Development and Validation of a Multienzyme Isothermal Rapid Amplification Combined with Lateral-Flow Dipstick (MIRA-LFD) Assay for Trypanosoma Strains Circulating in Large Yellow Croaker (Larimichthys crocea)
Abstract
1. Introduction
2. Materials and Methods
2.1. Trypanosome sp. 18S Ribosomal RNA (rRNA) Gene Cloning
2.2. Genomic DNA Extraction
2.3. Design and Screening of the MIRA Primer and Probe
2.4. Development of MIRA Assay for Large Yellow Croaker Trypanosome Detection
2.5. Specificity and Comparative Sensitivity Analysis
2.6. Development of a TaqMan-Based Quantitative PCR Method for L. crocea Trypanosome
- C: Concentration (0.01 fg/µL).
- NA: Avogadro’s constant (6.022 × 1023 copies/mol).
- M: Molecular weight of the plasmid (pMD19-T + 18S rRNA insert).
2.7. Clinical Validation and Diagnostic Consistency Testing
- TP (True Positive): Both assays yielded positive result.
- TN (True Negative): Both assays yielded negative result.
- FN (False Negative): qPCR-positive but MIRA-LFD-negative result.
- FP (False Positive): qPCR-negative but MIRA-LFD-positive result.
3. Results
3.1. Screening of Primers and Probes for the MIRA-LFD Assay
3.2. Sensitivity and Specificity in the MIRA-LFD Assay
3.3. Optimization of DNA Extraction Conditions
3.4. TaqMan-Based qPCR Detection Assay
3.5. Assessment of the MIRA Using Clinical Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Stuart, K.; Brun, R.; Croft, S.; Fairlamb, A.; Gürtler, R.E.; McKerrow, J.; Reed, S.; Tarleton, R. Kinetoplastids: Related protozoan pathogens, different diseases. J. Clin. Investig. 2008, 118, 1301–1310. [Google Scholar] [CrossRef] [Scilit]
- Shahi, N.; Yousuf, A.R.; Rather, M.I.; Ahmad, F.; Yaseen, T. First report of blood parasites in fishes from Kashmir and their effect on the haematological profile. Open Vet. J. 2013, 3, 89–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karlsbakk, E. Aspects of the Morphology and Ecology of Some North Atlantic Marine Fish Trypanosomes; University of Bergen: Bergen, Norway, 2006. [Google Scholar]
- Marques, R.; Jiménez-García, D.; Escobar, L.E.; Krolow, T.K.; Krüger, R.F. Spatial epidemiology of Tabanus (Diptera: Tabanidae) vectors of Trypanosoma. Parasites Vectors 2025, 18, 128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le Roux, C.; Cook, C.A.; Netherlands, E.C.; Truter, M.; Smit, N.J. Molecular and morphological characterization of one known and three new species of fish parasitic Trypanosoma Gruby, 1972 from the south coast of South Africa. Parasitology 2025, 152, 531–550. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.-Y.; Xu, L.; Bi, Y.-X.; Zhang, J.; Hide, G.; Lai, D.-H.; Lun, Z.-R. First outbreak of trypanosomiasis in farmed blood parrot cichlids (Vieja melanura♀ × Amphilophus citrinellus♂) from southern China. Aquaculture 2024, 588, 740944. [Google Scholar] [CrossRef] [Scilit]
- Qin, P.; Chen, X.; Lou, B.; Wu, T.; Yang, J.; Wang, W.; Huang, G.; Chen, X. Outbreak of trypanosomiasis in cage-cultured large yellow croaker in China. J. Fish Dis. 2024, 48, e13952. [Google Scholar] [CrossRef] [Scilit]
