Fasting Meets the Forecast: Thermal Conditions Influence Post-Mortem Muscle Traits in Rainbow Trout (Oncorhynchus mykiss)
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Setup
- ○
- 0D: no fasting
- ○
- 50D: 3-day fasting (65.5 ± 0.22 °C d)
- ○
- 100D: 6-day fasting (131.3 ± 0.07 °C d)
- ○
- 0D: no fasting
- ○
- 50D: 6-day fasting (58.7 ± 2.21 °C d)
- ○
- 100D: 13-day fasting (114.5 ± 1.86 °C d)
2.2. Sampling Procedures
2.3. Assay Methods
2.3.1. Muscle Glycogen and AChE Activity
2.3.2. Muscle Color Analysis
2.3.3. Rigor Mortis and pH
2.3.4. Gene Expression Analysis
2.4. Data Analysis
3. Results
3.1. Muscle Glycogen, pH, and Rigor Mortis
3.2. Acetylcholinesterase Activity
3.3. Fillet Color
3.4. Muscle Gene Expression
3.5. Correlation Analysis
4. Discussion
4.1. Muscle Glycogen, pH, and Rigor Mortis
4.2. Acetylcholinesterase Activity
4.3. Flesh Color
4.4. Muscle Gene Expression
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| a* | Redness |
| ACh | Acetylcholine |
| AChE | Acetylcholinesterase |
| b* | Yellowness |
| CAT | Catalase |
| C* | Chroma |
| °C d | Degree days |
| CIE | Commission Internationale de l’Eclairage |
| cDNA | Complementary DNA |
| DTNB | Dithiobisnitrobenzoic acid |
| EFSA | European Food Safety Authority |
| elf1 | Elongation factor 1 |
| ENO | Enolase |
| FW | Forward primer |
| GPx | Glutathione peroxidase |
| GST | Glutathione-S-transferase |
| GR1 | Glucocorticoid receptor 1 |
| h* | Hue |
| HIF1 | Hypoxia-inducible factor 1 |
| HSP70 | Heat shock protein 70 |
| HSP90 | Heat shock protein 90 |
| L* | Lightness |
| MIQE | Minimum Information for Publication of Quantitative Real-Time PCR Experiments |
| mr | Mineralocorticoid receptor gene |
| NH3 | Ammonia |
| NO2− | Nitrite |
| NO3− | Nitrate |
| O2 | Oxygen |
| RAS | Recirculating Aquaculture System |
| RNA | Ribonucleic acid |
| RM | Rigor mortis |
| ROS | Reactive oxygen species |
| RV | Reverse primer |
| rps16 | Ribosomal protein S16 |
| SOD | Superoxide dismutase |
| SEM | Standard Error of the Mean |
| sod | Superoxide dismutase |
| UPM | Polytechnic University of Madrid |
References
- Bermejo-Poza, R.; De La Fuente, J.; Pérez, C.; González De Chavarri, E.; Diaz, M.T.; Torrent, F.; Villarroel, M. Determination of optimal degree days of fasting before slaughter in rainbow trout (Oncorhynchus mykiss). Aquaculture 2017, 473, 272–277. [Google Scholar] [CrossRef] [Scilit]
- Lines, J.A.; Spence, J. Safeguarding the welfare of farmed fish at harvest. Fish Physiol. Biochem. 2012, 38, 153–162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robb, D.H.F.; Kestin, S.C.; Warriss, P.D. Muscle activity at slaughter: I. Changes in flesh colour and gaping in rainbow trout. Aquaculture 2000, 182, 261–269. [Google Scholar] [CrossRef] [Scilit]
- Regost, C.; Arzel, J.; Cardinal, M.; Laroche, M.; Kaushik, S.J. Fat deposition and flesh quality in seawater reared, triploid brown trout (Salmo trutta) as affected by dietary fat levels and starvation. Aquaculture 2001, 193, 325–345. [Google Scholar] [CrossRef] [Scilit]
- Álvarez, A.; García García, B.; Garrido, M.D.; Hernández, M.D. The influence of starvation time prior to slaughter on the quality of commercial-sized gilthead seabream (Sparus aurata) during ice storage. Aquaculture 2008, 284, 106–114. [Google Scholar] [CrossRef] [Scilit]
- Palmeri, G.; Turchini, G.M.; Marriott, P.J.; Morrison, P.; De Silva, S.S. Biometric, nutritional and sensory characteristic modifications in farmed Murray cod (Maccullochella peelii peelii) during the purging process. Aquaculture 2009, 287, 354–360. [Google Scholar] [CrossRef] [Scilit]
- Mørkøre, T.; Mazo, T.; Tahirovic, V.; Einen, O. Impact of starvation and handling stress on rigor development and quality of Atlantic salmon (Salmo salar L.). Aquaculture 2008, 277, 231–238. [Google Scholar] [CrossRef] [Scilit]
