Next Article in Journal
Comparative Analysis of Different Body Composition, Mucus Biochemical Indices, and Body Color in Five Strains of Larimichthys crocea
Previous Article in Journal
Age-Based Demography of Two Parrotfish and a Goatfish from Saipan, Northern Mariana Islands
Previous Article in Special Issue
Evaluation of Apparent Nutrient Digestibility of Novel and Conventional Feed Ingredients in Sobaity Seabream (Sparidentex hasta) for Sustainable Aquaculture
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 10
Issue 7
10.3390/fishes10070304
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Dietary β-Carotene on the Gonadal Color, Pigmentation, and Regulation Mechanisms in Sea Urchin Strongylocentrotus Intermedius

by
Weixiao Di
1,2,†,
Yinuo Zhang
1,2,†,
Huinan Zuo
1,2,
Haijing Liu
1,2,
Lina Wang
1,2,
Jun Ding
2,
Yaqing Chang
2 and
Rantao Zuo
1,2,*
1
Dalian Jinshiwan Laboratory, Dalian 116023, China
2
Key Laboratory of Mariculture and Stock Enhancement in North China’s Sea (Ministry of Agriculture and Rural Affairs), Dalian Ocean University, Dalian 116023, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Fishes 2025, 10(7), 304; https://doi.org/10.3390/fishes10070304
Submission received: 22 May 2025 / Revised: 16 June 2025 / Accepted: 17 June 2025 / Published: 24 June 2025
(This article belongs to the Special Issue Advances in Aquaculture Feed Additives)
Browse Figures
Versions Notes

Abstract

This study aims to clarify the dose–response relationship between dietary β-carotene levels and gonadal pigment deposition and regulation mechanisms related to the carotenoid synthesis of Strongylocentrotus intermedius based on a 60-day feeding trial and subsequent transcriptome analysis. Adult sea urchins (initial weight: 9.33 ± 0.21 g) of three cages were given one of the dry feeds with different doses of β-carotene (0 mg/kg, 150 mg/kg, 300 mg/kg) or fresh kelp (Saccharina japonica). The results indicated that the weight gain rate (WGR) of sea urchins increased with the addition of β-carotene, with that of the C300 group being markedly higher than that of the C0 group. The addition of β-carotene significantly improved the redness (a*) and yellowness (b*) values of the gonads, with sea urchins in the C300 group exhibiting closest gonad coloration to those in the kelp-fed group. Meanwhile, β-carotene and echinenone in the gonads of the C300 group showed the highest contents, reaching 1.96 μg/kg and 11.97 μg/kg, respectively. Several differential genes, enriched in the pathways of steroid biosynthesis, oxidative phosphorylation, and ubiquitination, were screened based on transcriptome analysis. Real-time PCR further demonstrated that β-carotene significantly upregulated the expression of cholesterol 25-hydroxylase (CH25H), NADH dehydrogenase subunit 1 (ND1), NADH dehydrogenase subunit 2 (ND2), and NADH dehydrogenase subunit 4 (ND4) while it downregulated the expression of 24-dehydrocholesterol reductase (DHCR24). These results showed that 300 mg/kg β-carotene significantly increased the WGR, redness, and yellowness values, as well as the contents of β-carotene and echinenone in the gonads of S. intermedius. On the one hand, dietary β-carotene increased NADH enzyme activity, which participates in echinenone synthesis by donating electrons for the transformation of β-carotene to echinenone synthesis. On the other hand, the addition of β-carotene inhibited cholesterol synthesis by increasing the expression of CH25H and decreasing the expression of DHCR24, which could in turn increase the fluidity and permeability of the cell membranes and the transport efficiency of β-carotene and echinenone from the digestive tract to the gonads. These results provided fundamental insights into the production of sea urchin gonads with market-favored colors.
Keywords:
sea urchin; carotenoids; pigmentation; gonad color
Key Contribution: This study reveals that dietary β-carotene supplementation promotes the growth of Strongylocentrotus intermedius, optimizes gonadal color, and increases the content of β-carotene and echinenone in the gonads. Through transcriptome analysis and real-time PCR, it identifies related differential genes and their expression patterns, elucidating the underlying regulatory mechanisms related to echinenone synthesis and offering insights into the production of sea urchin gonads with market-favored colors.

Graphical Abstract

1. Introduction

Sea urchin roe (gonads), highly regarded as gourmet, is particularly popular in some countries and regions, including Asia, the Mediterranean, and the Americas [1] Nevertheless, the rapidly increasing international demand for gonads has led to the overexploitation of natural populations of edible sea urchins [2]. In this context, echinoculture is regarded as an advantageous countermeasure to meet the scarcity of wild resources [3]. In 1989, Strongylocentrotus intermedius was first imported to China from Japan by our research group [4]. S. intermedius has become lucrative in northern China [5]. Sea urchins naturally live mainly on fresh macroalgae. However, the availability and nutrition of macroalgae vary at different seasons all year round, which has limited the massive use for large-scale aquaculture [6]. The gonadal color of sea urchins is an important determinant of their commercial value [7], with bright yellow and yellow-orange widely accepted as premium colors by consumers. Compared to kelp, formulated feeds usually produce sea urchins with pale gonads [1,8]. Thus, it becomes critically imperative to clarify the underlying mechanisms and develop efficient feed optimization strategies to enhance the gonadal color of sea urchins.
Sea urchin gonadal color is attributed to the accumulation of carotenoids [9]. Echinenone has proven to correlate positively with the occurrence of gonads with bright yellow and yellow-orange color [10,11,12]. Sea urchins have been reported to have the ability to synthesize echinenone by oxidizing β-carotene [11,12]. Previous studies have showed that β-carotene at an addition level of 100–250 mg/kg can effectively provide a more commercially desirable color to the gonads of sea urchin S. droebachiensis [13]. Additionally, with the advancement of high-throughput sequencing technology, a growing number of researchers are using transcriptome analysis to investigate molecular mechanisms [14]. New color-related genes were discovered by sequencing color-different aquatic animal samples and combining them with biochemical analyses [15,16,17]. Two apolipoprotein genes involved in carotenoid transport and storage were identified by the transcriptome analysis of Pacific oyster Crassostrea gigas fed different levels of β-carotene [16]. These results have significantly enhanced our understanding of pigmentation processes and their regulatory mechanisms in aquatic animals. However, from what we know, no studies have been published on the impact of dietary β-carotene on the distribution of major carotenoids and the associated mechanisms about echinenone biosynthesis in S. intermedius.
Therefore, the aims of this research are to determine (i) how β-carotene affects the distribution of major carotenoids in S. intermedius and (ii) the specific genes and pathways that participate in the echinenone biosynthesis in the gonads of S. intermedius. These results could help provide some basic clues for producing gonads with market-favored colors of S. intermedius.

