Development and Validation of a Multienzyme Isothermal Rapid Amplification Combined with Lateral-Flow Dipstick (MIRA-LFD) Assay for Trypanosoma Strains Circulating in Large Yellow Croaker (Larimichthys crocea)

Abstract

Trypanosomiasis, caused by flagellated protozoa of the genus Trypanosoma, has recently emerged as a major threat to aquaculture in China, particularly in farmed large yellow croaker (Larimichthys crocea). Outbreaks lead to high mortality rates and severe economic losses. Conventional diagnostic tools, such as blood-smear microscopy and molecular assays including polymerase chain reaction or quantitative polymerase chain reaction (qPCR), are often limited by low sensitivity during early infection or by their dependence on sophisticated instruments and trained personnel, restricting their utility in field conditions. To address these challenges, a multienzyme isothermal rapid amplification (MIRA) assay coupled with a lateral-flow dipstick (LFD) was developed for the rapid detection of trypanosoma strains circulating in L. crocea targeting the 18S ribosomal ribonucleic acid gene. After optimizing primer-probe sets, the assay performance was evaluated using plasmid standards and a panel of common aquaculture pathogens. The MRA-LFD assay consistently detected plasmid DNA at concentrations as low as 0.01 fg/µL (≈2.1 copies/µL) and demonstrated no cross-reactivity with other pathogens. Using clinical DNA samples positive for Trypanosoma, the detection limit was 100 fg µL⁻¹. Validation with 150 tissue samples from fish with and without clinical symptoms demonstrated high diagnostic consistency (94%) with qPCR results, confirming the reliability of the assay. This MIRA-LFD platform provides a sensitive, specific and portable diagnostic tool for early detection of Trypanosoma infections in large yellow croaker, offering valuable support for surveillance and disease management in aquaculture.

1. Introduction

Trypanosoma is a genus of flagellated protozoa within the order Kinetoplastida, comprising numerous parasitic species that infect a wide range of vertebrate hosts, including humans, livestock, birds, amphibians, and fish [1]. Fish trypanosomiasis is a globally distributed disease that affects both freshwater and marine species across families such as Cyprinidae, Anguillidae, Gobiidae, Esocidae, Serranidae, Cichlidae, Characidae, and Sciaenidae [2,3,4,5,6,7,8,9,10]. To date, more than 200 species of piscine trypanosomes have been reported, primarily parasitizing the blood and various tissues of their hosts [11,12]. While infections in wild fish are often asymptomatic, outbreaks of trypanosome infections in aquaculture systems have become increasingly significant. Trypanosomiasis has been documented in numerous farmed species, including Nile tilapia (Oreochromis niloticus) [13], largemouth bass (Micropterus salmoides) [14], orange-spotted grouper (Epinephelus fuscoguttatus) [15], and barramundi (Lates calcarifer) [16]. Recently, trypanosomiasis caused by Trypanosoma sp. has been linked to substantial economic losses in large yellow croaker farming [7,9,10].

The large yellow croaker (Larimichthys crocea) is one of the most economically valuable marine species in China’s aquaculture sector, with an annual production exceeding 290,000 tons and an estimated industry valuation of over 20 billion yuan. However, disease outbreaks in the L. crocea population have become more prevalent, posing a major threat to the industry [17,18,19,20,21]. In September 2023, trypanosomiasis was first identified in farmed L. crocea in Sanduao Bay, and it rapidly spread across major production regions in Fujian and Zhejiang Provinces [7,9,10,22]. The disease is characterized by rapid transmission, prolonged incubation and epidemic periods, and high mortality, with cumulative mortality rates in affected farms reaching 30–40% [7]. As an emerging parasitic disease, the origin, epidemiology, and pathogenesis of L. crocea trypanosomiasis remain poorly understood. Currently, there are no effective therapeutic and preventive measures, and management strategies mainly depend on the procurement of healthy fry, early screening, and timely intervention. Consequently, developing a simple, sensitive, and field-deployable diagnostic method is crucial for effective control.

