Supplementation of Enzymatic Hydrolysate in Low-Fishmeal and Low-Crop Diet Improves Growth, Antioxidant Capacity, and Immunity of Juvenile Sea Cucumber Apostichopus japonicus (Selenka)
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Diet
2.2. Experimental Sea Cucumber and Feeding Trial
2.3. Growth Indicators
2.4. Proximate Chemical Composition Analysis of Ingredients and Body Wall of Sea Cucumber
2.5. Determination of Intestinal Enzyme Activities
2.6. RNA Extraction, cDNA Synthesis, and Quantitative Real-Time PCR
2.7. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Proximate Chemical Composition of A. japonicus Body Wall
3.3. Activities of Digestive Enzymes
3.4. Immune and Antioxidant Enzyme Activities
3.5. Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Cho, J.H.; Kim, I.H. Fish meal—Nutritive value. J. Anim. Physiol. Anim. Nutr. 2011, 95, 685–692. [Google Scholar] [CrossRef] [PubMed]
- Hlordzi, V.; Wang, J.; Kuebutornye, F.K.A.; Yang, X.; Tan, B.; Li, T.; Cui, Z.; Lv, S.; Lao, T.; Chi, S. Hydrolysed fish protein powder is better at the growth performance, hepatopancreas and intestinal development of Pacific white shrimp (Litopenaeus vannamei). Aquac. Rep. 2022, 23, 101025. [Google Scholar] [CrossRef]
- Maulu, S.; Langi, S.; Hasimuna, O.J.; Missinhoun, D.; Munganga, B.P.; Hampuwo, B.M.; Gabriel, N.N.; Elsabagh, M.; Van Doan, H.; Abdul Kari, Z.; et al. Recent advances in the utilization of insects as an ingredient in aquafeeds: A review. Anim. Nutr. 2022, 11, 334–349. [Google Scholar] [CrossRef]
- Zhou, S.; Smith, A.D.; Knudsen, E.E. Ending overfishing while catching more fish. Fish Fish. 2015, 16, 716–722. [Google Scholar] [CrossRef]
- Hussain, S.M.; Bano, A.A.; Ali, S.; Rizwan, M.; Adrees, M.; Zahoor, A.F.; Sarker, P.K.; Hussain, M.; Arsalan, M.Z.-u.-H.; Yong, J.W.H.; et al. Substitution of fishmeal: Highlights of potential plant protein sources for aquaculture sustainability. Heliyon 2024, 10, e26573. [Google Scholar] [CrossRef]
- da Silva, R.F.B.; Viña, A.; Moran, E.F.; Dou, Y.; Batistella, M.; Liu, J. Socioeconomic and environmental effects of soybean production in metacoupled systems. Sci. Rep. 2021, 11, 18662. [Google Scholar] [CrossRef]
- Zhang, G.-G.; Li, X.; Cai, X.-B.; Zhang, S.-X.; Hua, X.-M.; Huang, Z.-Y.; Li, N.-Y.; Yao, J.-T. Effects of Enzymatic Hydrolyzed Soybean Meal on Growth Performance, Liver Function and Metabolism of Largemouth Bass (Micropterus salmoides). Acta Hydrobiol. Sin. 2019, 43, 1001–1012. [Google Scholar] [CrossRef]
- Zhang, X.; Li, X.; Liu, S.-Q. Enzymatic hydrolysis of minced chicken carcasses for protein hydrolysate production. Poult. Sci. 2023, 102, 102791. [Google Scholar] [CrossRef]
- Five, K.K.; Fålun, I.; Roland, G.J.; Forshaug, D.; Helgeland-Rossavik, M.-K.; Hals, R.; Sandbakken, I.S.; Rustad, T. Enzymatic hydrolysis of chicken viscera and bones: Rest raw material characterization and evaluation of industrially relevant process parameters on product yields. Process Biochem. 2024, 146, 68–80. [Google Scholar] [CrossRef]
- Lasekan, A.; Abu Bakar, F.; Hashim, D. Potential of chicken by-products as sources of useful biological resources. Waste Manag. 2013, 33, 552–565. [Google Scholar] [CrossRef]