2. Materials and Methods

2.1. Diet Preparation and Feeding Experiment

Kelp (Saccharina japonica) and three iso-proteinic (20.13%) and iso-lipidic (5.92%) formulated feeds were used for the feeding experiment. The formulated feeds were produced with the addition of β-carotene at different concentrations (0 mg/kg, 150 mg/kg, 300 mg/kg) (Table 1), which were named C0, C150, and C300, respectively.
All powder ingredients (<150 μm) of each feed were accurately weighed and mixed. Subsequently, the oils were blended with the mixture. After that, 30% water was added before the diets were processed into pellets using a pelletizer (DES-TS1280, Jinan, China). Feed pellets were dried, sealed, and placed in a refrigerator (−20 °C).
After acclimation to the experimental conditions, 120 healthy sea urchins (9.33 ± 0.12 g) were randomly divided among 12 floating cages (30 cm × 15 cm × 45 cm). Then, three cages of sea urchins were randomly fed one of the test diets until they showed obvious satiation thrice daily (8:00, 12:00, and 18:00) for 60 days. On average, 30% of water was replaced daily by siphoning the remaining dietary residues and excrement from the bottom of the tank. During the feeding period, the water temperature, pH, salinity, and dissolved oxygen were kept at 13 ± 1 °C, 8.0 ± 0.1, 33 ± 1‰, and above 8.0 mg/L.

2.2. Sampling

After the feeding test ended, the experimental animals were starved overnight before being counted and weighed separately to obtain the survival rate (SR) and weight gain rate (WGR). Then, sea urchins were individually dissected and sampled to obtain digestive tracts, gonads, and skeletons. The weights of the wet body mass, digestive tract, and gonads for every individual sea urchin were taken to compute the digestive tract index (DTI) and the gonadosomatic index (GSI). Subsequently, the digestive tracts of the sea urchins were preserved at −80 °C for subsequent analysis of carotenoid levels and gene expression levels. The gonads of each sea urchin were separated into four sections: one section for the histological observation; two sections for color measurement and carotenoid determination; one section for transcriptome analysis; and one section for gene expression. Finally, the skeletons of each sea urchin were comminuted into fine powder and kept at −80 °C for carotenoid determination.

2.3. Gonad Color Measurement

The gonad color was measured using a Color Cue 2 Colorimeter (PANTONE, Carlstadt, NJ, USA). ΔE denoted the distinction between the actual color value and normal color levels. The standards for ΔE1 (L* = 68.9, a* = 28.7, b* = 60.4) and ΔE2 (L* = 74.6, a* = 28.7, b* = 66.1) were reported by McBride [18].

2.4. Determination of Carotenoids

The procedures for extraction and carotenoid analysis were in line with Baião et al. [19]. The contents of β-carotene in the diets and those of echinenone in the sea urchin tissues were determined by a high-performance liquid chromatograph (HPLC) (model Agilent-1290-6470 brand Agilent) (Agilent Technologies, Santa Clara, CA, USA) and a mass spectrometer (model QQQ brand Agilent). The carotenoid extracts of 0.05 mg lyophilized samples were suspended in 0.2 mL of methanol/methyl tert-butyl ether (1:1), and 5 μL was injected into the Agilent C18 column (2.1 mm × 100 mm, 1.8 μm). Elution agents include solvent A (methanol/acetonitrile = 3:1) and solvent B (methyl tertiary-butyl ether). The 0.3 mL/min flow rate was prescribed, the column temperature was stabilized at 30 °C, and the acquisition mode was established as APCI. The mobile phase gradient ratio was 95%A + 5%B for the first 0–1 min, and then the gradient ratio was linearly changed to 5%A + 95%B for 1–3 min and maintained for 1 min. After that, the mobile phase was linearly changed to 95%A + 5%B for 4–4.5 min and held for 1.5 min. Finally, the gradient ratio was linearly changed to 70%A + 30%B for 6–9 min. The atmospheric pressure chemical ion source for mass spectrometry was set as follows: the atomization temperature of vaporization was 325 °C; the gas flow speed was 4 L/min; the pressure of the nebulizer was 20 psi; and the voltage of the capillary voltage was 4500 V. The retention time of each carotenoid was recorded by comparison with pure products of β-carotene (Tan mo, Changzhou City, Jiangsu Province, China) and echinenone (CaroteNature, Münsingen, Switzerland). The specific contents of β-carotene and echinenone were calculated by the calibration curves. The data were expressed as μg/kg dry weight.

2.5. Histological Analysis

Gonadal sections were prepared based on the methodology defined by Santos et al. [20]. To sum up briefly, the fixed tissues were subjected to ethanol treatment for the purpose of dehydration and then embedded in paraffin before being sectioned into thin slices. These sections were stained by immersion in hematoxylin and eosin. Eventually, the slices were analyzed microscopically. For the stages of gonadal maturation (stages I–VI), refer to Santos et al. [20].

2.6. RNA-Seq and Transcriptome Analyses

The Illumina Nova seq 6000 was used to sequence the gonadal transcriptomes of sea urchins of different dietary groups. Trinity was used to complete the transcriptome assembly [21]. DIAMOND was used to annotate the assembled genes based on multiple databases, such as the NCBI non-redundant (Nr) database, Swiss-Prot, KOG/COG (protein homology groups), GO (gene ontology), and Pfam (large collection of protein families) [22]. To annotate potential pathways of metabolism, each gene was aligned to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The reads generated by sequencing were aligned with the Unigene library by using Bowtie [23]. On the basis of the findings of the comparison, an expression level estimate was taken in combination with RSEM [22]. Gene sets exhibiting differential expression were identified in distinct samples using the DESeq2 software (version 1.36.0) [24]. To ascertain the differentially expressed genes (DEGs) between samples, the thresholds of multiple changes ≥ 1.5 and p < 0.01 were set.

2.7. Real-Time Quantitative PCR of Different Expression Genes

The specific description of the operations has been provided by Li et al. [25]. RNA was first extracted to meet the quality of the qPCR. A FastKing gDNA Dispelling RT SuperMix kit (TIANGEN, Beijing, China) was used for the generation of the cDNA. Finally, the cDNA templates were dissolved fivefold before being used for qPCR.
A FastReal qPCR PreMix (SYBR Green) kit (TIANGEN, Beijing, China) was used for the qPCR by following the instructions. The qPCR was accomplished with the application of the LightCycler® 96 real-time PCR system(Roche Diagnostics, Basel, Switzerland). The reaction settings were as follows: 95 °C for 120 s was set first, and then 40 cycles of 5 s at 95 °C and 15 s at 60 °C followed. The relative gene transcriptional level was computed using the formula 2−ΔΔCT. The sequences of the primers can be found in Table 2.

2.8. Calculations and Statistical Analyses

Survival rate (SR, %) = Nf/Ni × 100
Weight gain rate (WGR, %) = (FW − IW)/IW × 100
Gonadosomatic index (GSI, %) = GW/FW × 100
Digestive tract index (DTI, %) = DW/FW × 100
ΔE = SQRT[(L* − L*s)2 + (a* − a*s)2 + (b* − b*s)2].
Gene expression of transcriptome (log1P) = log(1 + FPKM)
Ni stands for the initial quantity of sea urchins, while Nf stands for the final quantity; IW and FW denote the initial and final average weight of sea urchin in every cage; GW and DW are the final wet weights of sea urchin gonads and digestive tract of every sea urchin sampled; FPKM (Fragments Per Kilobase of transcript per Million mapped reads) is the number of reads per kilobase of the length of a gene compared to a gene in a million reads [27].
The SPSS software (version 22.0) was employed to conduct the data analysis. The results were compared between the different dietary groups using one-way analysis of variance (ANOVA). Duncan’s multiple range test was conducted to assess mean differences between the diets if a significant difference was found. Independent t-tests were used to evaluate data between sexes within the identical dietary group. p < 0.05 was regarded as statistically different. The mean ± standard error of the mean (SEM) was adopted for expressing the results.