Conventional diagnosis of piscine trypanosomiasis primarily relies on microscopic examination of blood smears, a method that is rapid and inexpensive but suffers from low sensitivity, particularly during early or low-intensity infections [23]. Molecular techniques such as polymerase chain reaction (PCR) and quantitative polymerase chain reaction (qPCR) provide higher sensitivity and specificity, with the additional advantage of sequence-based identification. However, these assays require thermocycling equipment, trained staff, and dedicated laboratory infrastructure, which restricts their use in aquaculture field settings [24]. Isothermal amplification techniques have recently emerged as promising alternatives for point-of-care diagnostics. Among them, multienzyme isothermal rapid amplification (MIRA) represents a recombinase-mediated nucleic acid amplification approach analogous to recombinase polymerase amplification (RPA). MIRA operates at a constant 25–42 °C, optimally between 37 and 42 °C, and does not require thermal cycling [25]. The reaction employs a recombinase complex to invade double-stranded deoxyribonucleic acid (DNA), single-stranded DNA-binding proteins to stabilize unwound strands, and a strand-displacing polymerase to extend primers [25].

Despite advances in molecular diagnostics, no rapid, sensitive assay has yet been developed specifically for detecting trypanosomes in L. crocea. To address this gap, a MIRA–LFD assay targeting the 18S ribosomal ribonucleic acid (rRNA) gene of Trypanosoma was developed and validated. The assay was designed to provide a highly sensitive, specific, and practical tool for on-site detection, thereby facilitating early diagnosis, timely intervention, and enhanced disease control in L. crocea aquaculture.

2. Materials and Methods

2.1. Trypanosome sp. 18S Ribosomal RNA (rRNA) Gene Cloning

The 18S rRNA gene was amplified from DNA extracted from cultured Trypanosoma using primers S762 (5′-GACTTTTGCTTCCTCTATTG-3′) and S763 (5′-CATATGCTTGTTTCAAGGAC-3′). PCR conditions were: Initial denaturation at 95 °C for 5 min, followed by 35 cycles of 95 °C for 15 s, 56 °C for 20 s, and 72 °C for 30 s, with a final extension at 72 °C for 5 min. Each 50 µL reaction mixture consisted of 2 µL of DNA template, 2 µL of each primer, 25 µL of Taq DNA Polymerase Mix, and 19 µL of nuclease-free water. The resulting PCR products were subsequently cloned into the pMD19-T vector and transformed into E. coli Trans-T1 cells. Positive clones were screened and sequenced, and the validated construct was preserved as the standard plasmid (pMD18-Try 18S RNA).

2.2. Genomic DNA Extraction

Two DNA extraction methods were evaluated: A magnetic-bead protocol with TIANGEN’s Magnetic Universal Genomic DNA Kit (Beijing, China) as well as a rapid lysis approach using AMP-Future Biotech’s Animal Tissue DNA Rapid Release Reagent (Weifang, China). For each 0.2 g tissue sample, extractions follow the manufacturer’s protocols. DNA concentration and purity were measured with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA); only samples whose OD260/OD280 fell between 1.8 and 2.0 were used for MIRA-LFD and qPCR assays.

2.3. Design and Screening of the MIRA Primer and Probe

Due to limited genomic data on piscine Trypanosoma in the NCBI database and the scarcity of genetic information on Trypanosoma species in the L. crocea, the 18S rRNA gene was used for detection purposes. The complete 18S rRNA gene was selected as the diagnostic target. Complete 18S rRNA sequences of Trypanosoma isolates of L. crocea and other species (GenBank) were aligned using MAFFT software to identify conserved regions.

Primers were designed in Primer Premier 6 according to MIRA requirements: 25–35 nt in length, 40–60% GC content, absence of ≥ 4 nt homopolymers, limited secondary structure, negligible dimer potential, and amplicons of 150–300 bp. A FAM-labeled fluorescent probe, complementary to the target region, included a central THF residue and a 3′ C3 spacer (

Table 1. The primers and probes used in this study.

