Next Article in Journal
Boldness in Zebrafish Larvae—Development and Differences between a Domesticated Lab Strain and Offspring of Wild-Caught Fish
Next Article in Special Issue
Substituting Fish Meal with a Bacteria Protein (Clostridium autoethanogenum Protein) Derived from Industrial-Scale Gas Fermentation: Effects on Growth and Gut Health of Juvenile Large Yellow Croakers (Larimichthys crocea)
Previous Article in Journal
The Potential Compatibility of Designating Offshore Wind Farms within Wider Marine Protected Areas—Conservation of the Chinese White Dolphin Regarding Fishers’ Perception
Previous Article in Special Issue
Dietary Arachidonic Acid (20:4n-6) Levels and Its Effect on Growth Performance, Fatty Acid Profile, Gene Expression for Lipid Metabolism, and Health Status of Juvenile California Yellowtail (Seriola dorsalis)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization and Nutrition Regulation of the Glutamine Synthetase Gene in Triploid Crucian Carp

1
State Key Laboratory of Developmental Biology of Freshwater Fish, Department of Life Sciences, Hunan Normal University, Changsha 410081, China
2
Hunan Provincial Key Laboratory of Nutrition and Quality Control of Aquatic Animals, Department of Biological and Environmental Engineering, Changsha University, Changsha 410022, China
3
State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China
*
Authors to whom correspondence should be addressed.
Fishes 2022, 7(4), 196; https://doi.org/10.3390/fishes7040196
Submission received: 7 July 2022 / Revised: 2 August 2022 / Accepted: 4 August 2022 / Published: 8 August 2022
(This article belongs to the Special Issue Fish Nutrition and Physiology)

Abstract

Glutamine synthetase (GS) is a key enzyme that catalyzes the synthesis of glutamine from glutamate, which plays a role in the promotion of muscle cell growth and in improving the flavor of meats. In this study, a GS gene encoding 371 amino acids was cloned from triploid crucian carp and showed the highest level of similarity with the GS gene found in Cyprinus carpio. Meanwhile, GS was differentially expressed in different tissues, and its day–night expression changes showed obvious oscillation. Additionally, the effects of glutamate and glutamine on GS expression in muscle cells were investigated in vitro and in vivo. We found that its expression was obviously increased due to high levels of glutamate (2 mg/mL) but decreased by glutamine in vitro. However, it was significantly promoted by glutamate and glutamine in vivo, with an optimal concentration of 2%. Furthermore, the use of lysine–glutamate dipeptides as feed additives also had a positive influence on GS expression (the optimal concentration is 0.8%). Finally, we explored the effects of different protein levels and sources on the expression of GS, and the results demonstrated that GS had the highest expression at the 35% protein level, but no significant differences were observed in the different protein sources between the fish meal diet (FM) and the mixed diet comprising soybean meal and rapeseed meal (SM). This study sheds new light on the regulation of GS in teleost fish and provides new perceptions and strategies for the formulation of high-quality feed for triploid crucian carp.

1. Introduction

Glutamine (Gln), an abundant intracellular functional amino acid found in muscle, is a critical substrate for protein synthesis and inosine monophosphate (IMP) synthesis, both of which have a significant impact on fish growth and meat flavor [1]. The glutamine level in living organisms is kept in a dynamic equilibrium by a series of enzymes. There are many kinds of enzymes that promote the degradation of glutamine, while there is only one enzyme that is responsible for the de novo synthesis of glutamine: glutamine synthetase (GS) [2,3].
GS catalyzes glutamate and ammonia synthesis into glutamine to regulate intracellular metabolism. In higher vertebrates, GS is highly expressed in brain, liver, intestinal, and endothelial cells and plays an important role in brain ammonia and neurotransmitter homeostasis, in the excretion and metabolization of body ammonia, in intestinal cell growth, and in angiogenesis [4,5,6]. GS activity in muscle is related to the removal of extrahepatic ammonia, the turnover of muscle proteins, the synthesis of nucleic acid, cellular immunity, and meeting the energy demands of the surrounding tissues [7,8].
GS has been studied extensively over the course of its long evolutionary history, as has fish GS. According to previous studies, GS can remove endogenous ammonia and exogenous ammonia in rainbow trout by catalyzing glutamate and ammonia to glutamine, and exogenous ammonia can stimulate its activity in the muscle, liver, intestine, and stomach of the teleost fish Bostrichthys sinensis [9,10]. In addition, the digestion of a single meal able to affect GS activity in the gastrointestinal tract was first demonstrated in teleost fish [11]. Moreover, Hu et al. also found that low-protein diets and fish meal can stimulate GS activity in Ctenopharyngodon idellus intestine and that glutamine dipeptides can increase GS mRNA expression in vitro [12]. As the only synthase to synthesize glutamine, GS expression plays a major role in maintaining glutamine levels in the muscle amino acid pool. Until now, few studies have shown the dietary regulation of GS mRNA expression in fish muscle [13,14]. Thus, it is necessary to understand nutrition regulation for the GS gene in skeletal muscle.
Glutamate and glutamine, which are functional amino acids in cells, are the main fuel for metabolism in fish tissues [15]. Although glutamate and glutamine can be synthesized in the body de novo, they are commonly added to diets as feed additives because of the high physiological requirements of animals [16]. As feed additives, they promote intestinal development, innate and acquired immune responses, skeletal muscle development and fillet quality, ammonia removal, and endocrine status [17,18,19,20,21,22,23]. Moreover, Hu et al. showed that exogenous glutamine dipeptides promoted the expression of intestinal GS mRNA in grass carp [12]. Therefore, we hypothesized that the supplementation of glutamine and glutamate improves fish growth performance as a result of their influence on GS activity. Until now, only a few studies related to this have been reported, especially regarding aquatic animals.
With the rapid development of aquaculture, the demand for fish meal has soared. In recent years, the total supply of fishmeal has decreased and the price has increased. Therefore, improving the utilization rate of protein and optimizing feed formula are the key factors to reducing feed cost and alleviating the current situation of fish meal shortage.
In this study, the GS gene sequence of triploid crucian carp was cloned, bioinformatics analysis was performed, and then the spatio-temporal expression pattern in muscle was revealed. Moreover, we investigated the effects of different glutamate and glutamine concentrations on the GS expression levels in muscle cells in vivo and in vitro. Moreover, different concentrations of lysine–glutamate dipeptides were investigated to determine their effects on GS expression levels in vitro. Finally, we also studied the changes in GS expression under different protein levels and different protein sources. Collectively, this study provides a reference for further understanding the function of GS and its expression regulation.