3. Results

3.1. Growth Performance

As the β-carotene addition level increased, the weight gain rate (WGR) showed an increasing tendency. The C300 group had the highest WGR, which was markedly smaller in comparison with the kelp group (p < 0.05) but considerably greater than the C0 and C150 groups (p < 0.05) (Table 3).
The digestive tract weight (DW) and digestive index (DTI) showed a “first decreasing and then increasing” tendency with an increasing β-carotene addition level, while the maximum DW was measured in the kelp group. There appeared to be no statistically remarkable differences in the DTI and GSI between experimental groups (p > 0.05) (Table 3).

3.2. Gonad Color

With the β-carotene addition level increasing, the gonadal color of sea urchins was changed from white to bright yellow or bright orange, with the most favored color observed in the C300 group. The L, ΔE1, and ΔE2 values of the gonads in both male and female sea urchins showed a decreasing trend with the increase in β-carotene addition, while those in the C300 group were markedly lower than those in the C0 group (p < 0.05). The a* and b* values of the gonads in both male and female sea urchins showed an upward trend with the increase in β-carotene addition, with those in the C300 group were markedly higher than those in the C0 group (p < 0.05). Compared to those in the dry feed groups, sea urchin gonads in the kelp group displayed more favored colors, bright yellow or bright orange (Figure 1). In the kelp group, the a* and b* values of the gonads were markedly higher than those in all of the dry feed groups (p < 0.05), while the gonadal L*, ΔE1, and ΔE2 values were markedly lower than those in the dry feed groups (Table 4).
Compared with the gonads of male sea urchins, those of most female sea urchins showed more favored colors. The gonads of female sea urchins exhibited higher a* and b* values compared to those of their male counterparts. On the contrary, the female sea urchin gonad L, ΔE1, and ΔE2 values were lower than those of the male counterparties. The different coloration of gonads between males and females was notable in the kelp group, with the gonads of females showing a markedly higher b* value but lower ΔE2 value than those of males (p < 0.05) (Table 4).

3.3. Carotenoids’ Concentration

The introduction of β-carotene significantly affected the distribution of β-carotene and echinenone in the digestive tract and gonads of sea urchins. As the amount of β-carotene added improved, the β-carotene and echinenone content in the digestive tract and gonads indicated an increasing trend. The concentrations of β-carotene and echinenone in the C300 group were substantially elevated compared to those in the C0 and C150 groups (p < 0.05), yet they were still substantially depressed in comparison to those in the kelp group (p < 0.05). Although the β-carotene and echinenone contents showed no obvious difference in the skeletons of the feed groups (p > 0.05), they were all substantially lower than those in the kelp group (p < 0.05) (Table 5, Table 6 and Table 7).

3.4. Gonad Section Observation

In the male sea urchins of the C150 group (Figure 2C), the spermatogonial layer was thin, presumably at the early stage of stage II. In contrast, the spermatogonial layers of sea urchins in the C0 group, C300 group, and kelp group (Figure 2A,E,G) were thicker and showed a trend of central migration, suggesting that they were in the mid-stage of stage II.
For the female sea urchins in the C150 group (Figure 2D), the number of oocytes was small and loosely arranged, presumably at the early stage of stage II. Conversely, sea urchins in the C0, C300, and kelp groups (Figure 2B,F,H) had a larger number of tightly packed oocytes, indicating that they were in the mid-stage of stage II (Figure 2). β-carotene addition did not notably influence the gonadal development of sea urchins. Male and female sea urchins in all diet groups were synchronized to stage II (Figure 2).

3.5. Transcriptome and Related Gene Expression

Among the three feed groups, 1949 differential expression genes (DEGs) were analyzed. A total of 214 DEGs were shared in all groups, while there were 492 and 1243 DEGs significantly expressed in the C0 vs. C150 and C0 vs. C300 groups, respectively (Figure 3). There were 706 DEGs in the C0 vs. C150 groups, which included 435 upregulated and 271 downregulated genes. There were 1457 DEGs in C0 vs. C300, which included 903 upregulated and 554 downregulated genes (Figure 4). KEGG pathway was used to annotate DEGs. The most abundant pathway was the N metabolism pathway, followed by the apelin and calcium signaling pathways. In addition, the ubiquitin-mediated protein hydrolysis-related pathway was crucially downregulated, and the ribosome-related pathway was crucially upregulated (Figure 5).
The results of the qPCR verification data on DEGs were consistent with gene expression data from the transcriptome. With increasing β-carotene supplementation, the transcription of CH25H, ND1, ND2, and ND4 genes in sea urchin gonads demonstrated a rising trend. The transcription levels of CH25H, ND2, and ND4 genes of the C300 group were analogous to the C150 group (p > 0.05) but were obviously elevated compared with the C0 group (p < 0.05). In the C300 group, the transcription level of the ND1 gene was obviously higher than that in the C0 and C150 groups (p < 0.05). The transcription of the DHCR24 gene presented a declining tendency. In the C0 group, the transcription level of the DHCR24 gene resembled that in the C150 group (p > 0.05), while it was obviously elevated compared to that in the C300 group (p < 0.05) (Figure 6).