Function	Name	Sequence (5′-3′)
Plasmid construction	S762	5′-GACTTTTGCTTCCTCTATTG-3′
	S763	5′-CATATGCTTGTTTCAAGGAC-3′
MIRA primer	Try-n1F1	TGAAACTTAAAGAAATTGACGGAATGGCAC
	Try-n1F2	CACGCGAAAGCTTTGAGGTTACAGTCTCAG
	Try-n1F3	TATCCTCAGCACGTTTTCTTACTTCTTCAC
	Try-n1R1	[5′-biotin]-ACTCAATCTGTCAATCCTCACCCTGTCCGG
	Try-n1R2	[5′-biotin]-TCAGGGGATCGAGAAAGAACACTCAATCTG
	Try-n1R3	[5′-biotin]-ACCAAAAGCGGCCATGCACCACCATTCAGG
	Try-n2F1	TGATTTGTTTGGTTGATTCCGTCAACGGAC
	Try-n2F2	ATGGCCGCTTTTGGTCGGTGGAGTGATTTG
	Try-n2F3	TGTTCTTTCTCGATCCCCTGAATGGTGGTG
	Try-n2R1	[5′-biotin]-ATCCCGCAGAGAAGGATACAAACGAATACC
	Try-n2R2	[5′-biotin]-AAATCTCACCTTGTGCAAAGTCAAGGAATC
	Try-n2R3	[5′-biotin]-CATTGAGGAGCATCACAGACCTGCTGTTGC
	Try-n3F1	CTGCTTCCAGGAATGAAGGAGGGTAGTTCG
	Try-n3F2	CTTCGGCTTGTCTTTTCCTCTCGGTGCATT
	Try-n3F3	TATCTGGTGCCCGTCGCCTTTGTGGGAAAC
	Try-n3R1	[5′-biotin]-ATCCTTGAAGAATGCCTTCGCTGTAGTTCG
	Try-n3R2	[5′-biotin]-CACTTTGGTTCTTGATTGAGGAAGGTATCC
	Try-n3R3	[5′-biotin]-ACTACAATGGTCTCTAATCATCTTCGATCC
MIRA probe	Try-nP1	5′FAM-CACAAGACGTGGAGCGTGCGGTTTAATTTG[THF]CTCAACACGGGGAAC-3′C3spacer
	Try-nP2	5′FAM-AGATCCAAGCTGCCCAGTAGGATTCAGAAT[THF]GCCCATAGGATAGCA-3′C3spacer
	Try-nP3	5′FAM-AGAACGTACTGGTGCGTCAGAGGTGAAATT[THF]TTAGACCGCACCAAG-3′C3spacer
qPCR	Forward	ACGTTCGCAAGAGTGAAACTT
	Reverse	TGTCAATCCTCACCCTGTCC
	Probe	FAM-CCACAAGACGTGGAGCGTGCGG-BHQ1

). All oligonucleotides were synthesized and HPLC-purified (Tsingke Biotech, Fuzhou, China).

The identification of the optimal primer–probe set was conducted through a rigorous, multi-stage screening process designed to ensure high sensitivity while strictly eliminating false-positive results caused by primer dimers. A total of three FAM-labeled probes (nP1–P3) were synthesized, each systematically paired with three corresponding primer sets (Table 1). In the first stage, each combination was evaluated under No-Template Control (NTC) conditions, where sterile water was used as the template instead of DNA. The MIRA reactions followed the 1-probe/1-forward/3-reverse primer pattern to assess the propensity for primer-dimer formation.

Following amplification, the results were interpreted using the lateral-flow dipstick (LFD). The lateral-flow dipstick (LFD) consists of a sample pad, a conjugate pad (impregnated with colloidal gold-labeled anti-FAM antibodies), a nitrocellulose (NC) membrane, and an absorbent pad. The NC membrane was stripped with streptavidin at the test line (T-line) and secondary antibodies at the control line (C-line). Any combination that exhibited a visible red band at the Test-line (T-line) in the absence of target DNA was classified as susceptible to non-specific amplification and excluded from further study. Subsequently, the stable backbones identified were paired with candidate forward primers (n2F1, n2F2, and n2F3) and tested using serial dilutions of the pMD18-Try 18S RNA plasmid (10, 1, and 0.1 fg per reaction). The amplicons were analyzed via 2% agarose gel electrophoresis to determine which pairs yielded the most distinct and intense specific bands at the lowest concentrations. Finally, to confirm robustness, the remaining lead candidates were subjected to eight independent NTC replicates.