- Fouad, A.M.; Abd El-Lateif, R.S.A.; Abo-Al-Ela, H.G.; Abdel-Hakeem, S.S. Cytotoxicity and immunological impact of Trypanosoma sp. infection on blood parameters of wild African catfish, Clarias gariepinus. Parasitol. Res. 2023, 123, 10. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Qi, P.; Tao, Z.; Zhang, Q.; Wang, Y.; Zhu, D.; Yan, X.; Fu, P.; Guo, B. Identification of a new fish trypanosome from the large yellow croaker (Larimichthys crocea) and description of its impact on host pathology, blood biochemical parameters and immune responses. Parasite 2025, 32, 1. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.-F.; Li, X.-T.; Zhang, P.; Xu, L.-W.; Zhang, J.-Y.; Hide, G.; Lai, D.-H.; Lun, Z.-R. Characterization of a trypanosome from large yellow croaker (Larimichthys crocea), cage-cultured in seawater, in China. Aquac. Rep. 2025, 43, 102868. [Google Scholar] [CrossRef] [Scilit]
- Leadbeater, B.S.C.; Green, J.C. (Eds.) The Flagellates: Unity, Diversity and Evolution; CRC Press: London, UK, 2000. [Google Scholar]
- Lemos, M.; Fermino, B.R.; Simas-Rodrigues, C.; Hoffmann, L.; Silva, R.; Camargo, E.P.; Teixeira, M.M.; Souto-Padrón, T. Phylogenetic and morphological characterization of trypanosomes from Brazilian armoured catfishes and leeches reveal high species diversity, mixed infections and a new fish trypanosome species. Parasit Vectors 2015, 8, 573. [Google Scholar] [CrossRef] [Scilit]
- Jesus, R.; Gallani, S.; Valladão, G.; Pala, G.; Silva, T.; Costa, J.; Kotzent, S.; Pilarski, F. Trypanosomiasis causing mortality outbreak in Nile tilapia intensive farming: Identification and pathological evaluation. Aquaculture 2018, 491, 169–176. [Google Scholar] [CrossRef] [Scilit]
- Jiang, B.; Lu, G.; Du, J.; Wang, J.; Hu, Y.; Su, Y.; Li, A. First report of trypanosomiasis in farmed largemouth bass (Micropterus salmoides) from China: Pathological evaluation and taxonomic status. Parasitol. Res. 2019, 118, 1731–1739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, Y.; Feng, J.; Jiang, J.; Guo, Z.; Liu, G.; Xu, L. Trypanosoma epinepheli n. sp. (Kinetoplastida) from a farmed marine fish in China, the brown-marbled grouper (Epinephelus fuscoguttatus). Parasitol. Res. 2014, 113, 11–18. [Google Scholar] [CrossRef] [Scilit]
- Luo, D.; Xu, L.W.; Liu, X.H.; Sato, H.; Zhang, J.Y. Outbreak of trypanosomiasis in net-cage cultured barramundi, Lates calcarifer (Perciformes, Latidae), associated with Trypanosoma epinepheli (Kinetoplastida) in South China Sea. Aquaculture 2019, 501, 219–223. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Huang, W.; Shan, X.; Chen, J.; Wang, H. Growth characteristics of cage-cultured large yellow croaker Larimichthys crocea. Aquac. Rep. 2020, 16, 100242. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Su, Y.; Hong, W. Aquaculture of the Large Yellow Croaker. In Aquaculture in China; Wiley Online Library: Hoboken, NJ, USA, 2018; pp. 297–308. [Google Scholar]