2. Materials and Methods

2.1. Animals and Tissue Preparation

The healthy triploid crucian carp that were used in this experiment were purchased from the Hunan Fisheries Science Research Institute. All of the fish were placed in the experimental environment and cultured for 2 weeks. The fish were fed a commercial diet (crude protein 32.20%, crude lipid 6.54%, ash 10.4%, and gross energy 18.5 MJ/kg) twice daily at 9:00 and 15:00. Then, a certain number of healthy juvenile triploid crucian carp of similar size were selected for the experiment. All of the fish were anesthetized with 2-phenoxyethanol before being dissected. The whole dissection operation was carried out on a clean table surface. White muscle samples were placed into a 1.5 mL EP tube and quickly inserted into liquid nitrogen for temporary storage.

2.2. Cloning of GS cDNA and Its Phylogenetic Analysis

Homologous cloning was employed to clone the full length of GS cDNA. The cloning primers were designed according to the conserved sequences of GS genes from other teleost fish from the NCBI database (Table 1). The target specific fragments were purified using the Takara Agarose Gel DNA Purification Kit 2.0 (Takara, Shiga, Japan) and were ligated to PMD-T19 (Takara, Shiga, Japan). Then, the recombinant plasmid vector was transformed into Escherichia coli DH5 competent cells (Takara, Shiga, Japan). The positive clones were sequenced. The nucleotide sequence of GS was analyzed using the BLAST network service via the NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi; 9 August 2021). The protein sequence was predicted using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi; 9 August 2021). A neighbor-joining (NJ) phylogenetic tree was constructed based on the multiple sequence alignment using the MEGA 4.0 package with 1000 bootstrap repetitions.

2.3. Total RNA Isolation and Quantitative Real-Time PCR Analysis

Total RNA profiles were isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA). The cDNA was synthesized from 1μg of total RNA using the Evo M-MLV RT Kit with gDNA Clean for qPCR (Accurate biology, AG11705) and were used according to the manufacturer’s instructions. The SYBR® Green Premix Pro Taq HS qPCR Kit (Accurate biology, AG11701) was used for qPCR along with the Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) to determine the mRNA expression of different genes. Briefly, cDNA was diluted 10 times to be used as template in a 16 µL qPCR reaction that was pre-denatured at 95 °C for 5 min followed by a 40-cycle program (95 °C, 10 s; 55 °C, 30 s; 72 °C, 30 s per cycle). The mRNA level of β-actin was used as the internal control. The relative mRNA expression was calculated using the 2−ΔΔCt method in excel and is shown with the average (±SD) of three biological replicates. The primers used for qPCR are listed in Table 1.

2.4. Effects of Glutamate and Glutamine on GS Expression

2.4.1. In Vitro Study

The effects of glutamate and glutamine on GS gene expression in triploid crucian carp muscle cells were analyzed. The fish that reached average weight (20 ± 0.16 g, n = 3 were selected to be anesthetized with 20 mg/L MS-222 (Sigma–Aldrich, St. Louis, MO, USA). The muscle tissue was obtained from clean and pasteurized triploid crucian carp using conventional methods and then washed with PBS three times. The organs were incubated with 0.05% (w/v) collagenase (Sigma–Aldrich, St. Louis, MO, USA) in PBS for 15 min and were then washed with PBS three times. Cells were grown in a 24-well culture plate with 1 mL of DMEM containing 10% fetal bovine serum (Gibco BRL, Gaithersburg, MD, USA) at a density of 800 mg/each well. Before glutamate and glutamine treatment, the cells were incubated in a cell culture incubator at 28 °C with 5% CO2 for two days. In this study, the triploid crucian carp muscle cells could be transmitted to 3 generations. We prepared different concentrations of glutamate and glutamine (0, 0.10 mg/mL, 0.25 mg/mL, 0.50 mg/mL, 1.00 mg/mL, and 2.00 mg/mL) to examine their effects on GS expression in muscle cells. After a 12 h incubation period, the cells were harvested for GS mRNA transcript analysis, which was conducted using real-time PCR.

2.4.2. In Vivo Study

In order to study the effect of exogenous glutamate and glutamine on GS gene expression, we designed thirteen diets containing different levels of glutamate (0, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%) and glutamine (0, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%) (Table 2). The experiment was conducted at the Shaping Breeding Base in Changsha, Hunan Province. After 2 weeks in the domestication in a cage (5 m × 5 m × 2 m, water depth: 2.5 m), the fish (initial body weight: 300.63 ± 1.31 g) were kept in floating net cages (1.2 m × 1.2 m × 2.0 m, water depth: 2.5 m) (n = 15 fish in each cage). There were 3 parallel cages for each treatment, resulting in a total of 39 cages. All of the fish were adapted to the experimental diets over the course of 1 week. Additionally, timed feeding was performed at 9:00 and 15:00 every day. During the feeding trial, the water temperature was maintained at 24.5 ± 1.0 °C, the dissolved oxygen content was kept above 6.5 mg/L, and the ammonia nitrogen concentration was <0.5 mg/L. After 70 days of feeding, three individual fish from each fiberglass tank (n = 3 × 3) were randomly sacrificed, and the white muscle was collected. The GS mRNA expression levels were determined by qPCR.
To further investigate the effects of glutamate on GS expression, six diets with different concentrations of Lys-Glu dipeptides (0, 0.4%, 0.8%, 1.2%, 1.6% and 2.0%) were prepared (Table 3). The experiment was carried out in the indoor breeding base of Changsha University. After 2 weeks of domestication in an indoor recirculating aquaculture system comprising 4 fiberglass tanks (1500 L), the fish (initial body weight: 11.79 ± 0.09 g) were kept in 18 fiberglass tanks (1.2 m H × 0.8 m D) (n = 30 fish in each tank). Each group comprised 3 parallel fiberglass tanks that were randomly distributed. All of the fish were adapted to the experimental diets for 1 week. During the feeding trial, the water temperature was maintained at 24.5 ± 1.0 °C, the dissolved oxygen content was kept above 6.5 mg/L, and the ammonia nitrogen concentration was <0.5 mg/L. After 60 days of feeding, three individuals from each fiberglass tank (n = 3 × 3) were sacrificed, and the white muscle was collected. The GS mRNA expression levels were determined by qPCR.
All diets were prepared by thoroughly mixing the raw materials after drying, crushing and sieving with oil and water. The mixing method adopted a method in which the mass is gradually mixed from small to large, and the mixture was inserted into a pelleting machine to make feed pellets with a diameter of 2 mm. After drying, the feeds stored at −20 °C.