2.4. Development of MIRA Assay for Large Yellow Croaker Trypanosome Detection

Each 50 μL MIRA reaction contained 29.4 μL Buffer A, 1 μL each of forward and reverse primers (10 μM), 0.2 μL probe (10 μM), 2 μL template DNA, and 13.9 μL sterile water. After transfer to a lyophilized reaction tube, 2.5 μL Buffer B was added, mixed by inversion, briefly centrifuged, and incubated at 39 °C for 15 min. The amplicon was diluted 1:10 with sterile water, spotted onto lateral-flow strips, and read within 5 min by checking the control and test lines. The MIRA-LFD results were interpreted visually. A sample was defined as ‘weakly positive’ when a faint but discernible red line appeared at the test line (T-line) location, visible to the naked eye under standard laboratory lighting, while the control line (C-line) remained distinct.

2.5. Specificity and Comparative Sensitivity Analysis

To evaluate the analytical sensitivity of the developed MIRA-LFD assays, the limit of detection at a 95% confidence level LOD₉₅ was determined using pMD18-Try18S rRNA plasmid. A 10-fold serial dilution of the plasmid standards (ranging from 1 ng to 0.001 fg/μL) was initially prepared in nuclease-free water to establish the broad dynamic range. Based on the preliminary results, a narrower range of 2-fold serial dilutions was subsequently generated around the suspected detection limit to ensure the precision of the LOD₉₅ estimation. Each concentration gradient within the sensitivity range was tested in 20 replicates. The LOD value was calculated by probit regression analysis [26]. All statistical analyses were performed using IBM SPSS Statistics 27.

To evaluate the analytical exclusivity of the MIRA-LFD assay, a specificity panel was constructed comprising genomic DNA from common pathogens associated with L. crocea. These included the parasitic protozoans Cryptocaryon irritans and Miamiensis avidus, as well as the metazoans Benedenia seriolae and Pseudograffilla sp., all of which were cultured and maintained in the laboratory. For kinetoplastids and other aquatic parasites where clinical isolates were inaccessible, a comprehensive in silico analysis was performed. Representative 18S rRNA gene sequences were retrieved from the National Center for Biotechnology Information (NCBI) GenBank database, including related species within the same genus (Trypanosoma rotatorium, AJ009161; T. triglae, U39584; T. rajae, MG878995) and other common fish parasites (Lernaea cyprinacea, DQ107554; Ichthyobodo necator, KC208028). Multiple sequence alignments were conducted using MAFFT (version 7.0) to assess the primer and probe complementarity against these non-target sequences. To further validate the specificity beyond computational predictions, core sequences of Trypanosoma rotatorium, T. triglae, T. rajae, Lernaea cyprinacea and Ichthyobodo necator were synthesized (Tsingke Biotech, Fuzhou, China). These synthetic standards were tested experimentally to confirm the absence of cross-reactivity. All specificity tests were performed in triplicate to ensure reproducibility.

2.6. Development of a TaqMan-Based Quantitative PCR Method for L. crocea Trypanosome

A TaqMan qPCR assay targeting the conserved region of the Trypanosoma 18S rRNA gene was developed. Specific primer and probe sequences were designed to avoid cross-reactivity, with the probe labeled using FAM and BHQ1 dyes. The qPCR assay was performed in a total reaction volume of 20 µL. The thermal cycling conditions were optimized as follows: an initial denaturation at 95 °C for 30 s, followed by 35 cycles of denaturation at 95 °C for 5 s and a combined annealing/extension step at 60 °C for 30 s. A recombinant plasmid, pMD18-Try18S rRNA, was utilized as the positive control and for subsequent analytical sensitivity evaluations. For quantification, a standard curve was established by plotting the cycle threshold (Ct) values against the logarithm of the known DNA copy numbers. The amplification efficiency (E) was derived from the slope of the regression line. The DNA copy number (N, copies/µL) for the plasmid standard was calculated using the following equation:

$$N={\displaystyle \frac{C\times N_A\times {10}^{-15}}{M}}$$

• C: Concentration (0.01 fg/µL).
• N_A: Avogadro’s constant (6.022 × 10²³ copies/mol).
• M: Molecular weight of the plasmid (pMD19-T + 18S rRNA insert).