- Jentoft, S.; Aastveit, A.H.; Torjesen, P.A.; Andersen, Ø. Effects of stress on growth, cortisol and glucose levels in non-domesticated Eurasian perch (Perca fluviatilis) and domesticated rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2005, 141, 353–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pottinger, T.G.; Rand-Weaver, M.; Sumpter, J.P. Overwinter fasting and re-feeding in rainbow trout: Plasma growth hormone and cortisol levels in relation to energy mobilisation. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2003, 136, 403–417. [Google Scholar] [CrossRef] [Scilit]
- Poli, B.M.; Parisi, G.; Scappini, F.; Zampacavallo, G. Fish welfare and quality as affected by pre-slaughter and slaughter management. Aquac. Int. 2005, 13, 29–49. [Google Scholar] [CrossRef] [Scilit]
- Suárez, M.D.; García-Gallego, M.; Trenzado, C.E.; Guil-Guerrero, J.L.; Furné, M.; Domezain, A.; Alba, I.; Sanz, A. Influence of dietary lipids and culture density on rainbow trout (Oncorhynchus mykiss) flesh composition and quality parameter. Aquac. Eng. 2014, 63, 16–24. [Google Scholar] [CrossRef] [Scilit]
- Einen, O.; Waagan, B.; Thomassen, M.S. Effects on weight loss, body shape, slaughter- and fillet-yield, proximate and fatty acid composition. Aquaculture 1998, 167, 1–11. [Google Scholar]
- Grigorakis, K.; Alexis, M.N. Effects of fasting on the meat quality and fat deposition of commercial-size farmed gilthead sea bream (Sparus aurata, L.) fed different dietary regimes. Aquac. Nutr. 2005, 11, 341–344. [Google Scholar] [CrossRef] [Scilit]
- López-Luna, J.; Torrent, F.; Villarroel, M. Fasting up to 34 °C days in rainbow trout, Oncorhynchus mykiss, has little effect on flesh quality. Aquaculture 2014, 420–421, 63–70. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Wu, T.; Cai, L.; Zhu, Y. Influence of fasting on muscle composition and antioxidant defenses of market-size Sparus macrocephalus. J. Zhejiang Univ. Sci. B 2007, 8, 906–911. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- EFSA (European Food Safety Authority). Available online: www.efsa.europa.eu/ (accessed on 3 January 2025).
- Noble, C.; Gismervik, K.; Iversen, M.H.; Kolarevic, J.; Nilsson, J.; Stien, L.H.; Turnbull, J.F. Welfare Indicators for Farmed Rainbow Trout: Tools for Assessing Fish Welfare, p. 310. Available online: https://nofima.no/fishwell/trout/ (accessed on 23 April 2025).
- Bermejo-Poza, R.; De La Fuente, J.; Pérez, C.; Lauzurica, S.; De Chávarri, E.G.; Diaz, M.; Villarroel, M. Reducing the effect of pre-slaughter fasting on the stress response of rainbow trout (Oncorhynchus mykiss). Anim. Welf. 2016, 25, 339–346. [Google Scholar] [CrossRef] [Scilit]
- Bermejo-Poza, R.; Fernández-Muela, M.; De La Fuente, J.; Pérez, C.; De Chavarri, E.G.; Díaz, M.T.; Torrent, F.; Villarroel, M. Physio-metabolic response of rainbow trout during prolonged food deprivation before slaughter. Fish Physiol. Biochem. 2019, 45, 253–265. [Google Scholar] [CrossRef] [Scilit]
- Fernández-Muela, M.; Bermejo-Poza, R.; Cabezas, A.; Pérez, C.; González De Chavarri, E.; Díaz, M.T.; Torrent, F.; Villarroel, M.; De La Fuente, J. Effects of Fasting on Intermediary Metabolism Enzymes in the Liver and Muscle of Rainbow Trout. Fishes 2023, 8, 53. [Google Scholar] [CrossRef] [Scilit]
- López-Luna, J.; Vásquez, L.; Torrent, F.; Villarroel, M. Short-term fasting and welfare prior to slaughter in rainbow trout, Oncorhynchus mykiss. Aquaculture 2013, 400–401, 142–147. [Google Scholar] [CrossRef] [Scilit]
- López-Luna, J.; Bermejo-Poza, R.; Torrent Bravo, F.; Villarroel, M. Effect of degree-days of fasting stress on rainbow trout, Oncorhynchus mykiss. Aquaculture 2016, 462, 109–114. [Google Scholar] [CrossRef] [Scilit]
- Waagbø, R.; Jørgensen, S.M.; Timmerhaus, G.; Breck, O.; Olsvik, P.A. Short-term starvation at low temperature prior to harvest does not impact the health and acute stress response of adult Atlantic salmon. PeerJ 2017, 5, e3273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, J.; Li, Y.; Liu, Z.; Kang, Y.; Wang, J. Transcriptomic responses to heat stress in rainbow trout Oncorhynchus mykiss head kidney. Fish Shellfish. Immunol. 2018, 82, 32–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farrell, A.P.; Gamperl, A.K.; Hicks, J.M.T.; Shiels, H.A.; Jain, K.E. Maximum cardiac performance of rainbow trout (Oncorhynchus mykiss) at temperatures approaching their upper lethal limit. J. Exp. Biol. 1996, 199, 663–672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salazar-Duque, D.; Holguín, J.P.; Estrella, I.A.; Lomas Martínez, G. Mejoramiento de la calidad en la carne de la trucha arcoíris mediante la técnica de sacrificio Ikejime: Caso Ecuador. Cienc. Ergo Sum 2019, 26, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Dreiling, C.E.; Brown, D.E.; Casale, L.; Kelly, L. Muscle glycogen: Comparison of iodine binding and enzyme digestion assays and application to meat samples. Meat Sci. 1987, 20, 167–177. [Google Scholar] [CrossRef] [Scilit]
