Taurine Enhances Antioxidant Enzyme Activity and Immune Response in Seriola rivoliana Juveniles After Lipopolysaccharide Injection

Abstract

Additives in fish feeds are used worldwide to provide better productivity and improve fish’s health in facing disease outbreaks. This study aimed to identify the protective effect of taurine on the immune-related parameters and antioxidant enzyme activities of Seriola rivoliana juveniles after being challenged with LPS (lipopolysaccharide). Previously, the fish were submitted to a feeding trial for 60 days with feed enriched with different doses of external taurine (0, 1%, and 2%). Juveniles fed on different doses of taurine were injected with LPS (0%, LPS+T0%; 1%, LPS+T1%; 2%, LPS+T2%), and a control group was injected with saline solution (LPS-). The immune-related mRNA expression was evaluated, as were lysozyme enzyme activity and antioxidant enzyme activities (superoxide dismutase—SOD; catalase). Regarding immune mRNA expression, all the treatments had a peak of expression at 24 h post-LPS-injection, with a sharp decrease at 72 h post-injection, reaching similar mRNA expression as at 0 h post-injection. The results showed that the LPS+T2% treatment improved the expression of il1-β, tnf-α, and tlr-3 at 24 h post-LPS injection. Antioxidant and lysozyme activities were higher in both treatments with taurine when compared to the LPS+T0% and LPS- groups after 72 h post-LPS injection. These results suggest using 2% of exogenous external taurine can improve immunocompetency and counteract the oxidative stress caused by exposure to LPS in S. rivoliana juveniles.

1. Introduction

The aquaculture sector is faced with disease outbreaks that obstruct worldwide production; hence, prioritizing health maintenance is crucial in contemporary fish farming. It is important to develop strategies to boost the immune system and the general health of fish [1,2]. In this context, the use of feed additives as a potential solution to these issues is receiving increased attention. These supplements are frequently used to improve the general well-being of aquatic organisms as immune system boosters, thus helping to prevent or manage disease outbreaks [3]. Typically, they are incorporated into the standard diet, creating functional feeds, which are characterized as diets that satisfy the basic nutritional requirements of farmed fish and enhance their survival rates, growth, and overall health status [1].

An additive gaining attention in fish feed formulations is the amino acid (AA) taurine. Taurine has been found to be a conditionally essential amino acid in fish [4,5]. In stressful situations, an adequate amount of this β-sulphonic amino acid could prevent a debilitating status, avoiding the consequences of infectious processes [6,7]. It is worth noticing that in carnivorous fish, the presence of this amino acid is important since carnivorous fish feed is naturally rich in this amino acid. In this sense, this amino acid must be added to their diet when there is a partial or complete replacement of fish meal [8], which denotes the importance of taurine for the overall health of carnivorous fish. Taurine has been shown to have beneficial effects such as reducing oxidative damage and inflammation in organisms exposed to toxic substances and stressors [1,6,9,10,11,12,13].

In different animals, evidence has shown that lipopolysaccharides (LPSs) can induce inflammation and oxidative stress [11,14,15,16,17]. LPS, or endotoxin, is a component of the outer membrane of Gram-negative bacteria; it is also known as lipoglycans and is considered an important virulence factor [18,19,20]. The recognition of LPS by the organism activates a signaling cascade [11,21,22], since it acts as a pathogen-associated molecular pattern (PAMP), promoting the biosynthesis and release of inflammatory mediators [11,23,24,25], which makes it interesting for studies to stimulate the immune system and its response [21,23,26,27]. This molecule is highly toxic in mammals and higher vertebrates, even at low doses. However, in fish, it presents lower toxicity but still can activate the immune system similarly to a bacterial infection [21,25,26,28,29].

In the last few years, our group has studied the use of feed additives and immunomodulators in longfin yellowtail (Seriola rivoliana) juveniles on their immune response [30,31,32]. The carnivorous longfin yellowtail (Carangidae), also known as hirenaga-kanpachi, is a promising candidate for diversifying global aquaculture production due to its fast growth, high-quality meat, and circumglobal distribution [33]. As a marine carnivorous fish, taurine might be important to S. rivoliana mainly in stress conditions, such as bacterial infection, and it could improve its immune status.