4. Discussion

Jintasataporn and Yuangsoi [28] have highlighted that carotenoids, as sensitive organic compounds, are easily damaged by water, oxygen, and high temperatures. Baião et al. [19] further confirmed the vulnerability of carotenoids to degradation during feed processing. In this study, to minimize the loss of carotene activity, a series of measures have been adopted such as rapid mixing, low-temperature drying, sealing, and freezing storage during feed production. However, the degradation of carotenoids was not avoided based on the fact that the actual values were markedly lower than the targeted values. Therefore, the incorporation method of carotenoids should be improved in the following studies, such as microencapsulating carotenoids, adding higher contents or more potent antioxidants, and using vacuum freeze-drying methods.
In this experiment, the WGR of S. intermedius demonstrated a rising trend as the β-carotene addition level increased. Similar results have been obtained in other aquatic animals. Compared to the control diet, specific growth rate and weight gain were obviously higher in Nile tilapia Oreochromis niloticus fed a diet containing 50 mg/kg β-carotene [29]. White shrimp Litopenaeus vannamei fed β-carotene at a concentration of 300–400 mg/kg had obviously better growth performance [30]. A higher specific growth rate and weight gain were found in juvenile pacu fish Piaractus mesopotamicus fed diets supplemented with β-carotene in comparison with those fed extruded feeds without β-carotene [31]. Dietary β-carotene can improve the developmental performance of juvenile green sea urchins Strongylocentrotus droebachiensis [32] and the larvae of the sea urchin Paracentrotus lividus [33]. However, the elevation in growth performance was not observed in adult P. lividus [19]. This difference could result from the larger initial body weight (44.0 g) of the sea urchins used by Baião et al. [19]. In this study, the gonadosomatic index (GSI) and gonadal development were not affected by β-carotene addition. These results were in line with the discoveries of some earlier investigations, which found that dietary β-carotene did not impact the gonad growth and maturation of the sea urchin Lytechinus variegatus [34] and P. lividus [19,35].
Gonads with bright yellow and bright orange colors are more acceptable by consumers and thus have higher market values [5,18]. The redness (a*) and yellowness (b*) of gonads are caused by the accumulation of carotenoids and metabolism [2,11]. Since most animals are unable to produce carotenoids de novo [36], supplementing with β-carotene in the diet is an effective way to obtain carotenoids and thereby enhance the deposition of pigments in sea urchin gonads [10]. The addition of β-carotene, including both natural and artificial sources, to feed successfully has turned out to be an effective way to improve sea urchin gonadal color [10,13,37,38]. In this study, the favorable color frequency coupled with a* and b* values of the sea urchin gonads enhanced with the increasing addition of β-carotene; female sea urchins exhibited higher a* and b* values than males. Studies have demonstrated that when fed identical diets, female Paracentrotus lividus consistently achieve better coloration than males [19]. While the compositional profiles of carotenoids in the gonads of female and male Australian sea urchins and red sea urchins are similar, the carotenoid levels in ovaries are markedly higher than those in testes. During gametocyte development, carotenoids are transferred to developing eggs along with other nutrients, leading to a higher carotenoid concentration in mature oocytes compared to testes [9], a phenomenon not reported in male sea urchins. In addition, according to the unpublished research of our team, this may also be related to the decreased ability of carotenoid absorption, transportation, and metabolism caused by excessive inflammation in the digestive tract and gonads of male sea urchins. Echinenone, as the predominant carotenoid in most sea urchin gonads, is proved to be closely associated with the formation of characteristic color, especially redness [10]. Sea urchins could possess a certain capacity to synthesize echinenone from the substrate β-carotene [11,12]. In the current investigation, the concentrations of β-carotene and echinenone in the digestive tract and gonads of sea urchins were elevated with the increase in β-carotene in diets. Since the experimental feeds did not contain echinenone, the echinenone in the digestive tract and gonads could be synthesized through a series of steps, including the oxidation of β-carotene by S. intermedius.
In this study, the variation between the levels of β-carotene and β-carotene was more pronounced in the gonads, which was nearly ten times higher than that in the digestive tract. This indicated that gonad could be the main synthetic site of echinenone in sea urchins. It could also be inferred that the echinenone synthesis could be regulated by steroids because the coloration and echinenone contents of gonads are different between male and female individuals. The synthesis of β-carotene to echinenone requires hydroxylation and then ketonization [9]. However, to our knowledge, there are no reports of β-carotene hydroxylases and ketonases in sea urchins. A large proportion of β-carotene oxidases in other animals belong to the CYP450 family [39], where an electron donor is needed for catalyzing the reaction, usually NADH or NADPH. These electron donors pass electrons through specific reductases (e.g., CYP450 reductases) to the CYP450 enzymes [40]. In this process, NADH or NADPH is oxidized and the CYP450 enzyme is reduced so that it can accept the substrate and carry out the oxidation reaction. The findings of this study indicated that the expression of ND1, ND2, and ND4 demonstrated a rising trend with the increase in β-carotene. The ND1, ND2, and ND4 genes encode the core subunits of the mitochondrial respiratory chain complex I. The proteins ND1, ND2, and ND4 are subunits of the enzyme NADH dehydrogenase, which is situated in the inner membrane of the mitochondrion and is one of the five largest complexes in the electron transport chain. Their functions mainly include the initiation of NADH dehydrogenase (ubiquinone) activity, participation in mitochondrial electron transport, NADH to ubiquinone, and mitochondrial respiratory chain complex I assembly [41]. Thus, increased NADH enzyme activity provides electrons for the transformation of β-carotene to echinenone in the gonad, thereby increasing the amount of echinenone in the gonad.
Furthermore, some echinenone in the gonads was probably transported from the digestive tract, which functions as an important organ for storing lipids and lipid-soluble substances. Carotenoids are mostly lipid-soluble substances and have been reported to cross membranes mainly through diffusion with the help of specific carrier proteins and membrane fluidity [42]. This is a way for substances to pass through cell membranes that depends on specific carrier proteins in the membrane. The fluidity of the membrane allows the carrier proteins to move freely across the membrane. Cholesterol content is an important factor that is negatively correlated with the fluidity and permeability of cell membranes [43]. In this experiment, the supplementation of β-carotene increased the expression of cholesterol 25-hydroxylase (CH25H) and decreased the expression of the 24-dehydrocholesterol reductase (DHCR24). The CH25H could limit the activation of sterol-regulatory element binding protein-2 (SREBP2) and thereby reduce cellular cholesterol synthesis [44]. The DHCR24 protein is the final step of intracellular cholesterol synthesis by converting desmosterol to cholesterol [45]. Therefore, the addition of β-carotene could inhibit cholesterol synthesis by increasing the expression of CH25H and decreasing the expression of DHCR24, which in turn increases the fluidity and permeability of the cell membranes. This could increase the transport efficiency of β-carotene and echinenone from the digestive tract to the gonads. However, the cholesterol contents of cell membrane were not assayed in the present study. Future studies are needed to find more direct evidence to support our hypothesis.

5. Conclusions

In conclusion, 300 mg/kg β-carotene significantly increased the WGR, redness and yellowness values, as well as the contents of β-carotene and echinenone in the gonads of S. intermedius without affecting gonadal growth and development. Gene expression changes suggested that β-carotene enhanced gonad coloration by inhibiting cholesterol synthesis for carotenoid transport and boosting NADH dehydrogenase activity essential for echinenone production. Further exploration is required to find more evidence to elucidate the regulation mechanisms related to echinenone synthesis in sea urchins. Additionally, it is worth investigating the synergistic effects of phospholipids and antioxidants in adult sea urchins. These results provide fundamental insights for producing sea urchin gonads with market-favored colors.

Author Contributions

W.D. and R.Z. designed and performed the whole experiment. W.D., H.Z., H.L., and L.W. collected and analyzed the data. W.D., Y.Z., and R.Z. drafted the manuscript. J.D., R.Z., and Y.C. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Open Foundation of Dalian Jinshiwan Laboratory (Dljswkf202413).