2.5. Dietary Protein Levels and Resources for the Regulation of GS Expression

To determine the effects of different dietary protein levels (26%, 29%, 32%, 35%, 38% and 41%) and different dietary protein sources (FM and SM) on GS expression, six isocaloric diets with different crude protein (CP) levels and two diets with different protein resources were formulated (Table 4). Each group had 3 parallel fiberglass tanks. All of the experimental conditions described here refer to those used for the Lys-Glu experiment. After 60 days of breeding, three individuals from each fiberglass tank (n = 3 × 3) were randomly sacrificed, and samples were collected. The GS mRNA expression levels were determined by conducting real-time PCR on the muscle samples.

2.6. Statistical Analyses of Data

The data are expressed as the means ± SD. All statistical analyses were performed with SPSS 18.0 software (Chicago, IL, USA). Significant differences among the groups were confirmed using one-way analysis of variance with Tukey’s multiple range tests or T-test. Different lowercase letters indicate significant differences (p < 0.05).

2.7. Ethics Statement

Animal experiments: All experimental procedures complied with the ARRIVE guidelines and were carried out in accordance with the UK Animals (Scientific Procedures) Act, 1986, and its associated guidelines.

3. Results

3.1. Cloning and Sequence Analysis of GS cDNA from Triploid Crucian Carp

GS cDNA was isolated from a triploid crucian carp cDNA library. The full length of the cDNA was 1408 bp, with a 1115 bp open reading frame encoding a protein with 371 amino acids. Using neighbor-joining with Mega 4.0 software, we created a phylogenetic tree (Figure 1). The clustering pattern provides evidence that the GS of C. idellus has high bootstrap support in the lineage of other teleost fish and shares high sequence homology with Cyprinus carpio. The GS sequences from mammals are grouped into two other distinct lineages.

3.2. The Temporal and Spatial GS Gene Expressions of Triploid Crucian Carp

In order to determine the expression pattern of the GS gene in triploid crucian carp, we detected the expression level of the GS gene using real-time quantitative PCR in different tissues, such as tissues from the heart, liver, intestine, kidney, spleen, muscle, gill, and brain. The results showed that the highest expression was in the brain, followed by the liver, intestine, and kidney (p < 0.05). It had relatively low expression in the muscle, heart, spleen, and gill (Figure 2A). In addition, we also analyzed the circadian rhythm-based expression of GS in the white muscle of triploid Crucian carp at 3:00, 6:00, 9:00, 12:00, 15:00, 18:00, 21:00, and 24:00. The results demonstrate that there was obvious oscillation in GS expression, with the highest expression levels being observed at 12:00 and 24:00 (p < 0.05), and the lowest expression levels being observed at 6:00, 9:00, and 18:00, showing periodic oscillation every 12 h (Figure 2B).

3.3. Effects of Glutamate, Glutamine and Lys-Glu Dipeptides on GS mRNA Expression of Triploid Crucian Carp

In this study, the effects of glutamate and glutamine on GS mRNA expression in triploid juvenile crucian carp were analyzed at the cellular and individual levels, respectively. At the cellular level, 2 mg/mL of glutamate significantly promoted the expression of GS mRNA (p < 0.05), but no significant differences were observed between the other glutamate treatment groups and the control group (Figure 3A). However, glutamine significantly inhibited the expression of GS (p < 0.05) (Figure 3B). At the individual level, the expression of GS mRNA in muscle was significantly up-regulated after 70 days of feeding with diets containing different percentages of glutamate (Figure 3C) or glutamine (Figure 3D), and it reached its peak expression with 2% concentrations of glutamate and glutamine (p < 0.05). In addition, the experiment testing the effects of Lys-Glu dipeptides on GS mRNA expression showed that at a concentration of 0.8%, Lys-Glu dipeptides promote the expression of GS mRNA to the maximum extent possible (p < 0.05) (Figure 3E).

3.4. Effects of Dietary Protein Levels and Dietary Protein Sources on GS mRNA Expression in Muscle of Triploid Crucian Carp

Moreover, the effects of dietary protein levels and dietary protein sources on GS expression were studied. In this study, we detected GS mRNA expression levels at different protein levels (26%, 29%, 32%, 35%, 38%, and 41%), and the results showed that there were differences in GS expression at different protein levels, with the highest expression level being found when the protein content was 35% (p < 0.05) (Figure 4A). In addition, we also explored the effects of the feed protein source on gene expression but found that the mixed plant feed protein source and fish meal group had no significant effects on GS expression (Figure 4B).

