Pseudostellaria heterophylla Extract Enhances the Immune Responses in Larimichthys crocea Against Pseudomonas plecoglossicida Infection
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of P. heterophylla Extract
2.2. Bacterium, Fish and Sample Collection
2.3. RNA Extraction and Transcriptome Sequencing
2.4. Sequencing Data Analysis and Transcript Assembly
2.5. Identification of Differentially Expressed Genes
2.6. Functional Annotation and Signaling Pathway Analysis of DEGs
2.7. Gene Set Enrichment Analysis
2.8. Protein–Protein Interaction Network Analysis
2.9. Quantitative Real-Time PCR (qPCR) Validation
3. Results
3.1. Effects of P. heterophylla on Survival of P. plecoglossicida-Infected L. crocea
3.2. RNA-Seq Data Quality and Alignment
3.3. Differential Gene Expression Analysis
3.4. GO Functional Enrichment Analysis
3.5. KEGG Pathway Enrichment Analysis
3.6. Protein–Protein Interaction Network Analysis
3.7. Validation of DEGs by Quantitative Real-Time PCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, H.; Wang, J.; Jing, Y. Larimichthys crocea (large yellow croaker): A bibliometric study. Heliyon 2024, 10, e37393. [Google Scholar] [CrossRef]
- Wang, L.-Y.; Liu, Z.-X.; Zhao, L.-M.; Huang, L.-X.; Qin, Y.-X.; Su, Y.-Q.; Zheng, W.-Q.; Wang, F.; Yan, Q.-P. Dual RNA-seq provides novel insight into the roles of dksA from Pseudomonas plecoglossicida in pathogen-host interactions with large yellow croakers (Larimichthys crocea). Zool. Res. 2020, 41, 410–422. [Google Scholar] [CrossRef]
- Huang, L.; Zhao, L.; Su, Y.; Yan, Q. Genome Sequence of Pseudomonas plecoglossicida Strain NZBD9. Genome Announc. 2018, 6, 10-1128. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Zuo, Y.; Jiang, Q.; Su, Y.; Qin, Y.; Xu, X.; Zhao, L.; Yan, Q. A metabolomic investigation into the temperature-dependent virulence of Pseudomonas plecoglossicida from large yellow croaker (Pseudosciaena crocea). J. Fish Dis. 2019, 42, 431–446. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Li, W.; Chen, X.; Luo, T.; Mu, Y.; Chen, X. Molecular and functional identification of a β-defensin homolog in large yellow croaker (Larimichthys crocea). J. Fish Dis. 2021, 44, 391–400. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.T.; Zhou, S.M.; An, S.W.; Chen, L.; Wang, G.L. Visceral granulomas in farmed large yellow croaker, Larimichthys crocea (Richardson), caused by a bacterial pathogen, Pseudomonas plecoglossicida. J. Fish Dis. 2014, 37, 113–121. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Luo, G.; Zhao, L.; Huang, L.; Qin, Y.; Su, Y.; Yan, Q. Integration of RNAi and RNA-seq uncovers the immune responses of Epinephelus coioides to L321_RS19110 gene of Pseudomonas plecoglossicida. Fish Shellfish Immunol. 2018, 81, 121–129. [Google Scholar] [CrossRef] [PubMed]
- Xiang, J.; Chen, R.; Xu, D.; Sun, Y.; Liu, H. Characterization of pathological changes and immune-related gene expression in yellow drum (Nibea albiflora) in response to Pseudomonas plecoglossicida and poly I:C challenge. Aquac. Rep. 2020, 17, 100350. [Google Scholar] [CrossRef]