- Chi, H.; Taik, P.; Foley, E.J.; Racicot, A.C.; Gray, H.M.; Guzzetta, K.E.; Lin, H.Y.; Song, Y.L.; Tung, C.H.; Zenke, K.; et al. High genetic diversities between isolates of the fish parasite Cryptocaryon irritans (Ciliophora) suggest multiple cryptic species. Mol. Phylogenet. Evol. 2017, 112, 47–52. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Luan, Y.; Wei, J.; Li, Y.; Shi, H.; Cheng, H.; Bai, A.; Xie, J.; Xu, W.; Qin, P. Genetic and Pathogenic Characterization of a New Iridovirus Isolated from Cage-Cultured Large Yellow Croaker (Larimichthys crocea) in China. Viruses 2022, 14, 208. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Wang, S.; Ren, Q.; He, T.; Chen, X. An outbreak of visceral white nodules disease caused by Pseudomonas plecoglossicida at a water temperature of 12 °C in cultured large yellow croaker (Larimichthys crocea) in China. J. Fish Dis. 2020, 43, 1353–1361. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.; Xie, X.; Zheng, C.; Wang, X.; Buchmann, K.; Yin, F. Coinfection of large yellow croaker Larimichthys crocea by Trypanosoma sp. (Euglenozoa: Kinetoplastea) and Ceratomyxa xiangshanensis n. sp. (Cnidaria: Myxosporea) in offshore net cage systems in the East China Sea. Parasitol. Int. 2025, 111, 103167. [Google Scholar] [CrossRef] [Scilit]
- Desquesnes, M.; Gonzatti, M.; Sazmand, A.; Thévenon, S.; Bossard, G.; Boulangé, A.; Gimonneau, G.; Truc, P.; Herder, S.; Ravel, S.; et al. A review on the diagnosis of animal trypanosomoses. Parasit Vectors 2022, 15, 64. [Google Scholar] [CrossRef] [Scilit]
- MacAulay, S.; Ellison, A.R.; Kille, P.; Cable, J. Moving towards improved surveillance and earlier diagnosis of aquatic pathogens: From traditional methods to emerging technologies. Rev. Aquac. 2022, 14, 1813–1829. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, S.B.; Zhang, Y. Development of Multienzyme Isothermal Rapid Amplification (MIRA) Combined with Lateral-Flow Dipstick (LFD) Assay to Detect Species-Specific tlh and Pathogenic trh and tdh Genes of Vibrio parahaemolyticus. Pathogens 2024, 13, 57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Finney, D.J. Probit Analysis, 3rd ed.; Cambridge University Press: Cambridge, UK, 1971; Volume 60, p. 1432. [Google Scholar]
- Landis, J.R.; Koch, G.G. The measurement of observer agreement for categorical data. Biometrics 1977, 33, 159–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, C.; Li, J.; Yu, H.; Xu, K.; He, X.; Liu, Z.; Chen, J. CRISPR/Cas13a combined with reverse transcription-multienzyme isothermal rapid amplification for hepatitis B virus RNA detection. Anal. Chim. Acta 2025, 1370, 344389. [Google Scholar] [CrossRef] [Scilit]
- Huang, Q.; Dai, F.; Su, L.; Zhang, M.; Miao, X.; Ding, Y.; Xu, C.; Xu, J. Detection of Aeromonas hydrophila by Basic and Fluorescent MIRA Assays. Microorganisms 2025, 13, 2191. [Google Scholar] [CrossRef] [Scilit]