4. Discussion

Muscle is the main production site for the synthesis of glutamine, which is synthesized from glutamate and ammonia by glutamine synthase (GS) [9]. The net synthesis of glutamine in muscle can not only remove the damage caused by ammonia but also provide fuel for cell growth and a substrate for the formation of nucleic acid and for the generation of amino sugars. A number of studies have shown that glutamine is related to IMP, an important flavoring substance [24,25,26,27]. Therefore, studying the regulation of GS gene expression is of great significance to further study the growth and flavor of fish.
In this study, we cloned a GS cDNA sequence containing a 1115 bp ORF encoding a protein with 371 amino acids. Phylogenetic tree analysis showed that it had the highest similarity with that of Cyprinus carpio, indicating the evolutionary conservation of the GS gene in bony fish. The experimental results of the tissue expression analysis of the GS gene showed that it was widely distributed in various tissues and that the expression level was relatively high in the brain, intestine, and liver. The diversity of GS tissue expression may be related to the diversity of Gln function. In the brain, Gln is an important ammonia carrier and plays an important role in removing ammonia toxicity from the brain [28]. In the intestine, Gln plays an important role in maintaining and repairing the structural and functional integrity of the intestine and normal immune response [29]. In the liver, Gln promotes the production of glutathione and enhances the antioxidant capacity [30]. However, GS mRNA demonstrated its highest expression in the intestinal tract of grass carp, indicating the diversity of the GS gene expression map [12]. To further study the expression characteristics of the GS gene, we detected the circadian expression rhythm in muscle. The results showed that GS mRNA expression was significantly oscillated, and a similar conclusion was observed in the skeletal muscle of mice [31]. Additionally, the expression profile of the GS gene in the skeletal muscle of mice followed a pattern similar to that of endogenous corticosterone and shifted to the right for several hours. However, we found that the expression of the GS gene did not demonstrate an obvious correlation with diet. We fed the fish at 9:00 and 15:00, and GS gene expression was the highest at 12:00 and 24:00, respectively, indicating that the nutritional regulation of the GS gene in muscle requires further study.
Nowadays, aquaculture is developing rapidly around the world. With the density of aquaculture increasing year by year, the demand for efficient aquaculture and disease control is also becoming more significant. Glutamate and glutamine, although non-essential amino acids, have been widely used as functional amino acids in feed [32]. It has been shown that they can promote growth, enhance immunity, and improve meat quality in fish [33,34]. Following this work, we investigated their effects on GS mRNA expression levels in triploid Crucian carp muscle in vivo and in vitro, respectively. In the in vivo studies, a high glutamate concentration (2 mg/mL) was found to significantly promote GS gene expression, and glutamine was observed to decrease its expression. The same conclusion was reached in mouse muscle cells, which showed that GS gene expression may be affected by the substrate concentration [35]. However, in the in vivo experiments, we did not draw conclusions that were completely consistent with the in vivo experiments. There, we found that both glutamate and glutamine promoted GS gene expression, and when their concentrations increased, its expression first increased and then decreased, with maximum expression being achieved at 2%. Meng et al. showed that the addition of exogenous glutamate can increase glutamate levels in the plasma, which may be related to the increased expression of muscle GS at 0–2.0% [36]. However, the expression of the GS gene showed a downward trend as the glutamate concentration continued to increase, suggesting that there may be a more complex regulation mechanism controlling GS gene expression in vivo. When glutamine was used as a feed additive, an opposite trend was observed compared to the one observed in vivo, indicating that the inhibitory effect of glutamine substrates on GS gene expression were unable to be confirmed well in vivo. It has been shown that the gut is rich in glutaminase activity, which can break down ingested glutamine into glutamate and ammonia [37]. This may be an important reason explaining the increase in GS gene expression. In largemouth bass, glutamate and glutamine are oxidized at the same rate in the diet [31], corresponding well with the same concentration of glutamate and glutamine (2.0%) required to achieve the highest GS expression level observed in this experiment. However, when glutamine was supplemented by more than 2%, the GS expression in muscle began to decline. It is possible that glutamine utilization in the gut may reach a peak, resulting in the substrate inhibition of glutamine activity in muscle. Dipeptides are more stable and more easily absorbed than amino acid monomers [38]. In the study, we also added Lys-Glu dipeptides into dietary feed and found that they could promote GS expression, with the optimal concentration of Lys-Glu dipeptides being determined to be 0.8%. The concentration required to achieve the highest GS expression level was much lower than that of glutamine and glutamate and may represent a new cost-saving strategy.
Dietary protein is the key factor affecting the physiological indexes of fish. In this study, we also explored the effects of different protein levels and protein sources on GS gene expression. It was found that as the protein level increased, GS expression reached its peak at 35%, while no significant differences were observed between the fish meal group and soybean meal group. In grouper [39] and rainbow trout [40], it has been found that fish nitrogen excretion increases with the dietary protein level. This may be the reason for the difference in GS expression at different protein levels.

5. Conclusions

GS is a key enzyme that catalyzes glutamate and ammonia to glutamine. Glutamine synthesis plays an important role in the growth and immunity of fish, the maintenance and repair of the intestinal structure, and the flavor of meat. As the main site of glutamine synthesis, the regulation of GS expression in muscle is of great significance.
In this study, we cloned the GS gene of triploid Crucian Carp, analyzed its temporal and spatial expression, and explored the regulation of diet on its expression. We found that GS expression was spatiotemporally specific, with differences in expression levels being observed in different tissues and different time periods. In addition, exogenous glutamate, glutamine, and Lys-Glu also have regulatory effects on GS expression. In the in vitro studies, high concentrations of glutamate promoted the expression of GS in muscle cells, while glutamine inhibited its expression. In the in vitro studies, both glutamine and glutamate promoted GS expression in skeletal muscle, and the optimal concentration was determined to be 2%. Lys-Glu also has the effect of promoting GS expression, and its optimal concentration is 0.8%. Moreover, the regulation of GS expression by the protein level and protein source was also explored. We found that GS expression was different at different protein levels, but different protein sources had no significant effect on GS expression.
In summary, the distribution of GS expression was analyzed, and the effects of exogenous glutamate, glutamine, Lys-Glu, and protein levels and protein sources on the regulation of GS expression were explored. This study provides new insights for the regulation of GS mRNA expression in teleost fish, which may shed light on promoting fish growth, improving meat flavor, and saving feeding costs.

Author Contributions

Conceptualization, X.Z.; methodology, X.Z. and D.Z.; software and empirical analysis, Y.X.; validation, J.L. and Z.H.; formal analysis, X.Z. and Y.L.; investigation, D.Z.; resources, Z.L.; data curation, Y.C., Y.L. and Y.X.; writing—original draft preparation, X.Z.; writing—review and editing, J.L., F.Q. and Z.H.; supervision, Z.H. and J.L.; project administration, Z.L. and J.J.; funding acquisition, J.L., Z.L., Z.H., Z.M. and S.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (Grant No. 31902345, U19A2041, 31772865, 32102813, and 31702378), the State Key Laboratory of Developmental Biology of Freshwater Fish (Grant No. 2021KF010), the Hunan Provincial Natural Science Foundation of China (Grant No. 2019JJ50687 and 2021JJ40627), and the Scientific Research of Hunan Provincial Education Department, China (Grant No. 20B058 and 19K010).