- Sun, Y.; Luo, G.; Zhao, L.; Huang, L.; Qin, Y.; Su, Y.; Yan, Q. Integration of RNAi and RNA-seq Reveals the Immune Responses of Epinephelus coioides to sigX Gene of Pseudomonas plecoglossicida. Front. Immunol. 2018, 9, 1624. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Liao, S.-G.; He, Y.; Li, J.; Zhong, R.-F.; He, X.; Liu, Y.; Xiao, T.-T.; Lan, Y.-Y.; Long, Q.-D.; et al. Protective effects of fractions from Pseudostellaria heterophylla against cobalt chloride-induced hypoxic injury in H9c2 cell. J. Ethnopharmacol. 2013, 147, 540–545. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Wang, D.-Q.; Yao, Y.; Jin, X.-F. Observation on biological characteristics of wild Pseudostellaria heterophylla. J. Chin. Med. Mater. 2011, 34, 1323–1328. [Google Scholar] [PubMed]
- Wang, J.; Li, J.; Li, H.; Wu, X.; Gao, W. HPLC–ESI–MSn Analysis, Fed-Batch Cultivation Enhances Bioactive Compound Biosynthesis and Immune-Regulative Effect of Adventitious Roots in Pseudostellaria heterophylla. Appl. Biochem. Biotechnol. 2015, 177, 63–75. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Cai, X.; Huang, M.; Jia, L.; Wang, S. Immunomodulatory effects of Pseudostellaria heterophylla peptide on spleen lymphocytes via a Ca2+/CaN/NFATc1/IFN-γ pathway. Food Funct. 2019, 10, 3466–3476. [Google Scholar] [CrossRef] [PubMed]
- Fang, Z.-H.; Duan, X.-C.; Zhao, J.-D.; Wu, Y.-J.; Liu, M.-M. Novel Polysaccharide H-1-2 from Pseudostellaria Heterophylla Alleviates Type 2 Diabetes Mellitus. Cell. Physiol. Biochem. 2018, 49, 1037–1047. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.; Shi, K.; Qi, K.; Kong, H.; He, Q.; Zhou, M. Pseudostellaria heterophylla Extract Polysaccharide H-1-2 Suppresses Pancreatic Cancer by Inhibiting Hypoxia-Induced AG2. Mol. Ther. Oncolytics 2020, 17, 61–69. [Google Scholar] [CrossRef] [PubMed]
- Chuanlong, Z.; Xiaoxia, Z. Effects of polysaccharides from Pseudostellaria heterophylla on exercise endurance capacity and oxidative stress in forced swimming rats. Sci. Res. Essays 2011, 6, 2360–2365. [Google Scholar]
- Chen, Z.; Li, S.; Wang, X.; Zhang, C.L. Protective effects of Radix Pseudostellariae polysaccharides against exercise-induced oxidative stress in male rats. Exp. Ther. Med. 2013, 5, 1089–1092. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Liu, Z.; Liu, Q.; Zhang, X.; Li, S.; Tang, F.; Zhang, L.; Yang, Q.; Wang, Q.; Yang, S.; et al. Extraction of Polysaccharides from Root of Pseudostellaria heterophylla (Miq.) Pax. and the Effects of Ultrasound Treatment on Its Properties and Antioxidant and Immune Activities. Molecules 2023, 29, 142. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. EdgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Goto, S. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef] [PubMed]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [PubMed]
- Szklarczyk, D.; Franceschini, A.; Wyder, S.; Forslund, K.; Heller, D.; Huerta-Cepas, J.; Simonovic, M.; Roth, A.; Santos, A.; Tsafou, K.P.; et al. STRING v10: Protein–protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 2015, 43, D447–D452. [Google Scholar] [CrossRef] [PubMed]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of Biomolecular Interaction Networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Morelli, A.B.; Becher, D.; Koernig, S.; Silva, A.; Drane, D.; Maraskovsky, E. ISCOMATRIX: A novel adjuvant for use in prophylactic and therapeutic vaccines against infectious diseases. J. Med. Microbiol. 2012, 61, 935–943. [Google Scholar] [CrossRef] [PubMed]