- Shi, Y.; Zhong, L.; Ma, X.; Liu, Y.; Tang, T.; Hu, Y. Effect of replacing fishmeal with stickwater hydrolysate on the growth, serum biochemical indexes, immune indexes, intestinal histology and microbiota of rice field eel (Monopterus albus). Aquac. Rep. 2019, 15, 100223. [Google Scholar] [CrossRef]
- Bui, H.T.D.; Khosravi, S.; Fournier, V.; Herault, M.; Lee, K.-J. Growth performance, feed utilization, innate immunity, digestibility and disease resistance of juvenile red seabream (Pagrus major) fed diets supplemented with protein hydrolysates. Aquaculture 2014, 418–419, 11–16. [Google Scholar] [CrossRef]
- Seidavi, A.R.; Zaker-Esteghamati, H.; Scanes, C.G. Present and potential impacts of waste from poultry production on the environment. World’s Poul. Sci. J. 2019, 75, 29–42. [Google Scholar] [CrossRef]
- Cruz-Casas, D.E.; Aguilar, C.N.; Ascacio-Valdés, J.A.; Rodríguez-Herrera, R.; Chávez-González, M.L.; Flores-Gallegos, A.C. Enzymatic hydrolysis and microbial fermentation: The most favorable biotechnological methods for the release of bioactive peptides. Food Chem. Mol. Sci. 2021, 3, 100047. [Google Scholar] [CrossRef]
- Tonheim, S.K.; Espe, M.; Hamre, K.; Rønnestad, I. Pre-hydrolysis improves utilisation of dietary protein in the larval teleost Atlantic halibut (Hippoglossus hippoglossus L.). J. Exp. Mar. Biol. Ecol. 2005, 321, 19–34. [Google Scholar] [CrossRef]
- Liou, S.-T.; Wang, C. Small glutamine-rich tetratricopeptide repeat-containing protein is composed of three structural units with distinct functions. Arch. Biochem. Biophys. 2005, 435, 253–263. [Google Scholar] [CrossRef]
- Srichanun, M.; Tantikitti, C.; Kortner, T.M.; Krogdahl, Å.; Chotikachinda, R. Effects of different protein hydrolysate products and levels on growth, survival rate and digestive capacity in Asian seabass (Lates calcarifer Bloch) larvae. Aquaculture 2014, 428–429, 195–202. [Google Scholar] [CrossRef]
- Cheng, H.-H.; Jiang, G.-Z.; Zheng, X.-C.; Xu, C.-Y.; Sun, C.-X.; Zhang, D.-D.; Liu, W.-B. Effects of five attractants on Chinese mitten crab, Eriocheir sinensis. Acta Hydrobiol. Sin. 2019, 43, 395–401. [Google Scholar] [CrossRef]
- Delcroix, J.; Gatesoupe, F.-J.; Desbruyères, E.; Huelvan, C.; Le Delliou, H.; Le Gall, M.-M.; Quazuguel, P.; Mazurais, D.; Zambonino-Infante, J.L. The effects of dietary marine protein hydrolysates on the development of sea bass larvae, Dicentrarchus labrax, and associated microbiota. Aquac. Nutr. 2015, 21, 98–104. [Google Scholar] [CrossRef]
- Zheng, K.; Liang, M.; Yao, H.; Wang, J.; Chang, Q. Effect of dietary fish protein hydrolysate on growth, feed utilization and IGF-I levels of Japanese flounder (Paralichthys olivaceus). Aquac. Nutr. 2012, 18, 297–303. [Google Scholar] [CrossRef]
- Hao, Y.-T.; Guo, R.; Jia, G.-W.; Zhang, Y.; Xia, H.; Li, X.-H. Effects of enzymatic hydrolysates from poultry by-products (EHPB) as an alternative source of fish meal on growth performance, hepatic proteome and gut microbiota of turbot (Scophthalmus maximus). Aquac. Nutr. 2020, 26, 1994–2006. [Google Scholar] [CrossRef]
- Chen, J.; Yang, F.; Cheng, T.; Yi, J.; Yang, Z.; Li, Z.; Tan, B.; Chi, S. Glutathione-rich yeast hydrolysate makes the contributions to growth performance, healthy of Pacific white shrimp (Litopenaeus vannamei), and helps shrimp resist nitrite stress. Aquac. Rep. 2023, 33, 101825. [Google Scholar] [CrossRef]