Institutional Review Board Statement

The animal study protocol complied with the ARRIVE guidelines and was carried out in accordance with UK Animals (Scientific Procedures) Act, 1986, and the associated guidelines.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Yoo, H.C.; Yu, Y.C.; Sung, Y.; Han, J.M. Glutamine reliance in cell metabolism. Exp. Mol. Med. 2020, 52, 1496–1516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Kumada, Y.; Benson, D.R.; Hillemann, D.; Hosted, T.J.; Rochefort, D.A.; Thompson, C.J.; Wohlleben, W.; Tateno, Y. Evolution of the glutamine synthetase gene, one of the oldest existing and functioning genes. Proc. Natl. Acad. Sci. USA 1993, 90, 3009–3013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. He, Q.; Shi, X.; Zhang, L.; Yi, C.; Zhang, X.; Zhang, X. De Novo Glutamine Synthesis: Importance for the Proliferation of Glioma Cells and Potentials for Its Detection With 13N-Ammonia. Mol. Imaging 2016, 15, 1536012116645440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Bartl, M.; Pfaff, M.; Ghallab, A.; Driesch, D.; Henkel, S.G.; Hengstler, J.G.; Schuster, S.; Kaleta, C.; Gebhardt, R.; Zellmer, S.; et al. Optimality in the zonation of ammonia detoxification in rodent liver. Arch. Toxicol. 2015, 89, 2069–2078. [Google Scholar] [CrossRef] [Scilit]
  5. Eelen, G.; Dubois, C.; Cantelmo, A.R.; Goveia, J.; Brüning, U.; DeRan, M.; Jarugumilli, G.; van Rijssel, J.; Saladino, G.; Comitani, F.; et al. Role of glutamine synthetase in angiogenesis beyond glutamine synthesis. Nature 2018, 561, 63–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Eid, T.; Lee, T.W.; Patrylo, P.; Zaveri, H.P. Astrocytes and Glutamine Synthetase in Epileptogenesis. J. Neurosci. Res. 2019, 97, 1345–1362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Roth, E. Nonnutritive Effects of Glutamine1–3. J. Nutr. 2008, 138, 2025S–2031S. [Google Scholar] [CrossRef] [Scilit]
  8. Min-Hyun, K.; Hyeyoung, K. The Roles of Glutamine in the Intestine and Its Implication in Intestinal Diseases. Int. J. Mol. Sci. 2017, 18, 1051. [Google Scholar] [CrossRef] [Scilit]
  9. Anderson, P.M.; Broderius, M.A.; Fong, K.C.; Tsui, K.N.; Chew, S.F.; Ip, Y.K. Glutamine synthetase expression in liver, muscle, stomach and intestine of Bostrichthys sinensis in response to exposure to a high exogenous ammonia concentration. J. Exp. Biol. 2002, 205, 2053–2065. [Google Scholar] [CrossRef] [Scilit]
  10. Wicks, B.J.; Randall, D.J. The effect of sub-lethal ammonia exposure on fed and unfed rainbow trout: The role of glutamine in regulation of ammonia. Comp. Biochem. Physiol A Mol. Integr. Physiol. 2002, 132, 275–285. [Google Scholar] [CrossRef] [Scilit]
  11. Bucking, C.; Wood, C.M. Digestion of a single meal affects gene expression of ion and ammonia transporters and glutamine synthetase activity in the gastrointestinal tract of freshwater rainbow trout. J. Comp. Physiol B 2012, 182, 341–350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Hu, R.; Qu, F.; Tang, J.; Zhao, Q.; Yan, J.; Zhou, Z.; Zhou, Y.; Liu, Z. Cloning, expression, and nutritional regulation of the glutamine synthetase gene in Ctenopharyngodon idellus. Comp. Biochem. Physiol B Biochem. Mol. Biol. 2017, 212, 70–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. He, Y.; Hakvoort, T.B.M.; Köhler, S.E.; Vermeulen, J.L.M.; de Waart, D.R.; de Theije, C.; Ten Have, G.A.M.; van Eijk, H.M.H.; Kunne, C.; Labruyere, W.T.; et al. Glutamine synthetase in muscle is required for glutamine production during fasting and extrahepatic ammonia detoxification. J. Biol. Chem. 2010, 285, 9516–9524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Wang, X.; Wang, L.; Yao, C.; Qiu, L.; Zhang, H.; Zhi, Z.; Song, L. Alternation of immune parameters and cellular energy allocation of Chlamys farreri under ammonia-N exposure and Vibrio anguillarum challenge. Fish Shellfish Immun. 2012, 32, 741–749. [Google Scholar] [CrossRef] [Scilit]
  15. Jia, S.; Li, X.; Zheng, S.; Wu, G. Amino acids are major energy substrates for tissues of hybrid striped bass and zebrafish. Amino Acids 2017, 49, 2053–2063. [Google Scholar] [CrossRef] [Scilit]
  16. Li, P.; Wu, G. Composition of amino acids and related nitrogenous nutrients in feedstuffs for animal diets. Amino Acids 2020, 52, 523–542. [Google Scholar] [CrossRef] [Scilit]
  17. Xu, H.; Zhu, Q.; Wang, C.A.; Zhao, Z.G.; Luo, L.; Wang, L.S.; Li, J.N.; Xu, Q.Y. Effect of Dietary Alanyl-glutamine Supplementation on Growth Performance, Development of Intestinal Tract, Antioxidant Status and Plasma Non-specific Immunity of Young Mirror Carp (Cyprinus carpio L.). J. Northeast Agric. Univ. 2014, 21, 37–46. [Google Scholar] [CrossRef] [Scilit]
  18. Zhelyazkov, G.; Stratev, D. Effect of monosodium glutamate on growth performance and blood biochemical parameters of rainbow trout (Oncorhynchus mykiss W.). Vet. World 2019, 12, 1008–1012. [Google Scholar] [CrossRef] [Scilit]
  19. Yan, L.; Xiao, Q.Z. Dietary glutamine supplementation improves structure and function of intestine of juvenile Jian carp (Cyprinus carpio var. Jian)-ScienceDirect. Aquaculture 2006, 256, 389–394. [Google Scholar] [CrossRef] [Scilit]
  20. Yoshida, C.; Maekawa, M.; Bannai, M.; Yamamoto, T. Glutamate promotes nucleotide synthesis in the gut and improves availability of soybean meal feed in rainbow trout. Springerplus 2016, 5, 1021. [Google Scholar] [CrossRef] [Scilit]
  21. Cheng, Z.; Gatlin III, D.M.; Buentello, A. Dietary supplementation of arginine and/or glutamine influences growth performance, immune responses and intestinal morphology of hybrid striped bass (Morone chrysops × Morone saxatilis). Aquaculture 2012, 362–363, 39–43. [Google Scholar] [CrossRef] [Scilit]
  22. Larsson, T.; Koppang, E.O.; Espe, M.; Terjesen, B.F.; Krasnov, A.; Moreno, H.M.; Rørvik, K.; Thomassen, M.; Mørkøre, T. Fillet quality and health of Atlantic salmon (Salmo salar L.) fed a diet supplemented with glutamate. Aquaculture 2014, 426, 288–295. [Google Scholar] [CrossRef] [Scilit]
  23. Jiang, J.; Wu, X.Y.; Zhou, X.Q.; Feng, L.; Liu, Y.; Jiang, W.D.; Wu, P.; Zhao, Y. Glutamate ameliorates copper-induced oxidative injury by regulating antioxidant defences in fish intestine. Br. J. Nutr. 2016, 116, 70–79. [Google Scholar] [CrossRef] [Scilit]