- Sahoo, B.R. Structure of fish Toll-like receptors (TLR) and NOD-like receptors (NLR). Int. J. Biol. Macromol. 2020, 161, 1602–1617. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Lin, J.; Zhao, Y.; Ma, X.; Yi, H. Toll-like receptor 3 (TLR3) regulation mechanisms and roles in antiviral innate immune responses. J. Zhejiang Univ. B 2021, 22, 609–632. [Google Scholar] [CrossRef] [PubMed]
- Vallejos-Vidal, E.; Reyes-López, F.; Teles, M.; MacKenzie, S. The response of fish to immunostimulant diets. Fish Shellfish Immunol. 2016, 56, 34–69. [Google Scholar] [CrossRef] [PubMed]
- Ghochikyan, A.; Pichugin, A.; Bagaev, A.; Davtyan, A.; Hovakimyan, A.; Tukhvatulin, A.; Davtyan, H.; Shcheblyakov, D.; Logunov, D.; Chulkina, M.; et al. Targeting TLR-4 with a novel pharmaceutical grade plant derived agonist, Immunomax®, as a therapeutic strategy for metastatic breast cancer. J. Transl. Med. 2014, 12, 322. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.-J.; Lin, H.-J.; Chen, T.-H.; Hsu, Y.-A.; Liu, C.-S.; Hwang, G.-Y.; Wan, L. Polygonum cuspidatum and Its Active Components Inhibit Replication of the Influenza Virus through Toll-Like Receptor 9-Induced Interferon Beta Expression. PLoS ONE 2015, 10, e0117602. [Google Scholar] [CrossRef] [PubMed]
- Xue, T.; Liu, Y.; Cao, M.; Zhang, X.; Fu, Q.; Yang, N.; Li, C. Genome-wide identification of interleukin-17 (IL-17)/interleukin-17 receptor (IL- 17R) in turbot (Scophthalmus maximus) and expression pattern analysis after Vibrio anguillarum infection. Dev. Comp. Immunol. 2021, 121, 104070. [Google Scholar] [CrossRef] [PubMed]
- Mu, P.; Huo, J.; Li, X.; Li, W.; Li, X.; Ao, J.; Chen, X. IL-2 Signaling Couples the MAPK and mTORC1 Axes to Promote T Cell Proliferation and Differentiation in Teleosts. J. Immunol. 2022, 208, 1616–1631. [Google Scholar] [CrossRef] [PubMed]
- Cua, D.J.; Tato, C.M. Innate IL-17-producing cells: The sentinels of the immune system. Nat. Rev. Immunol. 2010, 10, 479–489. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Li, N.; Zhang, T.; Che, Y.; Duan, K.; Wang, Y.; Zhou, H.; Wan, X.; Lei, H.; Nguyễn, A.D.; et al. Glycyrrhiza polysaccharides can improve and prolong the response of chickens to the Newcastle disease vaccine. Poult. Sci. 2022, 101, 101549. [Google Scholar] [CrossRef] [PubMed]
- Elabd, H.; Wang, H.-P.; Shaheen, A.; Yao, H.; Abbass, A. Feeding Glycyrrhiza glabra (liquorice) and Astragalus membranaceus (AM) alters innate immune and physiological responses in yellow perch (Perca flavescens). Fish Shellfish Immunol. 2016, 54, 374–384. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhou, H.; Wei, K.; Zhang, T.; Che, Y.; Nguyễn, A.D.; Pandita, S.; Wan, X.; Cui, X.; Zhou, B.; et al. Structure of a new glycyrrhiza polysaccharide and its immunomodulatory activity. Front. Immunol. 2022, 13, 1007186. [Google Scholar] [CrossRef] [PubMed]