- Li, W.; Zhao, X.; Zhang, Y.; Song, W.; Zeng, L.; Zhang, H.; Zhao, X. Effects of Small Peptides on the Growth and Intestinal Development of Large Yellow Croaker Larvae and Their Antioxidant Stress Response under Low Temperature Stress. Anim. Nutr. 2021, 33, 572–583. [Google Scholar] [CrossRef]
- Wang, J. Application of Enzymatic Hydrolyzed Chicken Paste and Soy Protein Concentrate in Feed for Pearl Grouper (Epinephelus lanceolatus). Master’s Thesis, Guangdong Ocean University, Zhanjiang, China, 2020. [Google Scholar] [CrossRef]
- Vafidis, D.; Antoniadou, C. Holothurian Fisheries in the Hellenic Seas: Seeking for Sustainability. Sustainability 2023, 15, 9799. [Google Scholar] [CrossRef]
- Boziaris, I.S.; Anagnostopoulos, D.A.; Parlapani, F.F.; Syropoulou, F.; Martsikalis, P.V.; Apostologamvrou, C.; Kokioumi, D.; Vafidis, D. Microbial and Physicochemical Status of Raw and Processed Sea Cucumbers from the Hellenic Seawaters. Sustainability 2023, 15, 13467. [Google Scholar] [CrossRef]
- Karapanagiotidis, I.T.; Gkalogianni, E.Z.; Apostologamvrou, C.; Voulgaris, K.; Varkoulis, A.; Vafidis, D. Proximate Compositions and Fatty Acid Profiles of Raw and Processed Holothuria polii and Holothuria tubulosa from the Aegean Sea. Sustainability 2024, 16, 6048. [Google Scholar] [CrossRef]
- Ru, X.; Zhang, L.; Li, X.; Liu, S.; Yang, H. Development Strategies for the Sea Cucumber Industry in China. J. Oceanol. Limnol. 2019, 37, 300–312. [Google Scholar] [CrossRef]
- Ministry of Agriculture and Rural Affairs of the People’s Republic of China. China Fisheries Statistical Yearbook; China Agriculture Press: Beijing, China, 2023.
- Bai, Y.; Zhang, L.; Xia, S.; Liu, S.; Ru, X.; Xu, Q.; Zhang, T.; Yang, H. Effects of dietary protein levels on the growth, energy budget, and physiological and immunological performance of green, white and purple color morphs of sea cucumber, Apostichopus japonicus. Aquaculture 2016, 450, 375–382. [Google Scholar] [CrossRef]
- Zhang, Z.; Chi, Y.; Du, Y.; Li, F.; Ma, N.; Qin, S. Effects of kelp phlorotannins on the growth, immunity, intestinal health and disease resistance against Vibrio splendidus of sea cucumber Apostichopus japonicus. Aquac. Rep. 2025, 40, 102614. [Google Scholar] [CrossRef]
- Chen, J.; Ren, Y.; Wang, G.; Xia, B.; Li, Y. Dietary supplementation of biofloc influences growth performance, physiological stress, antioxidant status and immune response of juvenile sea cucumber Apostichopus japonicus (Selenka). Fish Shellfish Immunol. 2018, 72, 143–152. [Google Scholar] [CrossRef]
- Dou, H.; Wu, S. Dietary fulvic acid supplementation improves the growth performance and immune response of sea cucumber (Apostichopus japonicus). Fish Shellfish Immunol. 2023, 135, 108662. [Google Scholar] [CrossRef] [PubMed]
- Nogales-Mérida, S.; Gobbi, P.; Józefiak, D.; Mazurkiewicz, J.; Dudek, K.; Rawski, M.; Kierończyk, B.; Józefiak, A. Insect meals in fish nutrition. Rev. Aquac. 2019, 11, 1080–1103. [Google Scholar] [CrossRef]
- Chen, J.; Liu, P.; Li, Y.; Li, M.; Xia, B. Effects of dietary biofloc on growth, digestibility, protein turnover and energy budget of sea cucumber Apostichopus japonicus (Selenka). Anim. Feed Sci. Technol. 2018, 241, 151–162. [Google Scholar] [CrossRef]