Institutional Review Board Statement

The Ethics Committee of Dalian Ocean University did not require the study to be reviewed or approved because sea urchins are invertebrates.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data of this study can be provided by the corresponding author if they are requested.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
CH25Hcholesterol 25-hydroxylase
ND1NADH dehydrogenase subunit 1
ND2NADH dehydrogenase subunit 2
ND4NADH dehydrogenase subunit 4
DHCR2424-dehydrocholesterol reductase
SRsurvival rate
WGRweight gain rate
DTIdigestive tract index
GSIgonadosomatic index
HPLChigh-performance liquid chromatograph
DEGsdifferentially expressed genes
FPKMFragments Per Kilobase of transcript per Million mapped reads
ANOVAanalysis of variance
DWdigestive tract weight
DTIdigestive index
SREBP2sterol-regulatory element binding protein-2

References

  1. Di, W.; Heqiu, Y.; Gou, D.; Gong, P.; Ding, J.; Chang, Y.; Zuo, R. Effects of Supplementary Kelp Feeding on the Growth, Gonad Yield, and Nutritional and Organoleptic Quality of Subadult Sea Urchin (Strongylocentrotus intermedius) with Soya Lecithin Intake History. Aquac. Nutr. 2023, 8894923, 15. [Google Scholar] [CrossRef] [PubMed]
  2. Lourenço, S.; Raposo, A.; Cunha, B.; Pinheiro, J.; Santos, P.M.; Gomes, A.S.; Ferreira, S.; Gil, M.M.; Costa, J.L.; Pombo, A. Temporal changes in sex-specific color attributes a nd carotenoid concentration in the gonads (roe) of the purple sea urchin (Paracentrotus lividus) provided dry feeds supplemented with β-carotene. Aquaculture 2022, 560, 738608. [Google Scholar] [CrossRef]
  3. Lourenço, S.; Valente, L.M.P.; Andrade, C. Meta-analysis on nutrition studies modulating sea urchin roe growth, colour and taste. Rev. Aquacult. 2019, 11, 766–781. [Google Scholar] [CrossRef]
  4. Chang, Y.; Zhang, W.; Zhao, C.; Song, J. Estimates of heritabilities and genetic correlations for growth and gonad traits in the sea urchin Strongylocentrotus intermedius. Aquac. Res. 2012, 43, 271–280. [Google Scholar] [CrossRef]
  5. Ning, Y.; Zhang, F.; Tang, L.; Song, J.; Ding, J.; Chang, Y.; Zuo, R. Effects of dietary lipid sources on the growth, gonad development, nutritional and organoleptic quality, transcription of fatty acid synthesis related genes and antioxidant capacity during cold storage in adult sea urchin (Strongylocentrotus intermedius). Aquaculture 2022, 548, 737688. [Google Scholar] [CrossRef]
  6. Raposo, A.; Ferreira, S.; Ramos, R.; Anjos, C.; Pombo, A. Effect of three diets on the gametogenic development and fatty acid profile of Paracentrotus lividus (Lamarck, 1816) gonads. Aquac. Res. 2019, 50, 2023–2038. [Google Scholar] [CrossRef]
  7. Zhang, W.; Zhao, C.; Liu, P.; Chang, Y. First report on tube feet differential pigmentation in the cultivated sea urchin Strongylocentrotus intermedius (Agassiz, 1863) and its relationship with growth performance: Tube feet differential pigmentation in sea urchins. Aquac. Res. 2010, 41, e706–e708. [Google Scholar] [CrossRef]
  8. Onomu, A.J.; Vine, N.G.; Cyrus, M.D.; Macey, B.M.; Bolton, J.J. The effect of fresh seaweed and a formulated diet supplemented with seaweed on the growth and gonad quality of the collector sea urchin, Tripneustes gratilla, under farm conditions. Aquac. Res. 2020, 51, 4087–4102. [Google Scholar] [CrossRef]
  9. Suckling, C.C.; Kelly, M.S.; Symonds, R.C. Carotenoids in sea urchins. In Developments in Aquaculture and Fisheries Science; Elsevier: Amsterdam, The Netherlands, 2020; pp. 209–217. [Google Scholar] [CrossRef]
  10. Suckling, C.C.; Symonds, R.C.; Kelly, M.S.; Young, A.J. The effect of artificial diets on gonad colour and biomass in the edible sea urchin Psammechinus miliaris. Aquaculture 2011, 318, 335–342. [Google Scholar] [CrossRef]
  11. Symonds, R.C.; Kelly, M.S.; Caris-Veyrat, C.; Young, A.J. Carotenoids in the sea urchin Paracentrotus lividus: Occurrence of 9′-cis-echinenone as the dominant carotenoid in gonad colour determination. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2007, 148, 432–444. [Google Scholar] [CrossRef]
  12. Symonds, R.C.; Kelly, M.S.; Suckling, C.C.; Young, A.J. Carotenoids in the gonad and gut of the edible sea urchin Psammechinus miliaris. Aquaculture 2009, 288, 120–125. [Google Scholar] [CrossRef]
  13. Robinson, S.M.C.; Castell, J.D.; Kennedy, E.J. Developing suitable colour in the gonads of cultured green sea urchins (Strongylocentrotus droebachiensis). Aquaculture 2002, 206, 289–303. [Google Scholar] [CrossRef]
  14. Qiao, Y.; Zhou, L.; Qu, Y.; Lu, K.; Han, F.; Li, E. Effects of Different Dietary β-Glucan Levels on Antioxidant Capacity and Immunity, Gut Microbiota and Transcriptome Responses of White Shrimp (Litopenaeus vannamei) under Low Salinity. Antioxidants 2022, 11, 2282. [Google Scholar] [CrossRef]
  15. Ahmed, R.O.; Ali, A.; Leeds, T.; Salem, M. Fecal Microbiome Analysis Distinguishes Bacterial Taxa Biomarkers Associated with Red Fillet Color in RainbowTrout. Microorganisms 2023, 11, 2704. [Google Scholar] [CrossRef]
  16. Wan, S.; Li, Q.; Yu, H.; Liu, S.; Kong, L. Transcriptome analysis based on dietary beta-carotene supplement reveals genes potentially involved in carotenoid metabolism in Crassostrea gigas. Gene 2022, 818, 146226. [Google Scholar] [CrossRef]
  17. Wu, B.; Jiao, R.; Cui, D.; Zhao, T.; Song, J.; Zhan, Y.; Chang, Y. Integrated microRNA-mRNA analysis provides new insights into gonad coloration in the sea urchin Strongylocentrotus intermedius. Front. Mar. Sci. 2023, 10, 1247470. [Google Scholar] [CrossRef]
  18. McBride, S. Comparison of gonad quality factors: Color, hardness and resilience, of Strongylocentrotus franciscanus between sea urchins fed prepared feed or algal diets and sea urchins harvested from the Northern California fishery. Aquaculture 2004, 233, 405–422. [Google Scholar] [CrossRef]
  19. Baião, L.F.; Rocha, F.; Sá, T.; Oliveira, A.; Pintado, M.; Lima, R.C.; Cunha, L.M.; Valente, L.M.P. Sensory profiling, liking and gonad composition of sea urchin gonads fed synthetic or natural sources of β-carotene enriched diets. Aquaculture 2022, 549, 737778. [Google Scholar] [CrossRef]