This study aims to determine whether including taurine in the commercial diet of juveniles of the marine fish S. rivoliana can have a protective effect on modulating their immune and antioxidant response to a challenge with LPS. For this purpose, innate and adaptive immune-related genes (il-1β, il-10, tnf-α, myd-88, tlr-3, and marco) and an immune-related enzyme (lysozyme), as well as antioxidant enzymes (superoxide dismutase and catalase), were evaluated. This is the first report on an LPS challenge in S. rivoliana juveniles fed with different doses of taurine and their effects on immunity and antioxidant enzyme activities.

2. Materials and Methods

2.1. Ethics Statement

This study adhered to the guidelines established by the European Union Council (2010/63/EU) and the Mexican Government Normativity (NOM-062—ZOO-1999) about experimental animals’ production, care, and use. Additionally, the research protocols and procedures were meticulously reviewed and approved by an internal committee at CIBNOR, in compliance with the ARRIVE guidelines [34].

2.2. Previous Nutritional Trial

Prior to the LPS challenge, a nutritional trial was performed as described in [35] with hatchery-reared juveniles provided by Kampachi Farms, La Paz, Mexico. Briefly, three diets were formulated using AQUATEC^® commercial feed (Queretaro, Mexico; protein 49%, lipids 15%, fiber 3%, ash 9.5%, humidity 12%, and N.F.E.11.5%). The basal diet was supplemented with taurine (Encapsuladoras Mexico^®; 99.9% purity (Chihuahua, Mexico)) at 0, 1, and 2% concentration (Control, T1%, and T2%, respectively) for 60 days. The final taurine concentration and the formulation of each experimental diet are available in the Supplementary Materials (Table S1). Initial and final body weight and furcal length during the nutritional trial are provided in [35]. In the present trial, the fish weighed 611 ± 62 g (control), 655 ± 88 g (T1%), and 704 ± 95 g (T2%). Regarding length, control presented 33.4 ± 1.2 cm, T1% presented 34 ± 1.9 cm, and T2% presented 37 ± 1.3 cm. During the feeding trial, fish were kept in 3000 L tanks with through flow; water temperature was kept at 24.5 ± 0.5 °C, dissolved oxygen at 7.4 ± 1.2 mg L⁻¹, salinity at 36 ± 0.7, and pH at 7.8 ± 0.2.

2.3. LPS Challenge

For LPS exposure, we followed the protocol performed in [28] with some modifications. Briefly, the exposure occurred after 60 days of the nutritional trial, during which the fish were fed with different taurine concentrations (0, 1%, and 2%). The fish were acclimatized for 48 h before the LPS challenge; then, juveniles of S. rivoliana were assigned to be challenged with LPS (Salmonella typhimurium (Sigma L—6511)—1 mg Kg⁻¹ in 1 mL saline solution). This is the first study on the use of LPS injection for this species. This dose was chosen to trigger an immune response but to avoid immunosuppression or mortality. The experimental design was randomized and conducted in triplicate. Fish (9 fish per tank) from the experimental and control groups [LPS injected = LPS+T0%, LPS+T1%, LPS+T2%; saline solution injected = control (LPS-)] were kept in ten 3000 L indoor circular fiberglass tanks (three tanks for each treatment, i.e., LPS+T0%, LPS+T1%, and LPS+T2%, and one tank for the LPS- group) with a flow through system during 72 h after intraperitoneal injection. Dissolved oxygen was kept at 7.4 ± 1.1 mg L⁻¹, water exchange was 100% day⁻¹, and temperature 24 ± 1.0 °C.

2.4. Sampling

For biochemical analysis, fish were sampled (n = 3 replicates) for skin mucus (72 h post-injection), and molecular analysis was performed for the head kidney (n = 3 replicates at each sampling time) at 0, 24 h, and 72 h post-injection. Fish were first anesthetized with clove oil (eugenol), and skin mucus was collected and preserved in PBS at −80 °C until analysis. For molecular analysis, after being anesthetized, fish were euthanized by a quick and humane medullary cut using sharp scissors. Following euthanasia, samples of the head kidney were obtained and preserved in RNAlater^® (Thermo-Fisher Scientific, Carlsbad, CA, USA) at −80 °C for further analysis.