  24. Dai, S.F.; Wang, L.K.; Wen, A.Y.; Wang, L.X.; Jin, G.M. Dietary glutamine supplementation improves growth performance, meat quality and colour stability of broilers under heat stress. Bri. Poult. Sci. 2009, 50, 333–340. [Google Scholar] [CrossRef] [Scilit]
  25. Fuke, S.; Konosu, S. Taste-active components in some foods: A review of Japanese research. Physiol. Behav. 1991, 49, 863–868. [Google Scholar] [CrossRef] [Scilit]
  26. Hamada-Sato, N.; Usui, K.; Kobayashi, T.; Imada, C.; Watanabe, E. Quality assurance of raw fish based on HACCP concept. Food Control 2005, 16, 301–307. [Google Scholar] [CrossRef] [Scilit]
  27. Holecek, M.; Sispera, L.; Skalska, H. Enhanced Glutamine Availability Exerts Different Effects on Protein and Amino Acid Metabolism in Skeletal Muscle from Healthy and Septic Rats. Jpen-Parenter. Enter. 2014, 39, 847. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Sanderson, L.A.; Wright, P.A.; Robinson, J.W.; Ballantyne, J.S.; Bernier, N.J. Inhibition of glutamine synthetase during ammonia exposure in rainbow trout indicates a high reserve capacity to prevent brain ammonia toxicity. J. Exp. Biol. 2010, 213, 2343–2353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Ramos, A.R.P.; Campelo, D.A.V.; da Silva Carneiro, C.L.; Zuanon, J.A.S.; da Matta, S.L.P.; Furuya, W.M.; Salaro, A.L. Optimal dietary L-glutamine level improves growth performance and intestinal histomorphometry of juvenile giant trahira (Hoplias lacerdae), a Neotropical carnivorous fish species. Aquaculture 2022, 547, 737469. [Google Scholar] [CrossRef] [Scilit]
  30. Li, X.; Wu, G. Oxidation of energy substrates in tissues of Largemouth bass (Micropterus salmoides). J. Anim. Sci. 2019, 97, 68–69. [Google Scholar] [CrossRef] [Scilit]
  31. Yao, Z.; Dubois, D.C.; Almon, R.R.; Jusko, W.J. Modeling Circadian Rhythms of Glucocorticoid Receptor and Glutamine Synthetase Expression in Rat Skeletal Muscle. Pharm. Res. 2006, 23, 670–679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Li, X.; Zheng, S.; Wu, G. Nutrition and metabolism of glutamate and glutamine in fish. Amino Acids 2020, 52, 671–691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Yang, Q.H.; Zhou, Q.C.; Tan, B.P.; Chi, S.Y.; Dong, X.H.; Chang-Qian, D.U.; Wang, X.F. Effects of dietary glutamine on growth performance, feed utilization and anti-disease ability of hybrid tilapia (Oreochromis niloticus ♀ × O. aureus ♂). J. Fish. Sci. China 2008, 15, 1016–1023. [Google Scholar]
  34. Cruzat, V.F.; Pantale, O.L.C.; Donato, J.; Bittencourt, P.D.; Tirapegui, J. Oral supplementations with free and dipeptide forms of l-glutamine in endotoxemic mice: Effects on muscle glutamine-glutathione axis and heat shock proteins. J. Nutr. Biochem. 2014, 25, 345–352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Bo, F.; Shiber, S.K.; Max, S.R. Glutamine regulates glutamine synthetase expression in skeletal muscle cells in culture. J. Cell. Physiol. 1990, 145, 376–380. [Google Scholar] [CrossRef] [Scilit]
  36. Meng, L.; Zhang, B.; Yu, C.; Li, J.; Lin, Z.; Sun, H.; Feng, G.; Zhou, G. L-Glutamate Supplementation Improves Small Intestinal Architecture and Enhances the Expressions of Jejunal Mucosa Amino Acid Receptors and Transporters in Weaning Piglets. PLoS ONE 2014, 9, e111950. [Google Scholar] [CrossRef] [Scilit]
  37. Mccauley, R.; Kong, S.E.; Heel, K.; Hall, J.C. The role of glutaminase in the small intestine. Int. J. Biochem. Cell B 1999, 31, 405–413. [Google Scholar] [CrossRef] [Scilit]
  38. Hashimoto, S.I. Occurrence, Biosynthesis, and Biotechnological Production of Dipeptides. In Amino Acid Biosynthesis, Pathways, Regulation and Metabolic Engineering; Wendisch, V.F., Ed.; Springer: Berlin/Heidelberg, Germany, 2007; Volume 5, pp. 327–348. [Google Scholar] [CrossRef] [Scilit]
  39. Leung, K.; Chu, J.; Wu, R. Effects of body weight, water temperature and ration size on ammonia excretion by the areolated grouper (Epinephelus areolatus) and mangrove snapper (Lutjanus argentimaculatus). Aquaculture 1999, 170, 215–227. [Google Scholar] [CrossRef] [Scilit]
  40. Grove, K. Effects of feeding frequency on growth and food utilisation of rainbow trout (Oncorhynchus mykiss) fed low-fat herring or dry pellets. Aquaculture 1998, 165, 111–121. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Phylogenetic analysis of GS gene. The tree is built on an alignment corresponding to full-length amino acid sequences using MEGA (4.0) and the Clustal W method. Branch numbers denote the bootstrap majority consensus values for 1000 replicates. The accession numbers are as follows: Triploid Carassius carassius, QXO15199.1; Cyprinus carpio, KTG44256.1; Anabarilius graham, ROJ13898.1; Puntigrus tetrazona, XP_043074757.1; Ctenopharyngodon idella, ALP73374.1; Onychostoma macrolepis, KAF4117067.1; Labeo rohita, RXN27864.1; Pimephales promelas, XP_039533199.1; Danionella translucida, TRZ00796.1; Hemibagrus wyckioides, KAG7320023.1; Chanos chanos, XP_030629061.1; Danio rerio, NP_853537.1; Triplophysa tibetana, KAA0719043.1; Tachysurus fulvidraco, XP_027016383.1.XP_043074757.1; Ctenopharyngodon idella, ALP73374.1; Onychostoma macrolepis, KAF4117067.1; Labeo rohita, RXN27864.1; Pimephales promelas, XP_039533199.1; Danionella translucida, TRZ00796.1; Hemibagrus wyckioides, KAG7320023.1; Chanos chanos, XP_030629061.1; Danio rerio, NP_853537.1; Triplophysa tibetana, KAA0719043.1; Tachysurus fulvidraco, XP_027016383.1.
Figure 1. Phylogenetic analysis of GS gene. The tree is built on an alignment corresponding to full-length amino acid sequences using MEGA (4.0) and the Clustal W method. Branch numbers denote the bootstrap majority consensus values for 1000 replicates. The accession numbers are as follows: Triploid Carassius carassius, QXO15199.1; Cyprinus carpio, KTG44256.1; Anabarilius graham, ROJ13898.1; Puntigrus tetrazona, XP_043074757.1; Ctenopharyngodon idella, ALP73374.1; Onychostoma macrolepis, KAF4117067.1; Labeo rohita, RXN27864.1; Pimephales promelas, XP_039533199.1; Danionella translucida, TRZ00796.1; Hemibagrus wyckioides, KAG7320023.1; Chanos chanos, XP_030629061.1; Danio rerio, NP_853537.1; Triplophysa tibetana, KAA0719043.1; Tachysurus fulvidraco, XP_027016383.1.XP_043074757.1; Ctenopharyngodon idella, ALP73374.1; Onychostoma macrolepis, KAF4117067.1; Labeo rohita, RXN27864.1; Pimephales promelas, XP_039533199.1; Danionella translucida, TRZ00796.1; Hemibagrus wyckioides, KAG7320023.1; Chanos chanos, XP_030629061.1; Danio rerio, NP_853537.1; Triplophysa tibetana, KAA0719043.1; Tachysurus fulvidraco, XP_027016383.1.