2.7. Clinical Validation and Diagnostic Consistency Testing

To assess the clinical performance of the MIRA–LFD assay, a total of 150 clinical samples were obtained from five representative offshore aquaculture sites in Sanduao Bay (Dawan, Panqian, Lai Wei, Leijiang Island, and Changyao Island) located in Ningde, Fujian Province, during the period from October 2023 to December 2024. Additionally, 33 samples were collected from healthy L. crocea maintained in our laboratory. All 183 samples were subjected to parallel testing using both the gold-standard TaqMan-based quantitative PCR (qPCR) and the newly developed MIRA–LFD assay. The agreement between MIRA-LFD and qPCR was evaluated by Cohen’s kappa (κ) analysis and interpreted following the criteria of Landis and Koch (1977) [27]. The diagnostic sensitivity (DSe) and diagnostic specificity (DSp) of MIRA-LFD assay were calculated as the following equation:

$$\mathrm{O}\mathrm{v}\mathrm{e}\mathrm{r}\mathrm{a}\mathrm{l}\mathrm{l} \mathrm{A}\mathrm{g}\mathrm{r}\mathrm{e}\mathrm{e}\mathrm{m}\mathrm{e}\mathrm{n}\mathrm{t}={\displaystyle \frac{\mathrm{T}\mathrm{P}+\mathrm{T}\mathrm{N}}{\mathrm{T}\mathrm{o}\mathrm{t}\mathrm{a}\mathrm{l}}}\times 100\%$$

$$\mathrm{D}\mathrm{S}\mathrm{e}={\displaystyle \frac{\mathrm{T}\mathrm{P}}{\mathrm{T}\mathrm{P}+\mathrm{F}\mathrm{N}}}\times 100\%$$

$$\mathit{D}\mathit{S}\mathit{p}={\displaystyle \frac{\mathit{T}\mathit{N}}{\mathit{T}\mathit{N}+\mathit{F}\mathit{P}}}\times 100\%$$

• TP (True Positive): Both assays yielded positive result.
• TN (True Negative): Both assays yielded negative result.
• FN (False Negative): qPCR-positive but MIRA-LFD-negative result.
• FP (False Positive): qPCR-negative but MIRA-LFD-positive result.

3. Results

3.1. Screening of Primers and Probes for the MIRA-LFD Assay

Multiple sequence alignment of the Trypanosoma sp. 18S rRNA genes revealed that sequences from large yellow croaker isolates were identical to and shared more than 99% similarity with strains from other fish species (

Table 2. Nucleotide identity analysis of the trypanosome 18S rRNA gene.

Classify	Host	GeneBank No.	Identify (%)
Fish	Larimichthys crocea	OR934685	100.00
Fish	Larimichthys crocea	OR934688	99.05
Fish	Larimichthys crocea	OR934687	99.05
Fish	Larimichthys crocea	OR934686	98.91
Fish	Larimichthys crocea	PQ272744	98.15
Fish	Larimichthys crocea	PQ621096	98.15
Fish	Larimichthys crocea	PQ273029	98.15
Fish	Larimichthys crocea	PQ621095	98.01
Fish	Larimichthys crocea	PQ623010	97.96
Fish	Larimichthys crocea	PQ623008	97.96
Fish	Larimichthys crocea	PQ623018	97.54
Fish	Micropterus salmoides	MN831479	97.54
Fish	Pseudobagras fulvidraco	EF375883	95.33
Fish	Carassius carassius	KJ601715	95.02
Fish	Channa argus	EU185634	94.86
Fish	Abramis brama	AJ620554	94.44
Fish	Clarias angelensis	AJ620555	94.36
Fish	Melanogrammus aeglefinus	DQ016618	89.48
Amphibians	Trachycephalus venulosus	EU267074	87.26
Amphibians	Leptodactylus chaquensis	EU021225	87.26
Amphibians	Chaunus marinus	EU021230	87.21
Amphibians	Scinax hayii	EU267075	87.17
Amphibians	Aplastodiscus leucopygius	EU021234	87.17
Amphibians	Rhinella margaritifer	EU021231	87.13
Insects	Glossina pallidipes	AJ620547	88.88
Insects	Sciopemyia servulolimai	EU021241	87.33
Insects	Sciopemyia sordellii	EU021243	87.19