- Yin, L.; Zhao, Z.; Wang, C.; Zhou, C.; Wu, X.; Gao, B.; Wang, L.; Man, S.; Cheng, X.; Wu, Q.; et al. Development and evaluation of a CRISPR/Cas12a-based diagnostic test for rapid detection and genotyping of HR-HPV in clinical specimens. Microbiol. Spectr. 2025, 13, e0225324. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Song, M.; Pan, Y.; Zhao, Y.; Liu, H. Evaluation and Application of the MIRA-qPCR Method for Rapid Detection of Norovirus Genogroup II in Shellfish. Microorganisms 2025, 13, 712. [Google Scholar] [CrossRef] [Scilit]
- Fan, Y.; Wang, J.; Bian, X.; Wang, W.; Zhou, J.; Zhang, X.; Hu, M.; Sun, M.; Yang, S.; Zhao, Y.; et al. Multienzyme isothermal rapid amplification (MIRA)-LFD assay for rapid detection of PEDV and PoRVA. J. Microbiol. Methods 2025, 238, 107289. [Google Scholar] [CrossRef] [Scilit]
- Jinwei, Y.; Jun, H.; Lei, L.; Yang, L.; Min, D.; Chang, M.; Xuliang, Z.; Xiaobo, F.; Hui, C. An on-site detection assay for screening of sendai virus by using palm-sized handheld system based on the reverse transcription multienzyme isothermal rapid amplification. Microb. Pathog. 2025, 209, 108064. [Google Scholar] [CrossRef] [Scilit]






| Function | Name | Sequence (5′-3′) |
|---|---|---|
| Plasmid construction | S762 | 5′-GACTTTTGCTTCCTCTATTG-3′ |
| S763 | 5′-CATATGCTTGTTTCAAGGAC-3′ | |
| MIRA primer | Try-n1F1 | TGAAACTTAAAGAAATTGACGGAATGGCAC |
| Try-n1F2 | CACGCGAAAGCTTTGAGGTTACAGTCTCAG | |
| Try-n1F3 | TATCCTCAGCACGTTTTCTTACTTCTTCAC | |
| Try-n1R1 | [5′-biotin]-ACTCAATCTGTCAATCCTCACCCTGTCCGG | |
| Try-n1R2 | [5′-biotin]-TCAGGGGATCGAGAAAGAACACTCAATCTG | |
| Try-n1R3 | [5′-biotin]-ACCAAAAGCGGCCATGCACCACCATTCAGG | |
| Try-n2F1 | TGATTTGTTTGGTTGATTCCGTCAACGGAC | |
| Try-n2F2 | ATGGCCGCTTTTGGTCGGTGGAGTGATTTG | |
| Try-n2F3 | TGTTCTTTCTCGATCCCCTGAATGGTGGTG | |
| Try-n2R1 | [5′-biotin]-ATCCCGCAGAGAAGGATACAAACGAATACC | |
| Try-n2R2 | [5′-biotin]-AAATCTCACCTTGTGCAAAGTCAAGGAATC | |
| Try-n2R3 | [5′-biotin]-CATTGAGGAGCATCACAGACCTGCTGTTGC | |
| Try-n3F1 | CTGCTTCCAGGAATGAAGGAGGGTAGTTCG | |
| Try-n3F2 | CTTCGGCTTGTCTTTTCCTCTCGGTGCATT | |
| Try-n3F3 | TATCTGGTGCCCGTCGCCTTTGTGGGAAAC | |
| Try-n3R1 | [5′-biotin]-ATCCTTGAAGAATGCCTTCGCTGTAGTTCG | |
| Try-n3R2 | [5′-biotin]-CACTTTGGTTCTTGATTGAGGAAGGTATCC | |
| Try-n3R3 | [5′-biotin]-ACTACAATGGTCTCTAATCATCTTCGATCC | |
| MIRA probe | Try-nP1 | 5′FAM-CACAAGACGTGGAGCGTGCGGTTTAATTTG[THF]CTCAACACGGGGAAC-3′C3spacer |
| Try-nP2 | 5′FAM-AGATCCAAGCTGCCCAGTAGGATTCAGAAT[THF]GCCCATAGGATAGCA-3′C3spacer | |
| Try-nP3 | 5′FAM-AGAACGTACTGGTGCGTCAGAGGTGAAATT[THF]TTAGACCGCACCAAG-3′C3spacer | |
| qPCR | Forward | ACGTTCGCAAGAGTGAAACTT |
| Reverse | TGTCAATCCTCACCCTGTCC | |
| Probe | FAM-CCACAAGACGTGGAGCGTGCGG-BHQ1 |
| Classify | Host | GeneBank No. | Identify (%) |
|---|---|---|---|
| Fish | Larimichthys crocea | OR934685 | 100.00 |
| Fish | Larimichthys crocea | OR934688 | 99.05 |
| Fish | Larimichthys crocea | OR934687 | 99.05 |
| Fish | Larimichthys crocea | OR934686 | 98.91 |
| Fish | Larimichthys crocea | PQ272744 | 98.15 |