- Ellman, G.L.; Courtney, D.; Andres, V.J.; Featherstone, R.M. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 1961, 7, 88. [Google Scholar] [CrossRef] [Scilit]
- Commission Internationale de l’Eclairage (CIE). Recommendations on Uniform Colour Spaces Colour Difference Equations, Psychometric Colour Terms; Vol. Supplement No 2 to CIE Publication No 15. Colourimetry; Bureau Central de la CIE: Paris, France, 1978. [Google Scholar] [CrossRef] [Scilit]
- Korhonen, R.W.; Lanier, T.C.; Giesbrecht, F. An evaluation of simple methods for following rigor development in fish. J. Food Sci. 1990, 55, 346–348. [Google Scholar] [CrossRef] [Scilit]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Scilit]
- García-Meilán, I.; Tort, L.; Khansari, A.R. Rainbow trout integrated response after recovery from short-term acute hypoxia. Front. Physiol. 2022, 13, 1021927. [Google Scholar] [CrossRef] [Scilit]
- Holen, E.; Austgulen, M.H.; Espe, M. RNA from baker’s yeast cultured with and without lipopolysaccharide (LPS) modulates gene transcription in an intestinal epithelial cell model, RTgutGC from rainbow trout (Oncorhynchus mykiss). Fish Shellfish. Immunol. 2021, 119, 397–408. [Google Scholar] [CrossRef] [Scilit]
- Teles, M.; Tridico, R.; Callol, A.; Fierro-Castro, C.; Tort, L. Differential expression of the corticosteroid receptors GR1, GR2 and MR in rainbow trout organs with slow release cortisol implants. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2013, 164, 506–511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marandel, L.; Seiliez, I.; Véron, V.; Skiba-Cassy, S.; Panserat, S. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): A gene duplication trail. Physiol. Genom. 2015, 47, 253–263. [Google Scholar] [CrossRef] [Scilit]
- Ings, J.S.; Servos, M.R.; Vijayan, M.M. Hepatic transcriptomics and protein expression in rainbow trout exposed to municipal wastewater effluent. Environ. Sci. Technol. 2011, 45, 2368–2376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- West, T.G.; Brauner, C.J.; Hochachka, P.W. Muscle glucose utilization during sustained swimming in the carp (Cyprinus carpio). Am. J. Physiol.-Regul. Integr. Comp. Physiol. 1994, 267, R1226–R1234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barcellos, L.J.G.; Marqueze, A.; Trapp, M.; Quevedo, R.M.; Ferreira, D. The effects of fasting on cortisol, blood glucose and liver and muscle glycogen in adult jundiá Rhamdia quelen. Aquaculture 2010, 300, 231–236. [Google Scholar] [CrossRef] [Scilit]
- Lim, A.L.L.; Ip, Y.K. Effect of fasting on glycogen metabolism and activities of glycolytic and gluconeogenic enzymes in the mudskipper Boleophthalmus boddaerti. J. Fish Biol. 1989, 34, 349–367. [Google Scholar] [CrossRef] [Scilit]
- Navarro, I.; Gutiérrez, J.; Planas, J. Changes in plasma glucagon, insulin and tissue metabolites associated with prolonged fasting in brown trout (Salmo trutta fario) during two different seasons of the year. Comp. Biochem. Physiol. Part A Physiol. 1992, 102, 401–407. [Google Scholar] [CrossRef] [Scilit]
- Mehner, T.; Wieser, W. Energetics and metabolic correlates of starvation in juvenile perch (Perca fluviatilis). J. Fish Biol. 1994, 45, 325–333. [Google Scholar] [CrossRef]
- Black, D.; Love, R.M. The sequential mobilisation and restoration of energy reserves in tissues of Atlantic cod during starvation and refeeding. J. Comp. Physiol. B 1986, 156, 469–479. [Google Scholar] [CrossRef] [Scilit]