- Xia, B.; Wang, J.; Gao, Q.-F.; Sun, Y.; Zhang, L.; Ma, J.; Liu, X. The nutritional contributions of dietary protein sources to tissue growth and metabolism of sea cucumber Apostichopus japonicus (Selenka): Evidence from nitrogen stable isotope analysis. Aquaculture 2015, 435, 237–244. [Google Scholar] [CrossRef]
- Official Methods of Analysis of AOAC International; Oxford University Press: Oxford, UK, 2023. [CrossRef]
- Chen, J.; Sui, C.; Hu, Y.; Qin, H.; Zhang, D.; Wei, J.; Cao, B.; Li, Q. Effects of dietary phospholipids on growth performance, antioxidant capacity, and lipid metabolism of juvenile Chinese sturgeon (Acipenser sinensis), a critically endangered sturgeon in the Yangtze River. Aqua. Rep. 2024, 39, 102366. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Sibilla, S.; Godfrey, M.; Brewer, S.; Budh-Raja, A.; Genovese, L. An Overview of the Beneficial Effects of Hydrolysed Collagen as a Nutraceutical on Skin Properties: Scientific Background and Clinical Studies. Open Nutraceuticals J. 2015, 8, 29–42. [Google Scholar] [CrossRef]
- Kim, S.-K.; Takeuchi, T.; Yokoyama, M.; Murata, Y.; Kaneniwa, M.; Sakakura, Y. Effect of dietary taurine levels on growth and feeding behavior of juvenile Japanese flounder Paralichthys olivaceus. Aquaculture 2005, 250, 765–774. [Google Scholar] [CrossRef]
- Omura, Y.; Inagaki, M. Immunocytochemical localization of taurine in the fish retina under light and dark adaptations. Amino Acids 2000, 19, 593–604. [Google Scholar] [CrossRef]
- Wu, J.; Liu, W.; Wen, H.; Zhou, Y.; Wu, J. Animal by-products with or without enzymatic hydrolysis completely replacement of fish meal in genetically improved farmed tilapia diets (Oreochromis niloticus). Aquac. Res. 2021, 52, 291–301. [Google Scholar] [CrossRef]
- Hlordzi, V.; Tan, B.; Dong, X.; Zhang, S.; Zhu, L.; Zhang, L.; Hu, X.; Chi, S. Enzymatic Chicken Pulp Promotes Appetite, Digestive Enzyme Activity, and Growth in Litopenaeus vannamei. Metabolites 2022, 12, 698. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Wang, A.; Lin, X.; Miao, H.; Liu, X.; Xu, J.; Ma, X.; Wu, Y.; Dong, X.; Ge, J.; et al. Effects of dietary trimetlylamine oxide on the growth performance, feed utilization and appetite regulation of Chinese mitten crab (Eriocheir sinensis). Aquaculture 2023, 575, 739754. [Google Scholar] [CrossRef]
- Shamushaki, V.A.J.; Kasumyan, A.O.; Abedian, A.; Abtahi, B. Behavioural responses of the Persian sturgeon (Acipenser persicus) juveniles to free amino acid solutions. Mar. Freshw. Behav. Physiol. 2007, 40, 219–224. [Google Scholar] [CrossRef]
- Carr, W.E.S.; Netherton, J.C., III; Gleeson, R.A.; Derby, C.D. Stimulants of feeding behavior in fish: Analyses of tissues of diverse marine organisms. Biol. Bull. 1996, 190, 149–160. [Google Scholar] [CrossRef]
- Khosravi, S.; Rahimnejad, S.; Herault, M.; Fournier, V.; Lee, C.-R.; Dio Bui, H.T.; Jeong, J.-B.; Lee, K.-J. Effects of protein hydrolysates supplementation in low fish meal diets on growth performance, innate immunity and disease resistance of red sea bream Pagrus major. Fish Shellfish Immunol. 2015, 45, 858–868. [Google Scholar] [CrossRef]