Fishes 07 00196 g001
Figure 2. Analysis of tissue expression and rhythm expression of GS. (A) Tissue expression profile of GS; (B) the rhythm expression analysis of GS. β-actin was used as an internal reference. Tukey’s multiple range test was performed and different letters represent significant differences (p < 0.05, n = 3).
Figure 2. Analysis of tissue expression and rhythm expression of GS. (A) Tissue expression profile of GS; (B) the rhythm expression analysis of GS. β-actin was used as an internal reference. Tukey’s multiple range test was performed and different letters represent significant differences (p < 0.05, n = 3).
Fishes 07 00196 g002
Figure 3. Effects of glutamate, glutamine, and Lys-Glu on GS mRNA expression in vitro and in vivo. (A,B) Effects of glutamate (A) and glutamine (B) on GS mRNA expression in vitro; (CE) effects of glutamate (C), glutamine (D), and Lys-Glu (E) on GS mRNA expression in vivo. Error bars indicate the mean ± SD. Tukey’s multiple range test was performed and different letters represent significant differences (p < 0.05, n = 3 for each group).
Figure 3. Effects of glutamate, glutamine, and Lys-Glu on GS mRNA expression in vitro and in vivo. (A,B) Effects of glutamate (A) and glutamine (B) on GS mRNA expression in vitro; (CE) effects of glutamate (C), glutamine (D), and Lys-Glu (E) on GS mRNA expression in vivo. Error bars indicate the mean ± SD. Tukey’s multiple range test was performed and different letters represent significant differences (p < 0.05, n = 3 for each group).
Fishes 07 00196 g003
Figure 4. Dietary protein levels (A) and dietary protein sources (B) on GS mRNA abundance in the grass carp intestine. Error bars indicate the mean ± SD. Tukey’s multiple range test (A) and t-test (B) were performed, respectively. Different letters represent significant differences (p < 0.05, n = 3 for each group).
Figure 4. Dietary protein levels (A) and dietary protein sources (B) on GS mRNA abundance in the grass carp intestine. Error bars indicate the mean ± SD. Tukey’s multiple range test (A) and t-test (B) were performed, respectively. Different letters represent significant differences (p < 0.05, n = 3 for each group).
Fishes 07 00196 g004
Table 1. Primers used in this work.
Table 1. Primers used in this work.
Primer NamePrimer SequenceUsage
GS F:5′ GAATGAGAGAATACCGAACACA 3′CDS
GS R:5′ GAGGGAAGTTCAGTCCAGAAG 3′CDS
GS qPCR F:5′ GAGTAAAGTGGTAAAACGGCA 3′Real-time PCR
GS qPCR R:5′ TCAATGCTTTTAGGCTCCGA 3′Real-time PCR
β-actin qPCR F:5′ GAAACTGGAAAGGGAGGTAGC 3′Real-time PCR
β-actin qPCR R:5′ CTGTGAGGGCAGAGTGGTAGA 3′Real-time PCR
Table 2. Diet formulation and chemical composition of the glutamate diets or glutamine diets (% dry matter).
Table 2. Diet formulation and chemical composition of the glutamate diets or glutamine diets (% dry matter).
IngredientsSupplementation of Glutamate or Glutamine
Control0.5%1.0%1.5%2.0%2.5%3.0%
Glutamate or Glutamine0.000.501.001.502.002.503.00
Fishmeal2.002.002.002.002.002.002.00
Soybean meal34.0034.0034.0034.0034.0034.0034.00
Rapeseed meal23.6023.6023.6023.6023.6023.6023.60
Wheat flour 16.0016.0016.0016.0016.0016.0016.00
Fish oil2.002.002.002.002.002.002.00
Soybean oil2.502.502.502.502.502.502.50
Cornstarch6.006.006.006.006.006.006.00
Choline0.110.110.110.110.110.110.11
Premix 11.501.501.501.501.501.501.50
Methionine0.500.500.500.500.500.500.50
Carboxymethyl cellulose3.003.003.003.003.003.003.00
Cellulose8.798.297.797.296.796.295.79
Total100.00100.00100.00100.00100.00100.00100.00
Proximate composition of the glutamate group diets
Crude protein31.0231.5232.0232.5233.0233.5234.02
Crude lipid6.036.036.036.036.036.036.03
Moisture6.635.756.536.846.586.216.32
Ash5.665.795.635.705.305.555.62
Proximate composition of the glutamine group diets
Crude protein31.0231.5232.0232.5233.0233.5234.02
Crude lipid6.036.036.036.036.036.036.03
Moisture6.636.176.896.026.466.906.90
Ash5.665.605.605.715.695.625.65
1 Vitamin and mineral premix provided by DSM, S.A. de C.V.
Table 3. Diet formulation and chemical composition of the Lys-Glu dipeptide diet (% dry matter).
Table 3. Diet formulation and chemical composition of the Lys-Glu dipeptide diet (% dry matter).
IngredientsControlLys-Glu
0.4%
Lys-Glu
0.8%
Lys-Glu
1.2%
Lys-Glu
1.6%
Lys-Glu
2.0%
Fishmeal12.0012.0012.0012.0012.0012.00
Soybean meal20.0020.0020.0020.0020.0020.00
Rapeseed meal15.0015.0015.0015.0015.0015.00
Casein6.506.506.506.506.506.50
Fish oil3.003.003.003.003.003.00
Soybean oil3.003.003.003.003.003.00
Cornstarch16.8016.8016.8016.8016.8016.80
Wheat flour10.0010.0010.0010.0010.0010.00
Choline0.500.500.500.500.500.50
Premix 3.003.003.003.003.003.00
Carboxymethyl cellulose3.003.003.003.003.003.00
Cellulose7.206.806.406.005.605.20
Lysine-glutamate dipeptide0.000.400.801.201.602.00
Total100.00100.00100.00100.00100.00100.00
Proximate composition
Crude protein32.0132.4132.8133.2133.6134.01
Crude lipid8.078.078.078.078.078.07
Moisture10.0512.319.809.7011.180.93
Ash6.786.486.976.546.777.15
Table 4. Experimental diet compositions with different protein levels and dietary resources.
Table 4. Experimental diet compositions with different protein levels and dietary resources.
Group26%
CP
29%
CP
32%
CP
35%
CP
38%
CP
41%
CP
FMSM
Fish meal12.0012.0012.0012.0012.0012.0044.400.00
Soybean meal20.0020.0020.0020.0020.0020.000.0037.10
Rapeseed meal15.0015.0015.0015.0015.0015.000.0015.00
casein0.003.206.509.8013.1016.400.006.50
fish oil3.003.003.003.003.003.001.633.50
soya-bean oil3.003.003.003.003.003.001.633.50
corn starch25.0021.0016.8012.608.404.2031.0010.00
wheat flour10.0010.0010.0010.0010.0010.0010.0010.00
choline0.500.500.500.500.500.500.500.50
Premix3.003.003.003.003.003.003.003.00
Carboxymethyl cellulose3.003.003.003.003.003.003.003.00
cellulose5.506.307.208.109.009.004.807.90
Total100.00100.00100.00100.00100.0099.1099.96100.00
Proximate composition
Crude protein26.0829.0032.0135.0338.0441.0532.0532.03
Crude lipid8.078.078.078.078.078.078.058.06
Moisture9.126.0110.058.195.757.269.739.86
Ash6.156.126.786.136.346.759.115.65
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhou, X.; Zhao, D.; Chen, Y.; Xiao, Y.; Mao, Z.; Cao, S.; Qu, F.; Li, Y.; Jin, J.; Liu, Z.; et al. Molecular Characterization and Nutrition Regulation of the Glutamine Synthetase Gene in Triploid Crucian Carp. Fishes 2022, 7, 196. https://doi.org/10.3390/fishes7040196