- Yin, L.; Chen, L.; Wang, M.; Li, H.; Yu, X. An acute increase in water temperature can decrease the swimming performance and energy utilization efficiency in rainbow trout (Oncorhynchus mykiss). Fish Physiol. Biochem. 2021, 47, 109–120. [Google Scholar] [CrossRef] [Scilit]
- Warriss, P.D. Meat Science: An Introductory Text, 2nd ed.; Cabi Publication: New York, NY, USA, 2010. [Google Scholar]
- Bermejo-Poza, R.; De La Fuente, J.; Pérez, C.; Lauzurica, S.; González, E.; Diaz, M.T.; Villarroel, M. The effect of intermittent feeding on the pre-slaughter fasting response in rainbow trout. Aquaculture 2015, 443, 24–30. [Google Scholar] [CrossRef] [Scilit]
- Newton, K.G.; Gill, C.O. The microbiology of DFD fresh meats: A review. Meat Sci. 1981, 5, 223–232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Love, R.M.; Robertson, I.; Smith, G.L.; Whittle, K.J. The texture of cod muscle. J. Texture Stud. 1974, 5, 201–212. [Google Scholar] [CrossRef] [Scilit]
- Dalle Zotte, A.; Concollato, A.; Secci, G.; Cullere, M.; Parisi, G. Rainbow trout (Oncorhynchus mykiss) farmed at two different temperatures: Post rigor mortis changes in function of the stunning method. Czech J. Anim. Sci. 2020, 65, 354–364. [Google Scholar] [CrossRef] [Scilit]
- Gregory, N.G. Animal Welfare and Meat Science; CABI Publishing: Wallingford, UK, 1998. [Google Scholar]
- Kim, H.; Park, I. Effect of prolonged starvation on the activities of malic enzyme and acetylcholinesterase in tissues of Japanese quail. Int. J. Biochem. Cell Biol. 1995, 27, 1161–1167. [Google Scholar] [CrossRef] [Scilit]
- Daskalova, A. Farmed fish welfare: Stress, post-mortem muscle metabolism, and stress-related meat quality changes. Int. Aquat. Res. 2019, 11, 113–124. [Google Scholar] [CrossRef] [Scilit]
- Suchiang, K.; Sharma, R. Dietary restriction regulates brain acetylcholinesterase in female mice as a function of age. Biogerontology 2011, 12, 581–589. [Google Scholar] [CrossRef] [Scilit]
- Miron, D.; Crestani, M.; Rosa Shettinger, M.; Maria Morsch, V.; Baldisserotto, B.; Angel Tierno, M.; Moraes, G.; Vieira, V.L.P. Effects of the herbicides clomazone, quinclorac, and metsulfuron methyl on acetylcholinesterase activity in the silver catfish (Rhamdia quelen) (Heptapteridae). Ecotoxicol. Environ. Saf. 2005, 61, 398–403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sturm, A.; Radau, T.S.; Hahn, T.; Schulz, R. Inhibition of rainbow trout acetylcholinesterase by aqueous and suspended particle-associated organophosphorous insecticides. Chemosphere 2007, 68, 605–612. [Google Scholar] [CrossRef] [Scilit]
- Beauvais, S.L.; Cole, K.J.; Atchinson, G.J.; Coffey, M. Factors affecting brain cholinesterase activity in bluegill (Lepomis macrochirus). Water Air Soil Poll. 2002, 135, 249–264. [Google Scholar] [CrossRef] [Scilit]
- Sturm, A.; Wogram, J.; Hansen, P.D.; Liess, M. Potential use of cholinesterase in monitoring low levels of organophosphates in small streams: Natural variability in three-spined stickleback (Gasterosteus aculeatus) and relation to pollution. Environ. Toxicol. Chem. 1999, 18, 194–200. [Google Scholar] [CrossRef] [Scilit]
- Baslow, M.H.; Nigrelli, R.F. The effect of thermal acclimation on brain cholinesterase activity of the killifish, Fundulus heteroclitus. Zoologica 1964, 49, 41–51. [Google Scholar] [CrossRef] [Scilit]
- Anderson, S. Salmon color and the consumer. In Microbehavior and Macroresults: Proceedings of the Tenth Biennial Conference of the International Institute of Fisheries Economics and Trade; Johnston, R.S., Shriver, A.L., Eds.; International Institute of Fisheries Economics and Trade: Corvallis, OR, USA, 2001. [Google Scholar]
- Nickell, D.; Bromage, N. Problems of Pigmentation: Lipids and Maturation; Institute of Aquaculture, University of Stirling: Stirling, UK, 1997. [Google Scholar]
- Prieto, C. Características De Calidad de la Carne De Trucha Arco Iris Oncorhynchus mykiss De Tres Granjas Piscícolas Del Estado De Chihuahua; Universidad Autónoma de Chihuahua: Chihuahua, Mexico, 1998. [Google Scholar]