). Three sets of primers and probes targeting conserved regions of the 18S rRNA were designed (Figure 1). An initial combinatorial screening evaluated three forward primers, nine reverse primers, and three probes under no-template conditions to identify primer–probe sets susceptible to non-specific amplification. Reactions containing sterilized water instead of DNA were analyzed by lateral-flow readout. Only the combinations n2F1–n2R1–nP2 and n2F1–n2R3–nP2 produced no test-line coloration, indicating true negatives. Thus, n2R1–nP2 and n2R3–nP2 were identified as suitable reverse primer–probe backbones (Figure 2A). Each backbone was subsequently paired with n2F1, n2F2, or n2F3 and tested using plasmid templates (10, 1, and 0.1 fg/reaction). Amplification efficiency was assessed using 2% agarose gel electrophoresis. The combinations n2F2–n2R1–nP2 and n2F3–n2R1–nP2 produced the most intense bands and consistently detected 0.1 fg of plasmid DNA, thus identifying n2F2 and n2F3 as the optimal forward primers (Figure 2B). Consequently, four candidate sets n2F2–n2R1–nP2, n2F2–n2R3–nP2, n2F3–n2R1–nP2, and n2F3–n2R3–nP2 were further tested in eight replicate no-template controls. Only n2F3–n2R1–nP2 and n2F3–n2R3–nP2 consistently yielded negative (no test line), thereby confirming their reliability as effective primer–probe sets (Figure 2C).

3.2. Sensitivity and Specificity in the MIRA-LFD Assay

To enhance the detection performance, two candidate primer–probe sets, n2F3–n2R1–nP2 and n2F3–n2R3–nP2, were assessed using serially diluted plasmid DNA. The n2F3–n2R1–nP2 set demonstrated superior analytical sensitivity, consistently achieving a detection limit of 0.01 fg/µL (approximately 2.1 copies/µL), whereas the n2F3–n2R3–nP2 set exhibited significantly lower sensitivity under identical conditions (Figure 3A,B).

To assess the analytical sensitivity and establish the limit of detection (LOD) of the MIRA-LFD assay, a serial dilution of plasmid DNA was prepared, ranging from concentrations of 0.1 to 0.001 fg/μL. Each concentration was tested across 20 independent replicates to ensure statistical robustness. The experimental findings indicated that the MIRA-LFD assay achieved a 100% positivity rate (20/20) at concentrations of 0.1, 0.05, and 0.01 fg/μL. A notable reduction in diagnostic sensitivity was observed as the concentration decreased to 0.005 fg/μL, resulting in a positivity rate of 70% (14/20). At the lowest concentration tested, 0.001 fg/μL, the detection rate further decreased to 10% (2/20). To accurately determine the LOD with a 95% confidence interval, a probit regression analysis was conducted on the cumulative detection data. The statistical model identified the 95% LOD as 0.0095 fg/μL (approximately 0.01 fg/μL). (Figure 3C). When applied to total genomic DNA extracted from Trypanosoma-infected fish tissues, the MIRA-LFD assay maintained a robust detection threshold of 100 fg/µL, confirming its practical utility for clinical samples (Figure 3D).