AMA Style

Zhou X, Zhao D, Chen Y, Xiao Y, Mao Z, Cao S, Qu F, Li Y, Jin J, Liu Z, et al. Molecular Characterization and Nutrition Regulation of the Glutamine Synthetase Gene in Triploid Crucian Carp. Fishes. 2022; 7(4):196. https://doi.org/10.3390/fishes7040196

Chicago/Turabian Style

Zhou, Xiaomei, Dafang Zhao, Yuan Chen, Yangbo Xiao, Zhuangwen Mao, Shenping Cao, Fufa Qu, Yutong Li, Junyan Jin, Zhen Liu, and et al. 2022. "Molecular Characterization and Nutrition Regulation of the Glutamine Synthetase Gene in Triploid Crucian Carp" Fishes 7, no. 4: 196. https://doi.org/10.3390/fishes7040196

APA Style

Zhou, X., Zhao, D., Chen, Y., Xiao, Y., Mao, Z., Cao, S., Qu, F., Li, Y., Jin, J., Liu, Z., Li, J., & He, Z. (2022). Molecular Characterization and Nutrition Regulation of the Glutamine Synthetase Gene in Triploid Crucian Carp. Fishes, 7(4), 196. https://doi.org/10.3390/fishes7040196

Article Metrics

Back to TopTop