  20. Santos, P.M.; Albano, P.; Raposo, A.; Ferreira, S.M.F.; Costa, J.L.; Pombo, A. The effect of temperature on somatic and gonadal development of the sea urchin Paracentrotus lividus (Lamarck, 1816). Aquaculture 2020, 528, 735487. [Google Scholar] [CrossRef]
  21. Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef]
  22. Buchfink, B.; Xie, C.; Huson, D.H. Fast and sensitive protein alignment using DIAMOND. Nat. Methods 2015, 12, 59–60. [Google Scholar] [CrossRef]
  23. Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef]
  24. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
  25. Li, M.; Gou, D.; Gong, P.; Di, W.; Wang, L.; Ding, J.; Chang, Y.; Zuo, R. An Investigation on the Effects of Dietary Vitamin E on Juvenile Sea Urchin (Strongylocentrotus intermedius): Growth, Intestinal Microbiota, Immune Response, and Related Gene Expression. Biology 2023, 12, 1523. [Google Scholar] [CrossRef]
  26. Zhang, F.; Di, W.X.; Tang, L.; Ning, Y.C.; Ding, J.; Chang, Y.Q.; Zuo, R.T. Effects of soya lecithin on the growth, gonad development, transcription of genes related with fatty acid synthesis and inflammation between sexes of sea urchin Strongylocentrotus intermedius (A. Agassiz, 1864). Aquaculture 2023, 575, 739774. [Google Scholar] [CrossRef]
  27. Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef]
  28. Jintasataporn, O.; Yuangsoi, B. Stability of carotenoid diets during feed processing and under different storage conditions. Molecules 2012, 17, 5651–5660. [Google Scholar] [CrossRef]
  29. Hassaan, M.S.; Mohammady, E.Y.; Soaudy, M.R.; Sabae, S.A.; Mahmoud, A.M.A.; El-Haroun, E.R. Comparative study on the effect of dietary β-carotene and phycocyanin extracted from Spirulina platensis on immune-oxidative stress biomarkers, genes expression and intestinal enzymes, serum biochemical in Nile tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2021, 108, 63–72. [Google Scholar] [CrossRef]
  30. Fawzy, S.; Wang, W.; Zhou, Y.; Xue, Y.; Yi, G.; Wu, M.; Huang, X. Can dietary β-carotene supplementation provide an alternative to astaxanthin on the performance of growth, pigmentation, biochemical, and immuno-physiological parameters of Litopenaeus vannamei. Aquac. Rep. 2022, 23, 101054. [Google Scholar] [CrossRef]
  31. Bacchetta, C.; Rossi, A.; Cian, R.; Drago, S.; Cazenave, J. Dietary β-carotene improves growth performance and antioxidant status of juvenile Piaractus mesopotamicus. Aquac. Nutr. 2019, 25, 761–769. [Google Scholar] [CrossRef]
  32. Kennedy, E.J.; Robinson, S.M.C.; Parsons, G.J.; Castell, J.D. Effect of Dietary Minerals and Pigment on Somatic Growth of Juvenile Green Sea Urchins, Strongylocentrotus droebachiensis. J. World Aquac. Soc. 2007, 38, 36–48. [Google Scholar] [CrossRef]
  33. Gomes, A.S.; Lourenço, S.; Santos, P.M.; Neves, M.; Adão, P.; Tecelão, C.; Pombo, A. High dietary protein, n − 3/n − 6 ratio and β-carotene enhances Paracentrotus lividus (Lamarck, 1816) larval development. Aquac. Res. 2022, 53, 5398–5412. [Google Scholar] [CrossRef]
  34. Christopher Taylor, J.; Lawrence, A.L.; Watts, S.A. Select light spectra affect gonad color in the sea urchin Lytechinus variegatus. Mar. Freshw. Behav. Physiol. 2014, 47, 415–428. [Google Scholar] [CrossRef]
  35. Shpigel, M.; Schlosser, S.C.; Ben-Amotz, A.; Lawrence, A.L.; Lawrence, J.M. Effects of dietary carotenoid on the gut and the gonad of the sea urchin Paracentrotus lividus. Aquaculture 2006, 261, 1269–1280. [Google Scholar] [CrossRef]
  36. Concepcion, M.R.; Avalos, J.; Bonet, M.L.; Boronat, A.; Gomez-Gomez, L.; Hornero-Mendez, D.; Limon, M.C.; Meléndez-Martínez, A.J.; Olmedilla-Alonso, B.; Palou, A. A global perspective on carotenoids: Metabolism, biotechnology, and benefits for nutrition and health. Prog. Lipid Res. 2018, 70, 62–93. [Google Scholar] [CrossRef]
  37. Mclaughlin, G. Effect of artificial diets containing cartenoid-rich microalgae on gonad growth and color in the sea urchin Psammechinus miliaris (Gmelin). J. Shellfish Res. 2001, 20, 377–382. [Google Scholar]
  38. Pearce, C.M.; Daggett, T.L.; Robinson, S. Effects of starch type, macroalgal meal source, and β-carotene on gonad yield and quality of the green sea urchin, Strongylocentrotus droebachiensis (Müller), fed prepared diets. J. Shellfish Res. 2003, 22, 505–519. [Google Scholar] [CrossRef]
  39. Mojib, N.; Amad, M.; Thimma, M.; Aldanondo, N.; Kumaran, M.; Irigoien, X. Carotenoid metabolic profiling and transcriptome-genome mining reveal functional equivalence among blue-pigmented copepods and appendicularia. Mol. Ecol. 2014, 23, 2740–2756. [Google Scholar] [CrossRef] [PubMed]
  40. Alagoz, Y.; Mi, J.; Balakrishna, A.; Almarwaey, L.; Al-Babili, S. Chapter Twenty-Two—Characterizing cytochrome P450 enzymes involved in plant apocarotenoid metabolism by using an engineered yeast system. In Methods in Enzymology, Carotenoids: Carotenoid and Apocarotenoid Biosynthesis Metabolic Engineering and Synthetic Biology; Wurtzel, E.T., Ed.; Academic Press: Cambridge, MA, USA, 2022; pp. 527–552. [Google Scholar] [CrossRef]
  41. Lin, X.; Zhou, Y.; Xue, L. Mitochondrial complex I subunit MT-ND1 mutations affect disease progression. Heliyon 2024, 10, e28808. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  42. von Lintig, J.; Moon, J.; Lee, J.; Ramkumar, S. Carotenoid metabolism at the intestinal barrier. Biochimica et Biophysica Acta (BBA)—Molecular and Cell Biology of Lipids. Carotenoids Recent Adv. Cell Mol. Biol. 2020, 1865, 158580. [Google Scholar] [CrossRef]
  43. Chakraborty, S.; Doktorova, M.; Molugu, T.R.; Heberle, F.A.; Scott, H.L.; Dzikovski, B.; Nagao, M.; Stingaciu, L.-R.; Standaert, R.F.; Barrera, F.N.; et al. How cholesterol stiffens unsaturated lipid membranes. Proc. Natl. Acad. Sci. USA 2020, 117, 21896–21905. [Google Scholar] [CrossRef] [PubMed]
  44. Mao, S.; Ren, J.; Xu, Y.; Lin, J.; Pan, C.; Meng, Y.; Xu, N. Studies in the antiviral molecular mechanisms of 25-hydroxycholesterol: Disturbing cholesterol homeostasis and post-translational modification of proteins. Eur. J. Pharmacol. 2022, 926, 175033. [Google Scholar] [CrossRef] [PubMed]