2.5. Biochemical Analyses

For biochemical analyses, skin mucus preserved in PBS (1:2) was diluted at a final concentration of 1:10 (mucus: PBS). Then, the analyses described below were performed.

2.5.1. SOD Activity

SOD activity in the mucus was assayed in triplicate using the method described in [28]. Briefly, in an optical polystyrene cuvette, 10 µL of the sample, 10 µL of xanthine oxidase (0.025 IU mL⁻¹ Sigma, X-1875, St. Louis, MO, USA), and 1.98 mL of cocktail (phosphate buffer—50 mM pH 7.8; cytochrome C—0.012 mM (Sigma, C2506, St. Louis, MO, USA); xanthine—0.1 mM; and EDTA—0.1 mM) were added. A unit of SOD activity was determined by the percentage of inhibition of the reduction rate of cytochrome c at 550 nm by 90 s kinetics. The specific activity was expressed as U mg protein ⁻¹.

2.5.2. Catalase Activity

Catalase (CAT) activity was assayed according to [36] with some modifications. Briefly, the procedure started by mixing the mucus homogenate extract (20 μL) into a 96-well microplate with 100 μL of phosphate buffer (100 mM, pH 7.0), 30 μL of absolute methanol, and 20 μL of H₂O₂ (30%). The mixture was incubated in a shaker (120 rpm) for 20 min at room temperature. After incubation, 30 μL of KOH (10 M) was added to stop the reaction, and 30 μL of diluted 4-Amino-3-hydrazino-5-mercapto-1,2,4-triazole (Alfa Aesar, Ward Hill, MA, USA) (46 mM in 0.5 M HCl solution) reagent was added. The plate was incubated for 10 min in a rotational shaker. Finally, 10 μL of KIO₄ was added, and the plate was incubated for 5 min in a shaker at room temperature. Absorbance was read at 540 nm. The formaldehyde formation in each sample was calculated using a formaldehyde standard curve (Equation (1)). CAT activity was calculated using the equation below and was expressed as units mg protein ⁻¹ (Equation (2)):

$$Formaldehyde \left(\mu \mathrm{M}\right)=\left[{\displaystyle \frac{Sample absorbance-(y-intercept)}{slope}}\right]\times {\displaystyle \frac{0.17 \mathrm{m}\mathrm{L}}{0.02 \mathrm{m}\mathrm{L}}}$$

(1)

CAT activity = (μM formaldehyde)/(20 min) × sample dilution = nmol/min/mL

(2)

2.5.3. Lysozyme Activity

Based on a modification of the method in [37], on a flat-bottomed 96-well microtiter plate, 100 µL of 0.4 mg mL⁻¹ Micrococcus lysodeikticus (Sigma-Aldrich, St. Louis, MI, USA) in 0.05 M phosphate buffer (pH 5.2) was added to 100 µL of supernatant (1:10 dilution). A kinetics curve was performed at 450 nm with reads every 2 min for 60 min. For the positive control, the supernatant was replaced by 2 μg mL⁻¹ Hen Egg White lysozyme (Sigma L-7001). The supernatant was replaced by a phosphate buffer for the negative control. A unit of lysozyme activity was defined as the amount of supernatant causing a decrease in absorbance of 0.001 units per minute [37].

2.5.4. Protein Determination

The soluble protein content was determined in the supernatant as described by [38]; briefly, 10 µL of homogenate was mixed with 200 µL Bio-Rad Protein assay dye reagent (BioRad 500-0205, Hercules, CA, USA). Samples were assayed in triplicate in a 96-well plate and read at 595 nm. To calculate the amount of protein in sample, a standard curve was previously performed with bovine serum albumin (BSA, A7906; Sigma-Aldrich, Madrid, Spain).

2.6. Molecular Analysis

2.6.1. RNA Extraction

To analyze the immune-related mRNA expression, total RNA was extracted from the fish head kidney. The samples were homogenized using a FastPrep™ system (Thermo-Fisher Scientific, Carlsbad, CA, USA) with silica pearls at 5 s per minute for 30 s in 1000 µL of Trizol Reagent (Invitrogen, Carlsbad, CA, USA). After homogenization, the procedure for RNA isolation was performed following the manufacturer’s instructions.