- Gilchrist, A.L. Lightness and brightness. Curr. Biol. 2007, 17, R267–R269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; You, X.; Sun, W.; Xiong, G.; Shi, L.; Qiao, Y.; Wu, W.; Li, X.; Wang, J.; Ding, A.; et al. Insight into acute heat stress on meat qualities of rainbow trout (Oncorhynchus mykiss) during short-time transportation. Aquaculture 2021, 543, 737013. [Google Scholar] [CrossRef] [Scilit]
- Gatica, M.C.; Monti, G.E.; Knowles, T.G.; Gallo, C.B. Effects of crowding on blood constituents and flesh quality variables in Atlantic salmon (Salmo salar L.). Arch. Med. Vet. 2010, 42, 187–193. [Google Scholar] [CrossRef] [Scilit]
- Bosworth, B.G.; Small, B.C.; Gregory, D.; Kim, J.; Black, S.; Jerrett, A. Effects of rested-harvest using the anesthetic AQUI-STM on channel catfish, Ictalurus punctatus, physiology and fillet quality. Aquaculture 2007, 262, 302–318. [Google Scholar] [CrossRef] [Scilit]
- Erikson, U.; Misimi, E. Atlantic salmon skin and fillet color changes effected by perimortem handling stress, rigor mortis, and ice storage. J. Food Sci. 2008, 73, C50–C59. [Google Scholar] [CrossRef] [Scilit]
- Lefèvre, F.; Bugeon, J.; Aupérin, B.; Aubin, J. Rearing oxygen level and slaughter stress effects on rainbow trout flesh quality. Aquaculture 2008, 284, 81–89. [Google Scholar] [CrossRef] [Scilit]
- Marty-Mahé, P.; Loisel, P.; Fauconneau, B.; Haffray, P.; Brossard, D.; Davenel, A. Quality traits of brown trouts (Salmo trutta) cutlets described by automated color image analysis. Aquaculture 2004, 232, 225–240. [Google Scholar] [CrossRef] [Scilit]
- Einen, O.; Skrede, A. Quality characteristics in raw and smoked fillets of Atlantic salmon, Salmo salar, fed high-energy diets. Aquac. Nutr. 1998, 4, 99–108. [Google Scholar] [CrossRef] [Scilit]
- Einen, O.; Mørkøre, T.; Rørå, A.M.B.; Thomassen, M.S. Feed ration prior to slaughter a potential tool for managing product quality of Atlantic salmon (Salmo salar). Aquaculture 1999, 178, 149–169. [Google Scholar] [CrossRef] [Scilit]
- Ginés, R.; Palicio, M.; Zamorano, M.; Argüello, A.; López, J.; Afonso, J. Starvation before slaughtering as a tool to keep freshness attributes in gilthead sea bream (Sparus aurata). Aquacult. Int. 2002, 10, 379–389. [Google Scholar] [CrossRef] [Scilit]
- Teimouri, M.; Amirkolaie, A.K.; Yeganeh, S. The effects of dietary supplement of Spirulina platensis on blood carotenoid concentration and fillet color stability in rainbow trout (Oncorhynchus mykiss). Aquaculture 2013, 414, 224–228. [Google Scholar] [CrossRef] [Scilit]
- Welker, C.; de Negro, P.; Sarti, M. Green algal carotenoids and yellow pigmentation of rainbow trout. Aquac. Int. 2001, 9, 285–298. [Google Scholar] [CrossRef] [Scilit]
- Tomlinson, N.; Geiger, S.E.; Dollinger, E. Chalkiness in halibut in relation to muscle pH and protein denaturation. J. Fish. Res. Board Can. 1965, 22, 653–663. [Google Scholar] [CrossRef] [Scilit]
- Warris, P.D. Instrumental measurement of colour. In Meat Quality and Meat Packaging; ECCEAMST: Utrecht, The Netherlands, 1996; p. 221. [Google Scholar]
- Merkin, G.V.; Roth, B.; Gjerstad, C.; Dahl-Paulsen, E.; Nortvedt, R. Effect of pre-slaughter procedures on stress responses and some quality parameters in sea-farmed rainbow trout (Oncorhynchus mykiss). Aquaculture 2010, 309, 231–235. [Google Scholar] [CrossRef] [Scilit]
- Fuentes, A.; Fernández-Segovia, I.; Serra, J.A.; Barat, J.M. Comparison of wild and cultured sea bass (Dicentrarchus labrax) quality. Food Chem. 2010, 119, 1514–1518. [Google Scholar] [CrossRef] [Scilit]
- Balbuena-Pecino, S.; Riera-Heredia, N.; Vélez, E.J.; Gutiérrez, J.; Navarro, I.; Riera-Codina, M.; Capilla, E. Temperature affects musculoskeletal development and muscle lipid metabolism of gilthead sea bream (Sparus aurata). Front. Endocrinol. 2019, 10, 173. [Google Scholar] [CrossRef] [Scilit]
- Morales, A.E.; Pérez-Jiménez, A.; Hidalgo, M.C.; Abellan, E.; Cardenete, G. Oxidative stress and antioxidant defenses after prolonged starvation in Dentex dentex liver. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2004, 139, 153–161. [Google Scholar] [CrossRef] [Scilit]