| Gene | Primers | Amplicon Size (bp) | Primer Efficiency (%) | |
|---|---|---|---|---|
| sept8a | Forward primer | ATACTCAAGTGTCGACGGCAG | 178 | 99.5 |
| Reverse primer | TTGGCGCATTTCTTCTTCGTG | |||
| ilk | Forward primer | CACGGAGTTCCCTTCTCGAC | 215 | 98.8 |
| Reverse primer | ACCTTTCTTTCCCCAGGCTAC | |||
| rbck1 | Forward primer | GTTGCATTTTACAGGGCAAAGGT | 177 | 96.8 |
| Reverse primer | TGGCAATTTTGGCAGTTGGG | |||
| malt1 | Forward primer | AACGATGCAGGAGATTGACGA | 189 | 99.8 |
| Reverse primer | TTTTTCATCAAAGCCCCCGTT | |||
| β-actin | Forward primer | TCGTCGGTCGTCCCAGGCATCAG | 167 | 98.8 |
| Reverse primer | ATGGCGTGGGGCAGAGCGTAACC | |||
| Sample | Raw Data (bp) | Clean Data (bp) | Q20 (%) | Q30 (%) | GC (%) | Unique_Mapped (%) | Total_Mapped (%) |
|---|---|---|---|---|---|---|---|
| CHK-1-1 | 7,632,059,700 | 7,277,674,435 | 97.69 | 93.77 | 45.97 | 79.87 | 84.93 |
| CHK-1-2 | 8,430,991,200 | 8,001,031,889 | 97.62 | 93.58 | 46.63 | 81.15 | 86.04 |
| CHK-1-3 | 7,013,979,300 | 6,681,684,228 | 97.69 | 93.71 | 46.54 | 75.06 | 82.76 |
| CHK-2-1 | 7,406,268,000 | 7,045,258,944 | 98.08 | 94.67 | 46.64 | 80.51 | 86.88 |
| CHK-2-2 | 6,890,075,700 | 6,581,480,962 | 98.36 | 95.04 | 48.30 | 78.59 | 89.38 |
| CHK-2-3 | 5,451,673,800 | 5,296,742,370 | 98.32 | 95.07 | 48.83 | 81.00 | 91.44 |
| EHK-1-1 | 6,243,928,200 | 5,852,180,629 | 97.27 | 92.30 | 46.58 | 81.26 | 86.33 |
| EHK-1-2 | 7,058,998,500 | 6,752,416,226 | 98.19 | 94.88 | 45.70 | 77.81 | 84.57 |
| EHK-1-3 | 8,679,359,700 | 8,299,852,935 | 97.65 | 93.50 | 46.27 | 78.15 | 84.79 |
| EHK-2-1 | 6,162,554,100 | 6,015,304,308 | 97.69 | 93.49 | 46.95 | 78.07 | 88.07 |
| EHK-2-2 | 5,814,360,300 | 5,673,353,837 | 97.97 | 94.24 | 48.55 | 80.53 | 91.00 |
| EHK-2-3 | 6,454,137,900 | 6,282,802,338 | 98.23 | 94.85 | 48.42 | 80.37 | 90.64 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Han, K.H.; Li, Z.M.; Zhou, L.; Zhang, D.L.; Li, Y.; Sun, Z.H.; Chen, J.; Lin, Z.D.; Dai, Y.B.; Zou, P.F. Pseudostellaria heterophylla Extract Enhances the Immune Responses in Larimichthys crocea Against Pseudomonas plecoglossicida Infection. Fishes 2026, 11, 371. https://doi.org/10.3390/fishes11060371
Han KH, Li ZM, Zhou L, Zhang DL, Li Y, Sun ZH, Chen J, Lin ZD, Dai YB, Zou PF. Pseudostellaria heterophylla Extract Enhances the Immune Responses in Larimichthys crocea Against Pseudomonas plecoglossicida Infection. Fishes. 2026; 11(6):371. https://doi.org/10.3390/fishes11060371
Chicago/Turabian StyleHan, Kun Huang, Zi Min Li, Li Zhou, Dong Ling Zhang, Ying Li, Zhao Han Sun, Jia Chen, Zhi Deng Lin, Yan Bin Dai, and Peng Fei Zou. 2026. "Pseudostellaria heterophylla Extract Enhances the Immune Responses in Larimichthys crocea Against Pseudomonas plecoglossicida Infection" Fishes 11, no. 6: 371. https://doi.org/10.3390/fishes11060371
APA StyleHan, K. H., Li, Z. M., Zhou, L., Zhang, D. L., Li, Y., Sun, Z. H., Chen, J., Lin, Z. D., Dai, Y. B., & Zou, P. F. (2026). Pseudostellaria heterophylla Extract Enhances the Immune Responses in Larimichthys crocea Against Pseudomonas plecoglossicida Infection. Fishes, 11(6), 371. https://doi.org/10.3390/fishes11060371