The exclusivity of the finalized primer–probe set (n2F3–n2R1–nP2) was initially evaluated through in silico multiple sequence alignment. As shown in Figure 4A the primers and probe exhibited high conservation across target strains but showed significant mismatches and gaps when compared to other Trypanosoma species (T. rotatorium, T. triglae, and T. rajae) and common aquatic parasites (Lernaea cyprinacea and Ichthyobodo necator). To confirm these findings, experimental specificity validation was performed using a panel of common fish pathogens and synthetic standards of near-neighboring species. A distinct band was observed exclusively at the test line for the positive control (Trypanosoma sp.), while no cross-reactivity was detected for Cryptocaryon irritans, Miamiensis avidus, Benedenia seriolae, or Pseudograffilla sp. (Figure 4B, Lanes 3–6). Furthermore, the assay remained negative when challenged with synthetic 18S rRNA sequences from five related kinetoplastid and parasitic species, demonstrating the exceptional analytical exclusivity of the developed MIRA-LFD platform (Figure 4B, Lanes 7–11).

3.3. Optimization of DNA Extraction Conditions

To address the complexities associated with traditional DNA extraction methods, this study employed nucleic acid release reagents as an alternative. DNA was extracted from cultured Trypanosoma sp. (positive control) and Trypanosoma-positive large yellow croaker tissues using the Magnetic Universal Genomic DNA Kit and the Animal Tissue DNA Rapid Release Reagent. The extracted DNA was then evaluated using the MIRA-LFD assay. The results revealed that the nucleic acid release reagent demonstrated higher extraction efficiency, detecting parasite DNA in gill and kidney tissues (Figure 5A), whereas the magnetic bead-based kit detected DNA in the gills of only one fish (Figure 5B). Furthermore, the commercial DNA extraction method required 2 h and specialized nucleic acid equipment, while the nucleic acid release reagent method took only 5 min.

3.4. TaqMan-Based qPCR Detection Assay

The TaqMan qPCR assay was developed to detect Trypanosoma sp. through the 18S rRNA gene. To evaluate the assay’s performance, a standard curve was generated using ten-fold serial dilutions of the pMD18-Try 18S RNA plasmid, ranging from 2.1 × 10⁷ to 2.1 copies/μL, with each concentration tested in triplicate. The resulting standard curve (Figure 6A) exhibited excellent linearity, defined by the regression equation: y = –3.277x + 34.82 (where y represents the cycle threshold (Ct) value and x represents the log copy number). The assay demonstrated a high correlation coefficient (R² = 0.994) and an amplification efficiency of 101.9% (Figure 6B), both of which fall within the optimal range for diagnostic qPCR. The analytical limit of detection (LOD) for the plasmid DNA (pMD18-Try 18S RNA) was 0.1 fg/μL (≈21 copies/μL), confirming high sensitivity and quantitative accuracy.

3.5. Assessment of the MIRA Using Clinical Samples

To evaluate the diagnostic reliability of the MIRA-LFD assay, a total of 183 samples were analyzed, using qPCR as the reference standard. The MIRA-LFD assay correctly identified 141 out of 149 qPCR-positive samples and 33 out of 34 qPCR-negative samples (Supplemental Table S1). Accordingly, the MIRA-LFD assay achieved a diagnostic sensitivity (DSe) of 94.63% (95% CI: 89.65–97.66%) and diagnostic specificity (DSp) of 97.06% (95% CI: 84.67–99.93%), with an overall agreement of 95.08%. Furthermore, Cohen’s kappa coefficient (κ) was calculated to be 0.849, indicating high agreement between the two detection methods (

Table 3. Comparison of diagnostic results between MARA-LFD and qPCR for clinical samples.

Assay		qPCR			DSe	DSp	Κ Value
		Positive	Negative	Total
MIRA-LFD	Positive	141	1	142	94.63%	97.06%	0.849
	Negative	8	33	41
	Total	149	34	183

). These results demonstrate that MIRA-LFD is a highly robust and reliable alternative to qPCR for the rapid detection of trypanosoma strains circulating in L. crocea.