- Jiang, Q.; Yan, M.; Zhao, Y.; Zhou, X.; Yin, L.; Feng, L.; Liu, Y.; Jiang, W.; Wu, P.; Wang, Y.; et al. Dietary isoleucine improved flesh quality, muscle antioxidant capacity, and muscle growth associated with AKT/TOR/S6K1 and AKT/FOXO3a signaling in hybrid bagrid catfish (Pelteobagrus vachelli♀ × Leiocassis longirostris♂). J. Anim. Sci. Biotechnol. 2021, 12, 53. [Google Scholar] [CrossRef] [Scilit]
- Vranković, J.; Stanković, M.; Marković, Z. Levels of antioxidant enzyme activities in cultured rainbow trout (Oncorhynchus mykiss) fed with different diet compositions. Bull. Eur. Assoc. Fish Pathol. 2021, 41, 135–145. [Google Scholar] [CrossRef] [Scilit]
- Yang, S.; He, K.; Yan, T.; Wu, H.; Zhou, J.; Zhao, L.; Wang, Y.; Gong, Q. Effect of starvation and refeeding on oxidative stress and antioxidant defenses in Yangtze sturgeon (Acipenser dabryanus). Fish Physiol. Biochem. 2019, 45, 987–995. [Google Scholar] [CrossRef] [Scilit]
- Ensminger, D.C.; Salvador-Pascual, A.; Arango, B.G.; Allen, K.N.; Vázquez-Medina, J.P. Fasting ameliorates oxidative stress: A review of physiological strategies across life history events in wild vertebrates. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2021, 256, 110929. [Google Scholar] [CrossRef] [Scilit]
- Bu, T.; Xu, L.; Zhu, X.; Cheng, J.; Li, Y.; Liu, L.; Bao, L.; Chu, W. Influence of short-term fasting on oxidative stress, antioxidant-related signaling molecules and autophagy in the intestine of adult Siniperca chuatsi. Aquac. Rep. 2021, 21, 100933. [Google Scholar] [CrossRef] [Scilit]
- Feng, G.; Shi, X.; Huang, X.; Zhuang, P. Oxidative stress and antioxidant defenses after long-term fasting in blood of Chinese sturgeon (Acipenser sinensis). Procedia Environ. Sci. 2011, 8, 469–475. [Google Scholar] [CrossRef] [Scilit]
- Karatas, T.; Onalan, S.; Yildirim, S. Effects of prolonged fasting on levels of metabolites, oxidative stress, immune-related gene expression, histopathology, and DNA damage in the liver and muscle tissues of rainbow trout (Oncorhynchus mykiss). Fish Physiol. Biochem. 2021, 47, 1119–1132. [Google Scholar] [CrossRef] [Scilit]
- Florescu, I.E.; Georgescu, S.E.; Dudu, A.; Balaș, M.; Voicu, S.; Grecu, I.; Dediu, L.; Dinischiotu, A.; Costache, M. Oxidative stress and antioxidant defense mechanisms in response to starvation and refeeding in the intestine of stellate sturgeon (Acipenser stellatus) juveniles from aquaculture. Animals 2021, 11, 76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sánchez-Moya, A.; Perelló-Amorós, M.; Vélez, E.J.; Viñuales, J.; García-Pérez, I.; Blasco, J.; Gutiérrez, J.; Fernández-Borràs, J. Interaction between the effects of sustained swimming activity and dietary macronutrient proportions on the redox status of gilthead sea bream juveniles (Sparus aurata). Antioxidants 2022, 11, 319. [Google Scholar] [CrossRef] [Scilit]
- Villalba, A.M.; De La Llave-Propín, Á.; De La Fuente, J.; Ruiz, N.; Pérez, C.; De Chavarri, E.G.; Díaz, M.T.; Cabezas, A.; González-Garoz, R.; Villarroel, M.; et al. Seasonal comparison of uniform pre-slaughter fasting practices on stress response in rainbow trout (Oncorhynchus mykiss). Aquaculture 2025, 596, 741750. [Google Scholar] [CrossRef] [Scilit]
- Azad, M.A.K.; Kikusato, M.; Maekawa, T.; Shirakawa, H.; Toyomizu, M. Metabolic characteristics and oxidative damage to skeletal muscle in broiler chickens exposed to chronic heat stress. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2010, 155, 401–406. [Google Scholar] [CrossRef] [Scilit]
- Faught, E.; Vijayan, M.M. The Mineralocorticoid Receptor Functions as a Key Glucose Regulator in the Skeletal Muscle of Zebrafish. Endocrinology 2022, 163, bqac149. [Google Scholar] [CrossRef] [Scilit]
- Sakamoto, T.; Yoshiki, M.; Takahashi, H.; Yoshida, M.; Ogino, Y.; Ikeuchi, T.; Nakamachi, T.; Konno, N.; Matsuda, K.; Sakamoto, H. Principal function of mineralocorticoid signaling suggested by constitutive knockout of the mineralocorticoid receptor in medaka fish. Sci. Rep. 2016, 6, 37991. [Google Scholar] [CrossRef] [Scilit]
- Gaspar, J.M.; Velloso, L.A. Hypoxia inducible factor as a central regulator of metabolism–implications for the development of obesity. Front. Neurosci. 2018, 12, 813. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soñanez-Organis, J.G.; Vázquez-Medina, J.P.; Crocker, D.E.; Ortiz, R.M. Prolonged fasting activates hypoxia inducible factors-1α, -2α, and -3α in a tissue-specific manner in northern elephant seal pups. Gene 2013, 526, 155–163. [Google Scholar] [CrossRef] [Scilit]