- Khosravi, S.; Bui, H.T.D.; Rahimnejad, S.; Herault, M.; Fournier, V.; Kim, S.-S.; Jeong, J.-B.; Lee, K.-J. Dietary supplementation of marine protein hydrolysates in fish-meal based diets for red sea bream (Pagrus major) and olive flounder (Paralichthys olivaceus). Aquaculture 2015, 435, 371–376. [Google Scholar] [CrossRef]
- Wei, Y.; Liu, J.; Wang, L.; Duan, M.; Ma, Q.; Xu, H.; Liang, M. Influence of fish protein hydrolysate on intestinal health and microbial communities in turbot Scophthalmus maximus. Aquaculture 2023, 576, 739827. [Google Scholar] [CrossRef]
- Siddik, M.A.B.; Howieson, J.; Ilham, I.; Fotedar, R. Growth, biochemical response and liver health of juvenile barramundi (Lates calcarifer) fed fermented and non-fermented tuna hydrolysate as fishmeal protein replacement ingredients. PeerJ 2018, 6, e4870. [Google Scholar] [CrossRef]
- Abdullah-Zawawi, M.-R.; Afiqah-Aleng, N.; Ikhwanuddin, M.; Sung, Y.Y.; Tola, S.; Fazhan, H.; Waiho, K. Recent development in ecdysone receptor of crustaceans: Current knowledge and future applications in crustacean aquaculture. Rev. Aquac. 2021, 13, 1938–1957. [Google Scholar] [CrossRef]
- Kim, A.L.; Raffo, A.J.; Brandt-Rauf, P.W.; Pincus, M.R.; Monaco, R.; Abarzua, P.; Fine, R.L. Conformational and molecular basis for induction of apoptosis by a p53 C-terminal peptide in human cancer cells. J. Biol. Chem. 1999, 274, 34924–34931. [Google Scholar] [CrossRef]
- Hevrøy, E.M.; Espe, M.; Waagbø, R.; Sandnes, K.; Ruud, M.; Hemre, G.-I. Nutrient utilization in Atlantic salmon (Salmo salar L.) fed increased levels of fish protein hydrolysate during a period of fast growth. Aqua. Nutr. 2005, 11, 301–313. [Google Scholar] [CrossRef]
- Zhou, X.; Ding, Y.; Yang, C.; Li, C.; Su, Z.; Xu, J.; Qu, C.; Shi, Y.; Kang, X. FHL3 gene regulates bovine skeletal muscle cell growth through the PI3K/Akt/mTOR signaling pathway. Comp. Biochem. Physiol. Part D Genom. Proteom. 2024, 52, 101356. [Google Scholar] [CrossRef] [PubMed]
- Lv, Z.; Yue, Z.; Shao, Y.; Li, C.; Zhao, X.; Guo, M. mTORC2/Rictor Is Essential for Coelomocyte Endocytosis in Apostichopus japonicus. Dev. Comp. Immunol. 2021, 118, 104000. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.H.; Song, S.; Yang, J.F. Oral administration of sea cucumber (Stichopus japonicus) protein exerts wound healing effects via the PI3K/AKT/mTOR signaling pathway. Food. Funct. 2022, 13, 9796–9809. [Google Scholar] [CrossRef]
- Kousoulaki, K.; Olsen, H.J.; Albrektsen, S.; Langmyhr, E.; Mjøs, S.A.; Campbell, P.; Aksnes, A. High growth rates in Atlantic salmon (Salmo salar L.) fed 7.5% fish meal in the diet. Micro-, ultra- and nano-filtration of stickwater and effects of different fractions and compounds on pellet quality and fish performance. Aquaculture 2012, 338–341, 134–146. [Google Scholar] [CrossRef]
- Cudennec, B.; Fouchereau-Peron, M.; Ferry, F.; Duclos, E.; Ravallec, R. In vitro and in vivo evidence for a satiating effect of fish protein hydrolysate obtained from blue whiting (Micromesistius poutassou) muscle. J. Funct. Foods 2012, 4, 271–277. [Google Scholar] [CrossRef]
- Li, X.; Wei, X.; Guo, X.; Mi, S.; Hua, X.; Li, N.; Yao, J. Enhanced growth performance, muscle quality and liver health of largemouth bass (Micropterus salmoides) were related to dietary small peptides supplementation. Aquac. Nutr. 2020, 26, 2169–2177. [Google Scholar] [CrossRef]
