.00 |
| Fishmeal | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 |
| Soybean meal | 34.00 | 34.00 | 34.00 | 34.00 | 34.00 | 34.00 | 34.00 |
| Rapeseed meal | 23.60 | 23.60 | 23.60 | 23.60 | 23.60 | 23.60 | 23.60 |
| Wheat flour | 16.00 | 16.00 | 16.00 | 16.00 | 16.00 | 16.00 | 16.00 |
| Fish oil | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 |
| Soybean oil | 2.50 | 2.50 | 2.50 | 2.50 | 2.50 | 2.50 | 2.50 |
| Cornstarch | 6.00 | 6.00 | 6.00 | 6.00 | 6.00 | 6.00 | 6.00 |
| Choline | 0.11 | 0.11 | 0.11 | 0.11 | 0.11 | 0.11 | 0.11 |
| Premix 1 | 1.50 | 1.50 | 1.50 | 1.50 | 1.50 | 1.50 | 1.50 |
| Methionine | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Carboxymethyl cellulose | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| Cellulose | 8.79 | 8.29 | 7.79 | 7.29 | 6.79 | 6.29 | 5.79 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Proximate composition of the glutamate group diets | |||||||
| Crude protein | 31.02 | 31.52 | 32.02 | 32.52 | 33.02 | 33.52 | 34.02 |
| Crude lipid | 6.03 | 6.03 | 6.03 | 6.03 | 6.03 | 6.03 | 6.03 |
| Moisture | 6.63 | 5.75 | 6.53 | 6.84 | 6.58 | 6.21 | 6.32 |
| Ash | 5.66 | 5.79 | 5.63 | 5.70 | 5.30 | 5.55 | 5.62 |
| Proximate composition of the glutamine group diets | |||||||
| Crude protein | 31.02 | 31.52 | 32.02 | 32.52 | 33.02 | 33.52 | 34.02 |
| Crude lipid | 6.03 | 6.03 | 6.03 | 6.03 | 6.03 | 6.03 | 6.03 |
| Moisture | 6.63 | 6.17 | 6.89 | 6.02 | 6.46 | 6.90 | 6.90 |
| Ash | 5.66 | 5.60 | 5.60 | 5.71 | 5.69 | 5.62 | 5.65 |
| Ingredients | Control | Lys-Glu 0.4% | Lys-Glu 0.8% | Lys-Glu 1.2% | Lys-Glu 1.6% | Lys-Glu 2.0% |
|---|---|---|---|---|---|---|
| Fishmeal | 12.00 | 12.00 | 12.00 | 12.00 | 12.00 | 12.00 |
| Soybean meal | 20.00 | 20.00 | 20.00 | 20.00 | 20.00 | 20.00 |
| Rapeseed meal | 15.00 | 15.00 | 15.00 | 15.00 | 15.00 | 15.00 |
| Casein | 6.50 | 6.50 | 6.50 | 6.50 | 6.50 | 6.50 |
| Fish oil | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| Soybean oil | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| Cornstarch | 16.80 | 16.80 | 16.80 | 16.80 | 16.80 | 16.80 |
| Wheat flour | 10.00 | 10.00 | 10.00 | 10.00 | 10.00 | 10.00 |
| Choline | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Premix | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| Carboxymethyl cellulose | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| Cellulose | 7.20 | 6.80 | 6.40 | 6.00 | 5.60 | 5.20 |
| Lysine-glutamate dipeptide | 0.00 | 0.40 | 0.80 | 1.20 | 1.60 | 2.00 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Proximate composition | ||||||
| Crude protein | 32.01 | 32.41 | 32.81 | 33.21 | 33.61 | 34.01 |
| Crude lipid | 8.07 | 8.07 | 8.07 | 8.07 | 8.07 | 8.07 |
| Moisture | 10.05 | 12.31 | 9.80 | 9.70 | 11.18 | 0.93 |
| Ash | 6.78 | 6.48 | 6.97 | 6.54 | 6.77 | 7.15 |
| Group | 26% CP | 29% CP | 32% CP | 35% CP | 38% CP | 41% CP | FM | SM |
|---|---|---|---|---|---|---|---|---|
| Fish meal | 12.00 | 12.00 | 12.00 | 12.00 | 12.00 | 12.00 | 44.40 | 0.00 |
| Soybean meal | 20.00 | 20.00 | 20.00 | 20.00 | 20.00 | 20.00 | 0.00 | 37.10 |
| Rapeseed meal | 15.00 | 15.00 | 15.00 | 15.00 | 15.00 | 15.00 | 0.00 | 15.00 |
| casein | 0.00 | 3.20 | 6.50 | 9.80 | 13.10 | 16.40 | 0.00 | 6.50 |
| fish oil | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 1.63 | 3.50 |
| soya-bean oil | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 1.63 | 3.50 |
| corn starch | 25.00 | 21.00 | 16.80 | 12.60 | 8.40 | 4.20 | 31.00 | 10.00 |
| wheat flour | 10.00 | 10.00 | 10.00 | 10.00 | 10.00 | 10.00 | 10.00 | 10.00 |
| choline | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Premix | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| Carboxymethyl cellulose | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| cellulose | 5.50 | 6.30 | 7.20 | 8.10 | 9.00 | 9.00 | 4.80 | 7.90 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 99.10 | 99.96 | 100.00 |
| Proximate composition | ||||||||
| Crude protein | 26.08 | 29.00 | 32.01 | 35.03 | 38.04 | 41.05 | 32.05 | 32.03 |
| Crude lipid | 8.07 | 8.07 | 8.07 | 8.07 | 8.07 | 8.07 | 8.05 | 8.06 |
| Moisture | 9.12 | 6.01 | 10.05 | 8.19 | 5.75 | 7.26 | 9.73 | 9.86 |
| Ash | 6.15 | 6.12 | 6.78 | 6.13 | 6.34 | 6.75 | 9.11 | 5.65 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, X.; Zhao, D.; Chen, Y.; Xiao, Y.; Mao, Z.; Cao, S.; Qu, F.; Li, Y.; Jin, J.; Liu, Z.; et al. Molecular Characterization and Nutrition Regulation of the Glutamine Synthetase Gene in Triploid Crucian Carp. Fishes 2022, 7, 196. https://doi.org/10.3390/fishes7040196
Zhou X, Zhao D, Chen Y, Xiao Y, Mao Z, Cao S, Qu F, Li Y, Jin J, Liu Z, et al. Molecular Characterization and Nutrition Regulation of the Glutamine Synthetase Gene in Triploid Crucian Carp. Fishes. 2022; 7(4):196. https://doi.org/10.3390/fishes7040196
Chicago/Turabian StyleZhou, Xiaomei, Dafang Zhao, Yuan Chen, Yangbo Xiao, Zhuangwen Mao, Shenping Cao, Fufa Qu, Yutong Li, Junyan Jin, Zhen Liu, and et al. 2022. "Molecular Characterization and Nutrition Regulation of the Glutamine Synthetase Gene in Triploid Crucian Carp" Fishes 7, no. 4: 196. https://doi.org/10.3390/fishes7040196
APA StyleZhou, X., Zhao, D., Chen, Y., Xiao, Y., Mao, Z., Cao, S., Qu, F., Li, Y., Jin, J., Liu, Z., Li, J., & He, Z. (2022). Molecular Characterization and Nutrition Regulation of the Glutamine Synthetase Gene in Triploid Crucian Carp. Fishes, 7(4), 196. https://doi.org/10.3390/fishes7040196