- Soimato, A.J.; Raberg, C.M.I.; Gassmann, M.; Sistonen, L.; Nikinmaa, M. Characterization of a hypoxia-inducible factor (HIF-1a) from rainbow trout. J. Biochem. Chem. 2001, 276, 19699–19705. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Pu, D.; Zheng, J.; Li, P.; Lü, H.; Wei, X.; Li, M.; Li, D.; Gao, L. Hypoxia-induced physiological responses in fish: From organism to tissue to molecular levels. Ecotoxicol. Environ. Saf. 2023, 267, 115609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beg, M.U.; Al-Subiai, S.; Beg, K.R.; Butt, S.A.; Al-Jandal, N.; Al-Hasan, E.; Al-Hussaini, M. Seasonal effect on heat shock proteins in fish from Kuwait bay. Bull. Environ. Contam. Toxicol. 2010, 84, 91–95. [Google Scholar] [CrossRef] [Scilit]
- Werner, I.; Viant, M.R.; Rosenblum, E.S.; Gantner, A.S.; Tjeerdema, R.S.; Johnson, M.L. Cellular responses to temperature stress in steelhead trout (Onchorynchus mykiss) parr with different rearing histories. Fish Physiol. Biochem. 2006, 32, 261–273. [Google Scholar] [CrossRef] [Scilit]
- Peng, G.; Zhao, W.; Shi, Z.; Chen, H.; Liu, Y.; Wei, J.; Gao, F. Cloning HSP70 and HSP90 genes of kaluga (Huso dauricus) and the effects of temperature and salinity stress on their gene expression. Cell Stress Chaperones 2016, 21, 349–359. [Google Scholar] [CrossRef] [Scilit]
- Jesus, T.F.; Inácio, Â.; Coelho, M.M. Different levels of hsp70 and hsc70 mRNA expression in Iberian fish exposed to distinct river conditions. Genet. Mol. Biol. 2013, 36, 61–69. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Zhang, Y.; Fu, S. Effects of short-term fasting on spontaneous activity and excess post-exercise oxygen consumption in four juvenile fish species with different foraging strategies. Biol. Open 2020, 9, bio051755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ntantali, O.; Malandrakis, E.E.; Abbink, W.; Bastiaansen, J.; Chatzoglou, E.; Karapanagiotidis, I.T.; Golomazou, E.; Panagiotaki, P. Effects of short-term intermittent fasting on growth performance, fatty acids profile, glycolysis and cholesterol synthesis gene expression in European seabass Dicentrarchus labrax. Fishes 2023, 8, 582. [Google Scholar] [CrossRef] [Scilit]




| Gene | Official Name | Sequence 5′–3′ | Accession Number | Product Length (Base Pairs (bp)) | Efficiency Muscle (%) | Reference |
|---|---|---|---|---|---|---|
| elf1a | Elongation factor 1 | FW: TGCCCCTGGACACAGAGATT | NM_ 001124339 | 172 | 109.8 | [33] |
| RV: CCCACACCACCAGCAACAA | ||||||
| rps16 | Ribosomal Protein | FW: TTTCAGGTGGCGAAACATGC | tcbk0005c.o.13_5.1.om.4 | 156 | 102.4 | [35] |
| RV: GGGGTCTGCCATTCACCTTG | ||||||
| 18s | Ribosomal protein S18 | FW: TGAGCAATAACAGGTCTGTG | XR_005034822.1 | 212 | 104.8 | [32] |
| RV: GGGCAGGGACTTAATCAA | ||||||
| cat | Catalase | FW: GCAGTGCCTTTTTGGGTTAGT | XM_021568213.2 | 175 | 96.7 | [32] |
| RV: ACCAAACCACAACTCTTCAGTG | ||||||
| sod2 | Superoxide dismutase | FW: TCCCTGACCTGACCTACGAC | XM_021612540.2 | 201 | 97.2 | [32] |
| RV: GGCCTCCTCCATTAAACCTC | ||||||
| gpx | Glutathione peroxidase | FW: ATTCCCCTCCGATGACTCCA | XM_021569971.2 | 155 | 109.4 | [32] |
| RV: TGGTCAGGAACCTTCTGCTG | ||||||
| gst | Glutathione-S-transferase | FW: TATTGTGGGCTAATGTGTAAGAT | XM_021561454.2 | 215 | 105.9 | [32] |
| RV: CCCTGAAGAGCTTTGTCG | ||||||
| eno | Enolase | FW: CAAAGGTGTCTCAAAAGCCG | XM_036988980.1 | 73 | 102.2 | [32] |
| RV: GTTGACGTTCTGCCGTACAA | ||||||
| hif1α | Hypoxia-inducible factor 1 alpha | FW: TTCTCTGTGCTCTTCTGTGCG | NM_001124288.1 | 161 | 103.4 | [32] |
| RV: TGAGTAAGGAAGCAGGGCAA | ||||||
| gr1 | Glucocorticoid receptor 1 | FW: CGCAGCAGAACCAACAGTTG | Z54210.1 | 149 | 101.9 | [34] |
| RV: ATGAGGGCGTCCAAGTACAGA | ||||||
| mr | Mineralocorticoid receptor | FW: GGCAGCGTTTGAGGAGATGA | AF209873.1 | 152 | 102.2 | [34] |
| RV: CATGGCGTCCAGTAGCTTGG | ||||||
| hsp70 | Heat shock protein 70 | FW: ATTCTGAACGTAGCAGCGGT | NM_001124228.1 | 158 | 102.6 | [32] |