The determination of RNA quality and quantity was carried out in a Nanodrop spectrophotometer (Thermo-Fisher Scientific, Carlsbad, CA, USA) and by agarose electrophoresis (1.5%) with Sybr Safe DNA Gel Stain (Invitrogen, Paisley, UK).

2.6.2. DNase Treatment

To guarantee the elimination of genomic DNA, a DNase treatment was performed (RQ1 RNase-Free DNase; M6101; Promega, WI, USA). For each 1 μg of RNA, a mix of 1 μL of buffer 10X, 1 μL of DNase, and DEPC water was made to obtain a total of 10 μL, which was then incubated at 37 °C for 30 min, followed by adding 1 μL DNase Stop Solution and incubating at 65 °C for 10 min.

2.6.3. cDNA Synthesis

To generate complementary DNA by the Reverse Transcription System (ImProm-II™, A3800; Promega, WI, USA), 1 μL of oligo-dT was mixed with 2 μg of total RNA and then incubated at 70 °C for 10 min with a mix of 1 μL dNTP (10 mM), 2.4 μL 25 mM MgCl₂, 4 μL 5X reaction buffer, 2 µL ribonuclease inhibitor (RNasin^®, Madison, WI, USA), 1 μL reverse transcriptase, and 5.6 μL nuclease-free water. The protocol for reverse transcription was as follows: 25 °C for 5 min, 42 °C for 60 min, and 70 °C for 15 min. The cDNA was stored at −20 °C until further qPCR analyses.

2.6.4. RT-qPCR

Relative mRNA expression was quantified using RT-qPCR on a CFX96 Touch™ Real-Time Thermal Cycler CFX96 (Bio-Rad). Each well contained 10 μL reaction mixture comprising 5 μL SsoAdvanced™ Universal SYBR^® Green Supermix (Bio-Rad), 2.0 μL cDNA, and 0.1 μL primers as listed in

Table 1. Oligonucleotide primers for the qPCR analysis of target genes of Seriola rivoliana juveniles.

Gene	Function	Primer Sequences (5′-3′)	Amplicon Size (bp)
marco	Scavenger receptor	Fw: GACTCAGTGGACAACGTGG Rv: GTCTCCTTTGTCTCCTTTG	220
il-10	Anti-inflammatory cytokine	Fw: ACAGTGGTATCAGGGATCCTCA Rv: CCGACTGTGTAGGGTATGACTG	155
il-1β	Proinflammatory cytokine	Fw: AGCCAGCAGAGACACTTAG Rv: TGGGTAAAGGTGGCAAGTAG3	124
tnf-α	Proinflammatory cytokine	Fw: TTCATGCCTCTTAGCCACAGG Rv: CTCCGTCCGTCTCTGTAACTG	131
myd-88	Signaling molecule stimulator	Fw: ATGAAGCGACGAAAAACCCC Rv: AAGACTGAAGATCCTCCACAATGTC	135
tlr3	Pattern recognition receptor	Fw: CAAATGTTACCAGATTGCCAAACC Rv: TTACCATCAGCATCGGGACAAC	168
18s	18S Ribosomal RNA (reference gene)	Fw: CTGAACTGGGGCCATGATTAAGAG Rv: GGTATCTGATCGTCGTCGAACCTC	165

. The run protocol was performed according to the manufacturer’s specifications: (1) 95 °C, 30 s; (2) 95 °C, 5 s; (3) 60 °C, 15 s; (4) melt curve 65 °C to 95 °C, increasing by 0.5 °C for 5 s. Steps 2 and 3 were repeated 40 times. Primer design was based on the S. rivoliana transcriptome (BioProject: PRJNA756687), with each primer sequence evaluated using OligoCalc—Oligonucleotide Properties Calculator (http://oligocalc.eu/, accesses on 12 March 2025). All primers were designed to be amplified at 60 °C, with efficiency ranging from 100 to 105.9%. Target mRNA expression was determined by the 2^−ΔΔCT method, as outlined by [39], with normalization to the 18S reference gene and the control group, which was assigned an expression value of 1.