- Tullio, V.; Spaccapelo, R.; Polimeni, M. Lysozymes in the Animal Kingdom. In Human and Mosquito Lysozymes; Springer: Cham, Switzerland, 2015. [Google Scholar] [CrossRef]
- Frosali, S.; Pagliari, D.; Gambassi, G.; Landolfi, R.; Pandolfi, F.; Cianci, R. How the intricate interaction among Toll-like receptors, microbiota, and intestinal immunity can influence gastrointestinal pathology. J. Immunol. Res. 2015, 489821, 12. [Google Scholar] [CrossRef]
- Zhang, R.-Q.; Chen, Q.-X.; Zheng, W.-Z.; Lin, J.-Y.; Zhuang, Z.-L.; Zhou, H.-M. Inhibition kinetics of green crab (Scylla serrata) alkaline phosphatase activity by dithiothreitol or 2-mercaptoethanol. Int. J. Biochem. Cell Biol. 2000, 32, 865–872. [Google Scholar] [CrossRef]
- Cheng, T.C. The Role of Lysosomal Hydrolases in Molluscan Cellular Response to Immunologic Challenge. In Invertebrate Models for Biomedical Research; Bulla, L.A., Cheng, T.C., Eds.; Springer: Boston, MA, USA, 1978; pp. 59–71. [Google Scholar] [CrossRef]
- Abyaba, H.; Pasquini, V.; Ennas, C.; Addis, P.; Pusceddu, A. Organic matter ingestion and assimilation rates by the sea cucumber Holothuria (Holothuria) tubulosa (Gmelin, 1788) at different temperatures and potential effects on benthic trophic status. Mar. Environ. Res. 2025, 203, 106830. [Google Scholar] [CrossRef]
- Xu, D.; Sun, L.; Liu, S.; Zhang, L.; Yang, H. Polymorphisms of heat shock protein 90 (Hsp90) in the sea cucumber Apostichopus japonicus and their association with heat-resistance. Fish Shellfish Immunol. 2014, 41, 428–436. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Xu, D.; Chen, Y.; Zhao, C.; Liu, L.; Gu, Y.; Ren, Y.; Xia, B. Adverse effects of dietary virgin (nano)microplastics on growth performance, immune response, and resistance to ammonia stress and pathogen challenge in juvenile sea cucumber Apostichopus japonicus (Selenka). J. Hazard. Mater. 2022, 423, 127038. [Google Scholar] [CrossRef] [PubMed]
- Tower, J. Hsps and aging. Trends Endocrinol. Metab. 2009, 20, 216–222. [Google Scholar] [CrossRef]
- Lyu, Q.K.; Wawrzyniuk, M.; Rutten, V.P.M.G.; van Eden, W.; Sijts, A.J.A.M.; Broere, F. Hsp70 and NF-kB Mediated Control of Innate Inflammatory Responses in a Canine Macrophage Cell Line. Int. J. Mol. Sci. 2020, 21, 6464. [Google Scholar] [CrossRef]
- dos Santos Aguilar, J.G.; de Souza, A.K.S.; de Castro, R.J.S. Enzymatic Hydrolysis of Chicken Viscera to Obtain Added-Value Protein Hydrolysates with Antioxidant and Antihypertensive Properties. Int. J. Pept. Res. Ther. 2020, 26, 717–725. [Google Scholar] [CrossRef]
- Zhuang, Y.; Zhang, W.; Zheng, J.; Tang, Z.; Li, X.; Cao, X.; Zhang, L.; Xu, W.; Mai, K.; Ai, Q. Effects of enzymatic hydrolysis chicken by-product in high plant-based protein diet on growth performance, digestive capacity, antioxidant capacity and non-specific immunity of juvenile turbot (Scophthalmus maximus L.). Aquac. Nutr. 2021, 27, 1578–1589. [Google Scholar] [CrossRef]
- BØGwald, J.; Dalmo, R.O.Y.; McQueen Leifson, R.; Stenberg, E.; Gildberg, A. The stimulatory effect of a muscle protein hydrolysate from Atlantic cod, Gadus morhua L., on Atlantic salmon, Salmo salar L., head kidney leucocytes. Fish Shellfish Immunol. 1996, 6, 3–16. [Google Scholar] [CrossRef]