| RV: GCCATCTTCTCCCTCTGTGC | ||||||
| hsp90 | Heat shock protein 90 | FW: TCCAGCAGCTGAAGGAGTT | AB196457 | 135 | 104.9 | [36] |
| RV: TGAGCTTGCAGAGGTTCTCA |
| 0D | 50D | 100D | p-Value | ||||||
|---|---|---|---|---|---|---|---|---|---|
| S | W | S | W | S | W | Se | F | Se × F | |
| Gly (mg/g) | 12.05 ± 5.19 * | 2.78 ± 0.96 | 10.32 ± 5.38 * | 2.68 ± 1.39 | 11.54 ± 5.36 * | 2.13 ± 1.49 | <0.001 | 0.442 | 0.399 |
| 0 h post-mortem | |||||||||
| RM | 29.74 ± 3.66 b | 58.89 ± 5.05 a | 24.37 ± 4.28 c | 58.63 ± 2.72 a | 25.41 ± 3.81 c | 56.24 ± 3.20 a | <0.001 | 0.003 | 0.044 |
| pH | 6.60 ± 0.10 | 6.97 ± 0.17 * | 6.70 ± 0.13 | 6.98 ± 0.16 * | 6.68 ± 0.09 | 6.98 ± 0.14 * | <0.001 | 0.098 | 0.235 |
| 24 h post-mortem | |||||||||
| RM | 42.77 ± 41.48 | 45.84 ± 40.00 | 34.69 ± 39.49 | 45.64 ± 39.74 | 54.18 ± 41.23 | 45.79 ± 39.85 | 0.767 | 0.455 | 0.464 |
| pH | 6.45 ± 0.12 | 6.55 ± 0.04 * | 6.54 ± 0.11 | 6.61 ± 0.06 * | 6.53 ± 0.09 | 6.61 ± 0.09 * | <0.001 | <0.001 | 0.585 |
| 0D | 50D | 100D | p-Value | ||||||
|---|---|---|---|---|---|---|---|---|---|
| S | W | S | W | S | W | Se | F | Se × F | |
| 0 h post-mortem | |||||||||
| L* | 39.12 ± 1.97 c | 44.36 ± 5.71 a | 39.77 ± 2.24 bc | 42.06 ± 2.11 b | 39.87 ± 1.86 bc | 41.84 ± 1.82 b | <0.001 | 0.194 | 0.005 |
| a* | 4.76 ± 1.53 a | 3.25 ± 1.54 b | 4.37 ± 2.34 ab | 4.57 ± 1.89 ab | 3.23 ± 1.54 b | 3.89 ± 1.95 b | 0.434 | 0.031 | 0.005 |
| b* | 10.06 ± 2.18 * | 9.37 ± 3.19 | 10.18 ± 2.35 * | 7.08 ± 2.67 | 7.32 ± 2.64 * | 7.32 ± 2.10 | <0.001 | 0.101 | 0.064 |
| C* | 10.36 ± 1.83 a | 11.57 ± 3.45 a | 11.22 ± 2.87 ab | 9.21 ± 2.78 b | 10.84 ± 2.95 ab | 8.47 ± 2.93 c | 0.013 | 0.045 | 0.001 |
| h* (°) | 68.15 ± 4.65 * | 58.02 ± 10.15 | 67.78 ± 7.70 * | 58.39 ± 12.55 | 68.90 ± 6.39 * | 62.13 ± 11.98 | <0.001 | 0.305 | 0.623 |
| 24 h post-mortem | |||||||||
| L* | 51.12 ± 3.65 a | 35.93 ± 2.99 c | 47.69 ± 4.26 b | 36.74 ± 2.97 c | 47.65 ± 4.77 b | 36.40 ± 2.96 c | <0.001 | 0.057 | 0.002 |
| a* | 5.82 ± 1.78 * | 3.83 ± 2.00 | 5.87 ± 1.29 * | 3.40 ± 2.08 | 6.62 ± 2.17 * | 3.51 ± 1.90 | <0.001 | 0.298 | 0.064 |
| b* | 8.42 ± 2.32 a,b | 9.41 ± 3.57 *,a | 8.02 ± 3.03 a,b | 8.46 ± 3.42 *,a,b | 6.07 ± 2.73 b | 8.68 ± 3.51 *,a | 0.006 | 0.037 | 0.173 |
| C* | 10.11 ± 3.24 | 10.32 ± 3.76 | 10.32 ± 3.36 | 9.32 ± 3.68 | 9.92 ± 4.09 | 9.57 ± 3.69 | 0.484 | 0.753 | 0.660 |
| h* | 55.94 ± 9.82 b | 67.06 ± 7.47 a | 52.14 ± 10.31 b | 67.30 ± 8.18 a | 44.04 ± 12.16 c | 66.10 ± 7.77 a | <0.001 | 0.001 | 0.007 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martínez Villalba, A.; De la Llave-Propín, Á.; De la Fuente, J.; González de Chavarri, E.; Díaz, M.T.; Fernández-Muela, M.; Cabezas, A.; González-Garoz, R.; Villarroel, M.; Bermejo-Poza, R. Fasting Meets the Forecast: Thermal Conditions Influence Post-Mortem Muscle Traits in Rainbow Trout (Oncorhynchus mykiss). Fishes 2025, 10, 267. https://doi.org/10.3390/fishes10060267
Martínez Villalba A, De la Llave-Propín Á, De la Fuente J, González de Chavarri E, Díaz MT, Fernández-Muela M, Cabezas A, González-Garoz R, Villarroel M, Bermejo-Poza R. Fasting Meets the Forecast: Thermal Conditions Influence Post-Mortem Muscle Traits in Rainbow Trout (Oncorhynchus mykiss). Fishes. 2025; 10(6):267. https://doi.org/10.3390/fishes10060267
Chicago/Turabian StyleMartínez Villalba, Andrea, Álvaro De la Llave-Propín, Jesús De la Fuente, Elisabet González de Chavarri, María Teresa Díaz, Montserrat Fernández-Muela, Almudena Cabezas, Roberto González-Garoz, Morris Villarroel, and Rubén Bermejo-Poza. 2025. "Fasting Meets the Forecast: Thermal Conditions Influence Post-Mortem Muscle Traits in Rainbow Trout (Oncorhynchus mykiss)" Fishes 10, no. 6: 267. https://doi.org/10.3390/fishes10060267
APA StyleMartínez Villalba, A., De la Llave-Propín, Á., De la Fuente, J., González de Chavarri, E., Díaz, M. T., Fernández-Muela, M., Cabezas, A., González-Garoz, R., Villarroel, M., & Bermejo-Poza, R. (2025). Fasting Meets the Forecast: Thermal Conditions Influence Post-Mortem Muscle Traits in Rainbow Trout (Oncorhynchus mykiss). Fishes, 10(6), 267. https://doi.org/10.3390/fishes10060267