2.7. Statistical Analysis

Molecular and biochemical analyses were performed in triplicate for each sample and are shown as mean ± standard error (SE). For biochemical analysis, as well as for the differences between treatments for each time point in the molecular analysis, a one-way analysis of variance was performed. A two-way analysis of variance (ANOVA) was performed for molecular analysis, with treatment and time as independent variables. The Shapiro–Wilk test for normality and Levene’s test for homoscedasticity were previously performed (logarithmic transformation was performed when the data did not fit normality); then, Tukey’s post hoc test was carried out to determine the differences between the groups (p < 0.05). The statistical analysis and plot were performed using the software SPSS Version 29 (Armonk, NY, USA).

3. Results

Experimental fish did not show mortality after LPS administration, nor at the end of the experiment.

3.1. Enzyme Activity

The data presented in Figure 1A show the high activity of SOD in the LPS+T1% and LPS+T2% treatments when compared with LPS+T0% and LPS-; no statistical differences were observed between LPS+T1% and LPST2%. When compared with LPS-, the LPS+T0% treatment shows a higher activity of SOD in mucus at 72 h post-injection. Figure 1B shows the highest activity of catalase in the LPS+T2% group, followed by the LPS+T1% treatment. No differences between LPS- and LPS+T0%, related to catalase activity, were detected.

Regarding lysozyme activity, LPS+T1% and LPS+T2% presented higher values, which were statistically different from LPS+T0% and LPS-. No differences in lysozyme activity were observed between LPS+T0% and LPS- (Figure 2).

3.2. Immune System Gene Expression

Significant upregulation of the time–treatment interaction of all immune-related genes evaluated in this study was observed at 24 h post-LPS injection when compared to 0 h and 72 h post-injection (p < 0.05), and no differences in the time–treatment interaction of all immune-related genes were observed between 0 and 72 h post-injection. Regarding the il-1β gene, at the onset of the trial, fish that were given a control diet (LPS-) and LPS+T1% exhibited a higher expression of this gene compared to the LPS+T2% group; at 24 h, a significant upregulation was observed in the LPS+T2% treatment when compared to LPS+T0% (p < 0.05) and LPS+T1% (p < 0.05) in the same period (Figure 3A). There were no differences between the treatments at the end of the trial, and the values did not differ from the beginning (p > 0.05). The tnf-α gene was overexpressed at the beginning of the trial in the control group when compared with LPS+T1% and LPS+T2%; however, at 24 h post-injection, it presented a significant difference between the LPS+T2% and LPS+T0%. In the former treatment, this gene was overexpressed; no differences were found between time 0 and 72 h post-injection (Figure 3B). For the tlr-3 gene, upregulation was observed in control group prior to LPS injection (0 h) when compared to the LPS+T1% and LPS+T2% groups, whereas at 24 h post-injection, upregulation was observed in LPS+T2% when compared to LPS+ and LPS+T1%. At 72 h post-injection, no differences were observed between the treatments (Figure 4A).

Regarding the marco gene, at 0 h, LPS+T2% showed upregulation compared to the other groups in the same period. At 72 h post-injection, upregulation was observed in the LPS+T0% group when compared to the different treatments (p < 0.05). No differences were observed for this gene at 24 h (Figure 4B).

No differences between the treatments in each period were observed for the myd-88 gene (p > 0.05) (Figure 5A).

Upregulation of il-10 was observed at the beginning of the trial in the control group compared to the other groups. At 72 h post-injection, LPS+T0% presented upregulation compared to the LPS+T1% group. No differences were observed between the treatments at 24 h post-injection (Figure 5B).

During the trial, the expression of all the measured genes in the different treatments showed the same pattern. At 0 h, low gene expression was observed; then, a peak in expression was observed at 24 h, followed by a drop at 72 h, which presented no differences compared to 0 h.