  45. Qi, Z.; Zhang, Y.; Yao, K.; Zhang, M.; Xu, Y.; Zhang, J.; Bai, X.; Zu, H. DHCR24 Knockdown Lead to Hyperphosphorylation of Tau at Thr181, Thr231, Ser262, Ser396, and Ser422 Sites by Membrane Lipid-Raft Dependent PP2A Signaling in SH-SY5Y Cells. Neurochem. Res. 2021, 46, 1627–1640. [Google Scholar] [CrossRef]
Fishes 10 00304 g001
Figure 1. Effects of dietary β-carotene addition on the gonad color appearance in the gonads of sea urchin (Strongylocentrotus intermedius). (A) A1~A3: gonads of male sea urchins fed C0; A4~A6: gonads of female sea urchins fed C0; (B) B1~B3: gonads of male sea urchins fed C150; B4~B6: gonads of female sea urchins fed C150; (C) C1~C3: gonads of male sea urchins fed C300; C4~C6: gonads of female sea urchins fed C300; (D) D1~D3: gonads of male sea urchins fed kelp; D4~D6: gonads of female sea urchins fed kelp.
Figure 1. Effects of dietary β-carotene addition on the gonad color appearance in the gonads of sea urchin (Strongylocentrotus intermedius). (A) A1~A3: gonads of male sea urchins fed C0; A4~A6: gonads of female sea urchins fed C0; (B) B1~B3: gonads of male sea urchins fed C150; B4~B6: gonads of female sea urchins fed C150; (C) C1~C3: gonads of male sea urchins fed C300; C4~C6: gonads of female sea urchins fed C300; (D) D1~D3: gonads of male sea urchins fed kelp; D4~D6: gonads of female sea urchins fed kelp.
Fishes 10 00304 g001
Fishes 10 00304 g002
Figure 2. Effects of dietary β-carotene addition on the gonad histology of sea urchin (Strongylocentrotus intermedius). (A) C0, male, stage II; (B) C0, female, stage II; (C) C150, male, stage II; (D) C150, female, stage II; (E) C300, male, stage II; (F) C300, female, stage II; (G) Kelp, male, stage II; (H) kelp, female, stage II. NP: nutritive phagocyte. SP: spermatocyte. EV: early vitellogenic oocyte.
Figure 2. Effects of dietary β-carotene addition on the gonad histology of sea urchin (Strongylocentrotus intermedius). (A) C0, male, stage II; (B) C0, female, stage II; (C) C150, male, stage II; (D) C150, female, stage II; (E) C300, male, stage II; (F) C300, female, stage II; (G) Kelp, male, stage II; (H) kelp, female, stage II. NP: nutritive phagocyte. SP: spermatocyte. EV: early vitellogenic oocyte.
Fishes 10 00304 g002
Fishes 10 00304 g003
Figure 3. Effects of dietary β-carotene addition on differentially expressed genes in transcriptome levels in sea urchin (Strongylocentrotus intermedius).
Figure 3. Effects of dietary β-carotene addition on differentially expressed genes in transcriptome levels in sea urchin (Strongylocentrotus intermedius).
Fishes 10 00304 g003
Fishes 10 00304 g004
Figure 4. Volcano map showing the number of upregulated and downregulated genes in C0 vs. C150 (left) and C0 vs. C300 (right). Note: The X-axis is represented by log2 (fold change), and the larger the variation, the wider the distribution; the Y-axis is represented by −log10 (p value); the green dots are used to represent downregulated genes, the red dots are used to represent upregulated genes, and the black dots are used to represent genes that do not differ significantly.
Figure 4. Volcano map showing the number of upregulated and downregulated genes in C0 vs. C150 (left) and C0 vs. C300 (right). Note: The X-axis is represented by log2 (fold change), and the larger the variation, the wider the distribution; the Y-axis is represented by −log10 (p value); the green dots are used to represent downregulated genes, the red dots are used to represent upregulated genes, and the black dots are used to represent genes that do not differ significantly.
Fishes 10 00304 g004
Fishes 10 00304 g005
Figure 5. KEGG analyses of differentially expressed genes (DEGs) in C0 vs. C150 ∩ C0 vs. C300.
Figure 5. KEGG analyses of differentially expressed genes (DEGs) in C0 vs. C150 ∩ C0 vs. C300.
Fishes 10 00304 g005
Fishes 10 00304 g006
Figure 6. Effect of dietary β-carotene addition on the related gene expression in the gonad of sea urchin (Strongylocentrotus intermedius). Mean value bars bearing with different lowercase letters are significantly different at p < 0.05 (mean ± SEM, n = 3).
Figure 6. Effect of dietary β-carotene addition on the related gene expression in the gonad of sea urchin (Strongylocentrotus intermedius). Mean value bars bearing with different lowercase letters are significantly different at p < 0.05 (mean ± SEM, n = 3).
Fishes 10 00304 g006
Table 1. Formulation and proximate composition of the experimental diets (% dry weight).
Table 1. Formulation and proximate composition of the experimental diets (% dry weight).
Ingredients (%)Formulated Feed
C0C150C300
Casein333
Soybean meal 1101010
Wheat meal 2151515
Wheat gluten 3333
wheat bran 4404040
Corn Starch18.7118.6918.68
Palm oil222
Soybean lecithin222
Choline chloride0.10.10.1
Vitamin premix 5222
Mineral premix 6222
Calcium propionate0.180.180.18
Ethoxyquin0.010.010.01
Monocalcium phosphate222
β-carotene 700.01610.0323
Proximate composition
Crude protein20.120.1320.08
Crude lipid5.955.935.92
β-carotene (mg/kg DM)
β-carotene targets0150300
β-carotene measure contention0.958.3121.2
Note: 1 Soybean meal: crude protein, 51.56%, crude lipid, 0.9% dry matter; 2 wheat meal: crude protein 13.88% dry matter, crude lipid 1.0% dry matter; 3 gluten: crude protein, 68.99%, crude lipid, 2.8% dry matter; 4 wheat bran: crude protein, 19.85%; crude lipid, 4% dry matter; 5 vitamin premix (mg or g kg−1 diet): vitamin D, 5 mg; vitamin K, 10 mg; vitamin B12, 10 mg; vitamin B6, 20 mg; folic acid, 20 mg; vitamin B1, 25 mg; vitamin A, 32 mg; vitamin B2, 45 mg; pantothenic acid, 60 mg; biotin, 60 mg; niacin acid, 200 mg; α-tocopherol, 240 mg; inositol, 800 mg; ascorbic acid, 2000 mg; microcrystalline cellulose, 16.47 g; 6 mineral premix (mg or g kg−1 diet): CuSO4·5H2O, 10 mg; Na2SeO3 (1%), 25 mg; ZnSO4·H2O, 50 mg; CoCl2·6H2O (1%), 50 mg; MnSO4·H2O,60 mg; FeSO4·H2O, 80 mg; Ca (IO3)2, 180 mg; MgSO4·7H2O, 1200 mg; zeolite, 18.35 g; 7 purchased from sigma; CAS No. 7235-40-7; the purity of β-carotene is 93%.