4. Discussion

Trypanosomiasis, caused by Trypanosoma sp., has emerged as a major parasitic disease in farmed L. crocea, resulting in high mortality and substantial economic disruption within the marine aquaculture sector. In this study, we developed a MIRA–LFD assay targeting the 18S rRNA gene, achieving an analytical LOD of 0.01 fg/µL (approximately 2.1 copies/µL) for plasmid standards. However, when testing clinical DNA extracts from fish tissues, the detection threshold shifted to 100 fg/μL. This numerical discrepancy is primarily attributed to the “host matrix effect,” where the overwhelming presence of host genomic DNA can competitively inhibit the recombinase-mediated amplification, particularly when the target parasite DNA constitutes only a minute fraction of the total extract. Consequently, the clinical LOD established here represents a more realistic and reliable benchmark for diagnostic performance in field settings.

The specificity of the MIRA-LFD assay was rigorously confirmed through both in silico analysis and experimental testing. The assay demonstrated no cross-reactivity with common co-occurring pathogens of L. crocea, such as Cryptocaryon irritans and Miamiensis avidus. Given the difficulty of obtaining physical samples of near-neighbor kinetoplastids, an in silico specificity analysis was conducted using Multiple Sequence Alignment (MAFFT). This revealed that the 3′ ends of the primers (n2F3 and n2R1) contain 4–7 mismatches against the 18S rRNA sequences of closely related species, such as Ichthyobodo necator. This sequence divergence was further confirmed by the experimental specificity validation, performed using synthetic 18S rRNA sequences from five related kinetoplastid and parasitic species, demonstrating the exceptional analytical exclusivity of the developed MIRA-LFD platform.

During clinical validation with 183 samples, the MIRA-LFD assay exhibited a diagnostic sensitivity (DSe) of 94.63% and a diagnostic specificity (DSp) of 97.06% relative to the gold-standard TaqMan qPCR. The calculated Cohen’s kappa coefficient (κ) of 0.849 indicates high agreement between the two methodologies. The few observed discrepancies, primarily involving samples with elevated Ct values (28.19–29.04), likely arise from parasite loads residing at the assay’s extreme lower limit of detection. Nonetheless, MIRA-LFD provides distinct practical advantages over traditional methodologies; it surmounts the sensitivity limitations of blood-smear microscopy during early-stage or low-intensity infections and bypasses the requirement for specialized thermocyclers and highly trained personnel necessitated by laboratory qPCR.

By integrating a 5-min rapid nucleic acid release protocol, the entire “sample-to-answer” workflow is finalized in approximately 30 min, requiring only minimal equipment (Figure 6). With an estimated cost of ¥20–30 per reaction, this platform is economically comparable to other rapid tests and significantly more cost-effective than centralized qPCR when logistics and infrastructure are considered. Consequently, the MIRA–LFD assay is ideally suited for a tiered diagnostic framework: onsite primary screening for rapid intervention, followed by qPCR for the validation of equivocal results or subsequent epidemiological surveillance. Such early detection of low-parasitemia infections is critical to accelerating intervention, reducing mortality, and mitigating economic losses in the large yellow croaker industry.

The MIRA-LFD assay offers significant practical advantages for on-site disease surveillance. Over the past few years, MIRA has evolved into a versatile diagnostic tool across clinical, veterinary, and food safety settings [28,29,30,31,32,33]. To our knowledge, this study presents the first MIRA-based assay for Trypanosoma sp. detection in aquaculture species. Despite its advantages, the MIRA-LFD assay is primarily a qualitative tool, which limits its utility in quantifying parasite loads or monitoring subtle responses to treatment. Furthermore, the high conservation of the 18S rRNA gene prioritizes pan-genus detection over species-level differentiation. Future research will focus on developing multi-target assays using more polymorphic regions, such as the internal transcribed spacer (ITS), and integrating semi-quantitative band-intensity readers to enhance the analytical depth of point-of-care testing in aquaculture.

5. Conclusions

In summary, the MIRA–LFD assay provides a rapid, sensitive, and portable method for detecting Trypanosoma sp. in L. crocea. Combining high sensitivity, straightforward operation, and rapid turnaround, it enables early diagnosis and target management. This work advances diagnostics for an emerging aquaculture pathogen and delivers a scalable, practical tool for disease surveillance, outbreak control, and the long-term sustainability of large yellow croaker farming.