4. Discussion

Due to the environment in which they are kept, cultivated fish are highly susceptible to bacterial infections, which makes producers increasingly seek solutions to these problems through the use of immunostimulants. In this sense, there is evidence that the use of taurine can provide an immunomodulatory and antioxidant effect, capable of improving animal health and welfare [40,41]. The antioxidant properties of taurine in fish have been confirmed by several studies [13,40,41,42], and its antioxidant capacity could be associated with an increase in the antioxidant enzymes activities [11,24]. S. rivoliana juveniles were fed with different amounts of exogenous taurine (0, 1, and 2%) for 8 weeks and then exposed to an LPS challenge for 72 h. Regarding the antioxidant enzymes (SOD and CAT), we observed that juveniles from the LPS+T1% and LPS+T2% groups showed a significantly enhanced activity after the challenge. Similarly to our research, ref. [13] found that Monopterus albus fed with different taurine doses during an 8-week feeding trial showed higher SOD and CAT when challenged with H₂O₂ when compared with the control-fed group. In other fish species, in ammonia-challenged hybrid snakehead Channa maculatus♀ × Channa argus♂ [43] and low-temperature-stressed Takifugu obscurus [44], taurine showed an antioxidant effect, improving antioxidant enzyme activity. In studies [14,15] using taurine-rich Paroctopus dofleini and mussel water extracts, the authors found a reduction in ROS in the embryos and larvae of the zebrafish Danio rerio exposed to an LPS challenge when compared to a control group (no extract). In terrestrial animals, the effects of taurine administration are similar to our findings; rats and broiler chickens fed a diet with taurine presented an improvement in their antioxidant capacity when challenged with LPS, with increased SOD and CAT activity [11,24].

LPS can induce reactive oxygen species (ROS) production in organisms due to its pro-oxidative action [24]. In the present study, it has been shown that taurine can alleviate this process by increasing antioxidant activities after the LPS challenge when compared to the LPS+T0% group. It is worth mentioning that, because of its biochemical composition, LPS mimics a Gram-negative bacterial infection, so the host immune-related system can detect it and then initiate a cascade of responses.

When a pathogen invades an organism, the PPRs (pattern recognition receptors) are activated, generating a cascade of immune responses by the host, which includes an increase in lysozyme production, which aids in the elimination of the pathogen by hydrolyzing the ß-linked glycosidic bonds in the bacterial cell wall peptidoglycans [26]. Higher doses of taurine in this study were as effective as an immunostimulant, increasing mucus lysozyme activity in juveniles challenged with LPS compared to the LPS+T0% and LPS- groups. Similarly to our findings, ref. [41] reported an increase in mucosal lysozyme when Acanthopagrus latus was fed with a taurine-rich diet (≥1.25%). The same was observed in Pelteobagrus fulvidraco fed with higher levels of taurine (1.6, 2.13, and 2.55%), with values of lysozyme activity increasing with increasing dietary taurine levels [45]. A related species from the same family, the golden pompano (Trachinotus ovatus), exhibited a similar response when given higher levels of taurine in their diet, resulting in increased lysozyme activity [46]. There seems to be a positive correlation between diet taurine level and lysozyme activity; however, further research on this topic must be performed to standardize the amounts, way of administration, or delivery of taurine. When it comes to an LPS challenge, this correlation seems to be the opposite. Some studies have demonstrated that when organisms are exposed to different doses of LPS, lysozyme activity decreases when compared to the control group (no LPS injection) [21,22,23,25,26], which could indicate an immune depression status of the organism; however, this seems to depend on the dose and tissue evaluated and to be species-specific. In our study, no differences in mucus lysozyme activity were found between LPS- and LPS+T0%, which may indicate that even though LPS promoted a host immune response, the dose of LPS was not sufficiently high to trigger a decrease in lysozyme activity. The immune system in fish is predominantly influenced by humoral factors, including lysozyme. This enzyme in bodily fluids is a reliable indicator of fish health, crucial for innate immunity by combating microbes and enhancing immune cell phagocytosis [23,25,47,48]. The improvement in lysozyme activity associated with other immune parameters suggests that taurine can positively stimulate the fish’s immune response, which could, potentially, enhance their ability to fight bacterial infections. In addition, we also observed mRNA upregulation of immune-related genes such as tlr-3, il-1β, and tnf-α 24 h post-injection.