Table 2. Primer sequences for real-time PCR analysis.
Table 2. Primer sequences for real-time PCR analysis.
Gene NameOriginPrimer Sequences (5′→3′)
CH25HTRINITY_DN1511_c1_g1F:AGAAGGTCCGCTATTTCGTTTCCC
R:CAAGACTGGCATACAGAGGCATCC
ND1TRINITY_DN8691_c2_g1F:GCTGCCTACCCACGATTCCG
R:AGCCAAAACCGCACACAAAGC
ND2TRINITY_DN8691_c3_g1F:GAGTGCCCAATACAGCGGAAAC
R:ACACATTATTAGCCTCGCCTCTTG
ND4TRINITY_DN10351_c0_g1F:GCAGCACACATTAGAAGTCACCAG
R:CGTCTACGAGCGGAGAGGAAC
DHCR24TRINITY_DN83748_c0_g1F:CACCTTGCGTGTGGAATCTCTG
R:CTGTGGCTGTGTCCCTTTGTTC
18s[26] F:GTTCGAAGGCGATCAGATAC
R:CTGTCAATCCTCACTGTGTC
Table 3. Effects of dietary β-carotene addition on the survival and growth performance of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 3) 1.
Table 3. Effects of dietary β-carotene addition on the survival and growth performance of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 3) 1.
Formulated Feed TreatmentsKelp
C0C150C300
SR(%) 2100 ± 0.00100 ± 0.00100 ± 0.00100 ± 0.00
IW(g) 39.43 ± 0.139.41 ± 0.209.16 ± 0.049.33 ± 0.13
FW(g) 319.78 ± 0.75 b20.01 ± 0.73 b21.43 ± 0.59 b26.60 ± 0.76 a
WGR (%) 4109.70 ± 5.63 c112.57 ± 4.51 c133.87 ± 5.51 b185.19 ± 4.18 a
GW(g) 51.66 ± 0.171.64 ± 0.281.59 ± 0.061.59 ± 0.20
GSI (%) 68.35 ± 0.618.14 ± 1.157.41 ± 0.225.96 ± 0.65
DW(g) 70.76 ± 0.08 a0.62 ± 0.08 b0.76 ± 0.13 a1.06 ± 0.11 a
DTI (%) 83.85 ± 0.513.10 ± 0.273.53 ± 0.563.99 ± 0.48
1 Mean values with the different superscript letters within the same row represent significant difference at p < 0.05; 2 SR: survival rate; 3 IW: initial body weight; FW: final body weight; 4 WGR: weight gain rate; 5 GW: gonad weight; 6 GSI: gonadosomatic index; 7 DW: digestive tract weight; 8 DTI: digestive tract index.
Table 4. Effects of dietary β-carotene addition on the gonad color of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 3) 1.
Table 4. Effects of dietary β-carotene addition on the gonad color of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 3) 1.
MaleFemale
C0C150C300KelpC0C150C300Kelp
L82.21 ± 0.41 a79.10 ± 1.45 ab77.04 ± 1.40 bc73.89 ± 0.88 c79.58 ± 0.29 a*74.73 ± 2.16 ab76.56 ± 1.82 ab71.33 ± 1.27 b
a9.66 ± 0.60 c14.27 ± 1.03 bc17.10 ± 2.15 b24.76 ± 2.21 a11.75 ± 0.91 c17.59 ± 2.00 b18.47 ± 1.82 b31.29 ± 1.66 a
b32.49 ± 1.44 c39.88 ± 0.87 b43.34 ± 2.97 b52.33 ± 1.41 a33.34 ± 3.16 c40.37 ± 1.95 bc45.41 ± 1.80 b63.72 ± 1.26 a*
ΔE136.33 ± 1.40 a27.15 ± 1.47 b22.21 ± 3.83 b10.59 ± 2.08 c33.74 ± 2.89 a23.78 ± 3.03 b19.95 ± 2.21 b5.80 ± 1.00 c
ΔE239.38 ± 1.50 a30.34 ± 1.26 b25.73 ± 3.67 b14.63 ± 1.87 c37.25 ± 3.16 a28.24 ± 2.54 b23.43 ± 1.95 b5.09 ± 2.13 c*
1 Mean values with different superscript letters represent significant differences between different experimental groups of the same gender p < 0.05, and mean values with superscript “*” represent significant differences between different genders in the same experimental group p < 0.05.
Table 5. Effects of β-carotene addition on the distribution of major carotenoids in digestive tract of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 3) 1.
Table 5. Effects of β-carotene addition on the distribution of major carotenoids in digestive tract of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 3) 1.
Digestive Tract
C0C150C300Kelp
Echinenone (μg/kg)0.38 ± 0.05 c0.48 ± 0.02 c0.84 ± 0.04 b6.93 ± 0.11 a
β-carotene (μg/kg)0.34 ± 0.01 b0.40 ± 0.03 b0.51 ± 0.05 c9.25 ± 0.46 a
1 Mean values of the same tissue with different superscript letters indicate significant differences at the p < 0.05 level.
Table 6. Effects of β-carotene addition on the distribution of major carotenoids in the gonads of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 3) 1.
Table 6. Effects of β-carotene addition on the distribution of major carotenoids in the gonads of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 3) 1.
Gonad
C0C150C300Kelp
Echinenone (μg/kg)3.25 ± 0.56 c3.27 ± 0.11 c11.97 ± 2.27 b31.72 ± 1.33 a
β-carotene (μg/kg)0.38 ± 0.01 c0.52 ± 0.01 c1.96 ± 0.04 b11.12 ± 0.46 a
1 Mean values of the same tissue with different superscript letters indicate significant differences at the p < 0.05 level.
Table 7. Effects of β-carotene addition on the distribution of major carotenoids in skeleton of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 3) 1.
Table 7. Effects of β-carotene addition on the distribution of major carotenoids in skeleton of sea urchin (Strongylocentrotus intermedius) (mean ± SEM, n = 3) 1.
Skeleton
C0C150C300Kelp
Echinenone (μg/kg)0.32 ± 0.05 b0.27 ± 0.02 b0.33 ± 0.06 b6.71 ± 0.30 a
β-carotene (μg/kg)0.31 ± 0.02 b0.27 ± 0.01 b0.27 ± 0.03 b1.55 ± 0.05 a
1 Mean values of the same tissue with different superscript letters indicate significant differences at the p < 0.05 level.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Di, W.; Zhang, Y.; Zuo, H.; Liu, H.; Wang, L.; Ding, J.; Chang, Y.; Zuo, R. Effects of Dietary β-Carotene on the Gonadal Color, Pigmentation, and Regulation Mechanisms in Sea Urchin Strongylocentrotus Intermedius. Fishes 2025, 10, 304. https://doi.org/10.3390/fishes10070304

AMA Style

Di W, Zhang Y, Zuo H, Liu H, Wang L, Ding J, Chang Y, Zuo R. Effects of Dietary β-Carotene on the Gonadal Color, Pigmentation, and Regulation Mechanisms in Sea Urchin Strongylocentrotus Intermedius. Fishes. 2025; 10(7):304. https://doi.org/10.3390/fishes10070304

Chicago/Turabian Style

Di, Weixiao, Yinuo Zhang, Huinan Zuo, Haijing Liu, Lina Wang, Jun Ding, Yaqing Chang, and Rantao Zuo. 2025. "Effects of Dietary β-Carotene on the Gonadal Color, Pigmentation, and Regulation Mechanisms in Sea Urchin Strongylocentrotus Intermedius" Fishes 10, no. 7: 304. https://doi.org/10.3390/fishes10070304

APA Style

Di, W., Zhang, Y., Zuo, H., Liu, H., Wang, L., Ding, J., Chang, Y., & Zuo, R. (2025). Effects of Dietary β-Carotene on the Gonadal Color, Pigmentation, and Regulation Mechanisms in Sea Urchin Strongylocentrotus Intermedius. Fishes, 10(7), 304. https://doi.org/10.3390/fishes10070304

Article Metrics

Back to TopTop