- Gildberg, A.; Bøgwald, J.; Johansen, A.; Stenberg, E. Isolation of acid peptide fractions from a fish protein hydrolysate with strong stimulatory effect on atlantic salmon (Salmo salar) head kidney leucocytes. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 1996, 114, 97–101. [Google Scholar] [CrossRef]
- Leduc, A.; Hervy, M.; Rangama, J.; Delépée, R.; Fournier, V.; Henry, J. Shrimp by-product hydrolysate induces intestinal myotropic activity in European seabass (Dicentrarchus labrax). Aquaculture 2018, 497, 380–388. [Google Scholar] [CrossRef]
- Feddern, V.; Mazzuco, H.; Fonseca, F.N.; de Lima, G.J.M.M. A review on biogenic amines in food and feed: Toxicological aspects, impact on health and control measures. Anim. Prod. Sci. 2019, 59, 308–318. [Google Scholar] [CrossRef]
- Tapia-Salazar, M.; Cruz-Suárez, L.E.; Ricque-Marie, D.; Pike, I.H.; Smith, T.K.; Harris, A.; Nygård, E.; Opstvedt, J. Effect of fishmeal made from stale versus fresh herring and of added crystalline biogenic amines on growth and survival of blue shrimp Litopenaeus stylirostris fed practical diets. Aquaculture 2004, 242, 437–453. [Google Scholar] [CrossRef]
- Wu, D.; Zhou, L.; Gao, M.; Wang, M.; Wang, B.; He, J.; Luo, Q.; Ye, Y.; Cai, C.; Wu, P. Effects of stickwater hydrolysates on growth performance for yellow catfish (Pelteobagrus fulvidraco). Aquaculture 2018, 488, 161–173. [Google Scholar] [CrossRef]





| Ingredient (%) | Diet | ||
|---|---|---|---|
| Control | EFS | ECP | |
| Fishmeal | 10.00 | 8.00 | 8.00 | 
| Soybean meal | 5.00 | 0 | 0 | 
| Corn meal | 10.00 | 9.00 | 9.00 | 
| Starch | 3.00 | 3.00 | 3.00 | 
| Mixed seaweed meal * | 70.00 | 70.00 | 70.00 | 
| EFS | 8.00 | ||
| ECP | 8.00 | ||
| Mineral premix ** | 0.50 | 0.50 | 0.50 | 
| Vitamin premix *** | 0.50 | 0.50 | 0.50 | 
| Ca(H2PO4)2 | 1.00 | 1.00 | 1.00 | 
| Proximate Chemical Composition | |||
| Moisture | 8.20 | 8.12 | 8.19 | 
| Crude protein | 15.6 | 15.19 | 15.29 | 
| Crude lipid | 2.01 | 2.35 | 2.50 | 
| Ash | 23.48 | 24.06 | 24.23 | 
| Component | EFS | ECP | 
|---|---|---|
| Proximate composition of enzymatic hydrolysates, % Wet Weight | ||
| Moisture | 50.32 | 48.96 | 
| Protein | 37.72 | 34.22 | 
| Lipid | 1.38 | 4.26 | 
| Ash | 10.32 | 12.31 | 
| Acid-soluble protein | 62.52 | 56.23 | 
| T-VBN (mg/100 g) | 445.43 | 133.73 | 
| Histamine (mg/kg) | 985 | 64.7 | 
| Percentage of peptides with different molecular weights in hydrolysates, % Protein | ||
| <200 Da | 45.26 | 18.68 | 
| 200–500 Da | 11.00 | 24.89 | 
| 500–1000 Da | 18.89 | 27.61 | 
| 1000–2000 Da | 9.77 | 20.10 | 
| 2000–3000 Da | 6.28 | 4.18 | 
| >3000 Da | 8.80 | 4.55 | 
| Amino acid composition of hydrolysates, % wet weight | ||
| Arg | 1.31 | 1.68 | 
| His | 0.58 | 0.73 | 
| Ile | 0.61 | 0.97 | 
| Leu | 1.25 | 1.86 | 
| Lys | 1.47 | 1.91 | 
| Met | 0.50 | 0.58 | 
| Phe | 0.73 | 0.99 | 
| Thr | 0.70 | 1.05 | 
| Val | 0.91 | 1.15 | 
| Ala | 2.47 | 2.21 | 
| Asp | 2.06 | 2.42 | 
| Cys | 0.29 | 0.27 | 
| Glu | 3.62 | 3.93 | 
| Gly | 4.53 | 3.28 | 
| Pro | 4.75 | 3.98 | 
| Ser | 0.84 | 1.03 | 
| Tyr | 0.39 | 0.77 | 
| Genes | Primer Sequences 5′-3′ | Annealing Temp. (°C) | Efficiency | Accession Number | 