| Fish | Larimichthys crocea | PQ621096 | 98.15 |
| Fish | Larimichthys crocea | PQ273029 | 98.15 |
| Fish | Larimichthys crocea | PQ621095 | 98.01 |
| Fish | Larimichthys crocea | PQ623010 | 97.96 |
| Fish | Larimichthys crocea | PQ623008 | 97.96 |
| Fish | Larimichthys crocea | PQ623018 | 97.54 |
| Fish | Micropterus salmoides | MN831479 | 97.54 |
| Fish | Pseudobagras fulvidraco | EF375883 | 95.33 |
| Fish | Carassius carassius | KJ601715 | 95.02 |
| Fish | Channa argus | EU185634 | 94.86 |
| Fish | Abramis brama | AJ620554 | 94.44 |
| Fish | Clarias angelensis | AJ620555 | 94.36 |
| Fish | Melanogrammus aeglefinus | DQ016618 | 89.48 |
| Amphibians | Trachycephalus venulosus | EU267074 | 87.26 |
| Amphibians | Leptodactylus chaquensis | EU021225 | 87.26 |
| Amphibians | Chaunus marinus | EU021230 | 87.21 |
| Amphibians | Scinax hayii | EU267075 | 87.17 |
| Amphibians | Aplastodiscus leucopygius | EU021234 | 87.17 |
| Amphibians | Rhinella margaritifer | EU021231 | 87.13 |
| Insects | Glossina pallidipes | AJ620547 | 88.88 |
| Insects | Sciopemyia servulolimai | EU021241 | 87.33 |
| Insects | Sciopemyia sordellii | EU021243 | 87.19 |
| Assay | qPCR | DSe | DSp | Κ Value | |||
|---|---|---|---|---|---|---|---|
| Positive | Negative | Total | |||||
| MIRA-LFD | Positive | 141 | 1 | 142 | 94.63% | 97.06% | 0.849 |
| Negative | 8 | 33 | 41 | ||||
| Total | 149 | 34 | 183 | ||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Zuo, Y.; Liao, B.; Lin, L.; Wu, T.; Yuan, J.; Xue, Q.; Wei, H.; Liu, S.; Huang, G.; Chen, X.; et al. Development and Validation of a Multienzyme Isothermal Rapid Amplification Combined with Lateral-Flow Dipstick (MIRA-LFD) Assay for Trypanosoma Strains Circulating in Large Yellow Croaker (Larimichthys crocea). Fishes 2026, 11, 107. https://doi.org/10.3390/fishes11020107
Zuo Y, Liao B, Lin L, Wu T, Yuan J, Xue Q, Wei H, Liu S, Huang G, Chen X, et al. Development and Validation of a Multienzyme Isothermal Rapid Amplification Combined with Lateral-Flow Dipstick (MIRA-LFD) Assay for Trypanosoma Strains Circulating in Large Yellow Croaker (Larimichthys crocea). Fishes. 2026; 11(2):107. https://doi.org/10.3390/fishes11020107
Chicago/Turabian StyleZuo, You, Bichai Liao, Luoxuan Lin, Tong Wu, Jiahao Yuan, Qianxi Xue, Haiyun Wei, Shuming Liu, Guangliang Huang, Xinhua Chen, and et al. 2026. "Development and Validation of a Multienzyme Isothermal Rapid Amplification Combined with Lateral-Flow Dipstick (MIRA-LFD) Assay for Trypanosoma Strains Circulating in Large Yellow Croaker (Larimichthys crocea)" Fishes 11, no. 2: 107. https://doi.org/10.3390/fishes11020107
APA StyleZuo, Y., Liao, B., Lin, L., Wu, T., Yuan, J., Xue, Q., Wei, H., Liu, S., Huang, G., Chen, X., & Qin, P. (2026). Development and Validation of a Multienzyme Isothermal Rapid Amplification Combined with Lateral-Flow Dipstick (MIRA-LFD) Assay for Trypanosoma Strains Circulating in Large Yellow Croaker (Larimichthys crocea). Fishes, 11(2), 107. https://doi.org/10.3390/fishes11020107