In this study, Toll-like receptor (tlr-3) upregulation may indicate an attempt by the organism to restore proper balance in its immune system. tlr-3 can amplify the immune response by promoting the release of proinflammatory cytokines and activating other immune components. It is worth mentioning that tlr-3 is mainly associated with virus or poly I: C challenge [49,50,51,52]; however, in some fish, evidence shows that tlr-3 has a response after bacterial challenge. In this sense, ref. [51] found the upregulation of tlr-3 in Lateolabrax japonicus after bacterial challenge with Vibrio harveyi and Streptococcus agalactiae. Another study [53] demonstrated the upregulation of tlr-3 in the head kidney of yellow catfish (Pelteobagrus fulvidraco) following exposure to Aeromonas hydrophila, a Gram-negative bacterium. The authors evaluated nine tlrs genes, including tlr-3, at different times of exposure (0, 6, 12, 24, 28, and 72 h), and interestingly, similarly to what was found in our study, high fold-change was observed at 6, 12, and 24 h, decreasing drastically afterward [53]. We observed an upregulation at 24 h, with a prominent decrease at 72 h, which led us to infer that this gene participates actively in the recognition of bacteria, as well as LPS, as a PAMP and that it might induce inflammatory responses in fish.

Il-1β and tnf-α play pivotal roles as essential molecules within the innate immune response against bacterial intrusion while also serving to induce the secretion of fundamental cytokines that activate the effector functions of macrophages and lymphocytes [48]. The upregulation of both cytokines il-1β and tnf-α was observed in this study at 24 h after LPS injection, with significant differences in LPS+T2% when compared to the other treatments, demonstrating its potential immunostimulant effect. This enhanced immune response is a key feature of trained immunity, where the innate immune cells exhibit a memory-like response to subsequent challenges with pathogens or PAMPs [16]. Regarding the effect of taurine on mRNA expression after an LPS challenge, ref. [12] found that before a stress period of transition from fresh- to seawater, using an amino acid-rich diet (DL-Methionine, L-Lysine, L-Threonine, and taurine) benefits the leukocyte immune responses induced by LPS, increasing il-1β gene expression. The authors suggest that a diet containing those amino acids could increase the defense of the fish against bacterial and viral infection in this vulnerable transition period [12]. Contrary to our findings, ref. [13] found that taurine could inhibit the upregulation of il-1β and tlr-3 when Monopterus albus juveniles were challenged with H₂O₂; however, an upregulation of il-10 was observed in taurine treatment. In our study, the mechanism of defense after 24 h LPS injection triggered a proinflammatory response, with no difference between treatments in terms of the anti-inflammatory il-10 response, which could indicate a balance among proinflammatory and anti-inflammatory responses; in certain pathologies, the anti-inflammatory response may be insufficient to counteract inflammatory activity or, conversely, it may be excessively pronounced, leading to immunosuppression and an increased susceptibility to infection [54].

Inflammation can help to regulate the immune response, ensuring that it is properly activated to fight the infection or injury and deactivated once the problem is resolved. In the present study, this could be observed at 72 h, when the inflammatory mRNA expression decreased to the basal level, with similar values to those found at 0 h post-injection; this proinflammatory upregulation of tlr-3, il1-b, and tnf-a in LPS+T2% could indicate a better immune stimulation in the LPS+T2% group. In this sense, a study performed with LPS-challenged goats showed that the use of β-glucan as an immunostimulant increased the expression of il-1β and tnf-α when compared to the control group. The authors suggest that the increased production of il-1β and tnf-α reflects the activation of immune signaling pathways and the priming of the immune system to respond effectively to the challenge posed by the pathogen [16,55].

5. Conclusions

In conclusion, our findings suggest that supplementation with taurine has the potential to improve the immunological capabilities of juvenile S. rivoliana, thereby enabling them to initiate an efficient immune response against an immune challenge. The assessment of antioxidant enzymes and lysozyme activity, accompanied by other immune parameters, helped us to understand how taurine influenced immune function in S. rivoliana juveniles and contributed to their avoiding oxidative stress, as well as to their ability to respond to challenges such as lipopolysaccharide exposure. A higher transient immune mRNA upregulation was observed after an immune stimulus (LPS injection), mainly in the LPS+T2% treatment when compared to the LPS+T0% or LPS- groups. A similar pattern was observed at 72 h with antioxidant and lysozyme activities, leading us to infer that this acute response after LPS injection could be amplified by taurine. This could be associated with a better immune-trained status; however, further research on trained immunity needs to be carried out to validate this hypothesis.

Future research is suggested to optimize the level of taurine for this species, as well as the use of other immunostimulants against LPS or bacterial challenge, to elucidate the defense mechanisms of S. rivoliana juveniles against infection and the ways to improve their immune responses.