|---|---|---|---|---|
| β-actin | F: GTCACAAACTGGGATGATATGGAG | 59.18 | 0.92 | AB510191 | 
| R: TTGGCTTTAGGGTTGAGTGGA | ||||
| LZM | F: TTGGTCCGCCGTTGTGT | 59.43 | 1.02 | EF036468 | 
| R: CTGGATGGAGATTGGCAGAAA | ||||
| SOD | F: CGATGATAATGGTGTGGCTAGTGT | 60.74 | 1.02 | JX097096 | 
| R: TAAATCGTCAACCCCTTCGTG | ||||
| CAT | F: GCTGGTGCATTTGGTTACTTTG | 58.94 | 0.97 | JQ776634 | 
| R: AGTGGTGTTTTCTTGCCGATTT | ||||
| GS | F: CAACCCACGGAAAAAGTTACCTG | 60.24 | 0.98 | KJ839835 | 
| R: TTGCTGTCTGTTTAGTGTCTGGG | ||||
| p105 | F: CAACACACCCCTCCATCTT | 56.94 | 1.01 | JF828766 | 
| R: TCTTCTTCGCTAACGTCACACC | ||||
| CL | F: CCTGGTTGGGGTATGTCTGT | 59.01 | 1.05 | HQ728281 | 
| R: AGTGTCCGGTAGCTAAGTCG | ||||
| Hsp90 | F: GGAGGAGCGAACAAACCAAG | 59.12 | 0.98 | HO054976 | 
| R: GTCAAATGGCGCCCTCTTAG | ||||
| Hsp70 | F: GCCGCATCCCTTGTAAGAAG | 58.98 | 0.92 | EU930813 | 
| R: AGTTCAAATTGACCGAGGCG | ||||
| TLR | F: TGCAGCTCTCCATCAGTTCA | 59.02 | 0.97 | KC708868 | 
| R: CAACTTCCCTGGCCTTTTCC | ||||
| TOR | F: CCAAGAGACAGAAGACAGTG | 55.43 | 1.02 | MH807454 | 
| R: CATCGGTTCCAAGAGTTCCT | 
| Parameter | Diet | ||
|---|---|---|---|
| Control | EFS | ECP | |
| IW (g) | 0.25 ± 0.01 | 0.25 ± 0.01 | 0.25 ± 0.01 | 
| FW (g) | 0.93 ± 0.03 a | 1.25 ± 0.07 b | 1.31 ± 0.04 b | 
| SR (%) | 61.21 ± 5.41 | 63.79 ± 5.76 | 61.51± 6.45 | 
| FI (g) | 1.58 ± 0.05 a | 1.82 ± 0.10 b | 1.93 ± 0.06 b | 
| SGR (%/day) | 1.56 ± 0.04 a | 1.91 ± 0.09 b | 1.97 ± 0.08 b | 
| RNA/DNA ratio | 1.00 ± 0.27 a | 1.58 ± 0.02 b | 1.74 ± 0.14 b | 
| Parameter | Diet | ||
|---|---|---|---|
| Control | EFS | ECP | |
| Moisture | 92.35 ± 0.18 | 92.23 ± 0.45 | 92.18 ± 0.84 | 
| Crude protein | 3.34 ± 0.25 a | 4.01 ± 0.13 b | 4.26 ± 0.1 b | 
| Crude lipid | 0.38 ± 0.08 | 0.30 ± 0.06 | 0.28 ± 0.03 | 
| Ash | 2.77 ± 0.35 | 2.15 ± 0.26 | 2.28 ± 0.37 | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Q.; Liu, Z.; Yang, G.; Zhang, D.; Qin, H.; Xia, B.; Liu, S.; Chen, J. Supplementation of Enzymatic Hydrolysate in Low-Fishmeal and Low-Crop Diet Improves Growth, Antioxidant Capacity, and Immunity of Juvenile Sea Cucumber Apostichopus japonicus (Selenka). Fishes 2025, 10, 42. https://doi.org/10.3390/fishes10020042
Li Q, Liu Z, Yang G, Zhang D, Qin H, Xia B, Liu S, Chen J. Supplementation of Enzymatic Hydrolysate in Low-Fishmeal and Low-Crop Diet Improves Growth, Antioxidant Capacity, and Immunity of Juvenile Sea Cucumber Apostichopus japonicus (Selenka). Fishes. 2025; 10(2):42. https://doi.org/10.3390/fishes10020042
Chicago/Turabian StyleLi, Qingfei, Zhengyong Liu, Gang Yang, Danyang Zhang, Huimin Qin, Bin Xia, Shilin Liu, and Jinghua Chen. 2025. "Supplementation of Enzymatic Hydrolysate in Low-Fishmeal and Low-Crop Diet Improves Growth, Antioxidant Capacity, and Immunity of Juvenile Sea Cucumber Apostichopus japonicus (Selenka)" Fishes 10, no. 2: 42. https://doi.org/10.3390/fishes10020042
APA StyleLi, Q., Liu, Z., Yang, G., Zhang, D., Qin, H., Xia, B., Liu, S., & Chen, J. (2025). Supplementation of Enzymatic Hydrolysate in Low-Fishmeal and Low-Crop Diet Improves Growth, Antioxidant Capacity, and Immunity of Juvenile Sea Cucumber Apostichopus japonicus (Selenka). Fishes, 10(2), 42. https://doi.org/10.3390/fishes10020042
 
        


 
       