Supplementation of Sage (Salvia officinalis) Essential Oil in Balanced Diets for Tropical Gar (Atractosteus tropicus) Larvae on Digestive and Antioxidant Enzyme Activities and Expression of Immune System Genes

Abstract

The tropical gar (Atractosteus tropicus) has significant ecological, economic, and cultural importance in southeast Mexico, where aquaculture is increasing and fish are frequently exposed to stress. In this sense, feed additives such as sage (Salvia officinalis) strengthen organisms’ growth, immune systems, antioxidant capacities, and digestive capabilities. A 30-day experiment was conducted on larvae to determine the effect of different concentrations of sage essential oil (0%, 0.5%, 1%, 1.5%, and 2% treatments) supplemented in balanced diets. Significant differences (p < 0.05) between 0.5% and 2% sage oil supplement treatments for average weight were found. The highest acid and alkaline proteases, chymotrypsin, leucine aminopeptidase, amylase, and lipase activities were obtained for the sage oil-supplemented treatments. In contrast, trypsin showed the highest activity for treatment 0%, followed by diets with 0.5% and 2% sage oil. Regarding the antioxidant enzymatic activity for GPx, CAT and SOD, the highest activity was obtained in the diet with 1% sage oil, while in PEROx, the highest activity was recorded in the treatment with 0%, 1.5% and 2% S. officinalis supplementation. On the other hand, for relative gene expression, the highest expression was observed in sage-supplemented treatments for the nod, zo-1, zo-2, and occ genes. In contrast, the lowest expression was found in supplemented treatments for the il-10 and muc2 genes. These findings suggest that incorporating sage essential oil into the diets of tropical gar larvae, particularly at concentrations of 1.66% and 1.77%, holds potential for enhancing aquaculture practices for this important species.

1. Introduction

Due to global population growth, alternatives have been sought to ensure the supply of high-quality food to the human population, positioning aquaculture as a key sector in food production [1]. In this sense, balanced feeds are being developed based on digestive physiology to enhance digestion and nutrient absorption [2]. Additionally, these types of balanced feeds for aquaculture can be supplemented with prebiotics, probiotics, postbiotics, symbiotics, functional additives, and phytogenics, which contribute to improved health and performance in aquatic species. These supplements support optimal growth and a stimulated immune system to combat potential opportunistic pathogens [2,3,4]. Functional additives are dietary ingredients that not only fulfill basic nutritional requirements but also provide additional benefits such as improved growth, immune responses and resistance to diseases [5]. Moreover, phytogenic compounds, which are bioactive compounds obtained from plants, are classified into hydroalcohols and essential oils, and have recently been included in balanced feeds at low concentrations, having growth-promoting, antimicrobial, immunostimulant, anti-inflammatory, sedative, and antioxidant properties in several animal species [6]. In relation to the above, various essential oils (Eos) have been identified such as pepper, oregano, cinnamon, mint, and Salvia sp., which have been used in humans and animals with various health benefits [7,8,9,10,11], in addition to enhancing the antioxidant capacity in the organisms that consume them, thus promoting the synthesis and release of enzymes such as glutathione peroxidase (Gpx), which is a selenoenzyme that reduces reactive oxygen species (ROS) and limits their toxicity, catalyzing the reduction of hydrogen peroxide or organic hydroperoxides to water or corresponding alcohols [12]; catalase (CAT), which is a hemoenzyme that acts as an oxidoreductase, where the decomposition of hydrogen peroxide mitigates oxidative stress, resulting from the imbalance in the levels of reactive oxygen species and antioxidants [13]; superoxide dismutase (SOD), which catalyzes the dismutation of superoxide anion into oxygen and hydrogen peroxide, thus protecting cells from oxidative damage caused by reactive oxygen species, so that the inactivation of SOD can induce or aggravate oxidative stress [14]; and peroxidase (PEROx), which catalyzes the oxidation of various compounds by interacting with hydrogen peroxide and related compounds [15].

On the other hand, the essential oil of sage (Salvia officinalis) is a compound rich in steroids, polyphenols, triterpenoids, diterpenoids and sesquiterpenoids, in addition, it has potent antibacterial, antifungal, antioxidant, anticancer, anticholinesterase and anti-inflammatory properties, as well as a great capacity to improve mood and cognitive function [16]. It is obtained through hydrodistillation, steam distillation, enzyme-assisted ensiling, extraction with conventional organic solvents, or near-critical extraction (liquid or supercritical) using CO₂ [17]. Thus, the essential oil contains natural biomolecules that remain unchanged during the extraction process. When included in food, they exhibit biostimulant properties that enhance the immune system by activating various components, such as mucins, interleukins, occludins, claudins, and nucleotide-binding oligomerization domain (NOD) receptors [18]. Within the mucins is muc-2, which plays a crucial role in protecting and maintaining intestinal homeostasis; therefore, reduced levels of muc-2 may be associated with various intestinal diseases [19]. From the group of interleukins, there is IL-10, which synthesizes a key protein involved in regulating the inflammatory response. By interacting with various immune cells, it blocks their activation and ability to produce inflammatory substances, thus contributing to maintaining tissue homeostasis [20]. The group of occludins is zo-1 and zo-2, which play an important role in the formation and maintenance of tight junctions between epithelial cells, which seal the intercellular space, forming a barrier that regulates the passage of substances between tissues, protecting the integrity of the organs [21]. In this sense, claudins such as occ, which synthesizes a protein that acts as a barrier between cells by regulating cell permeability, playing an essential role in maintaining vascular homeostasis [22]; Finally, from the group of nucleotide-binding oligomerization domain molecules, there is nod2, which synthesizes a protein that helps detect the presence of foreign or harmful substances, triggering an alarm response that activates the immune system [23].

Based on the above, the benefits of sage oil have been studied in various species, as is the case with a study by Alanazi et al. [24], where they studied the effect of the combination of sage oil and thymoquinone on hyperglycemia, oxidative stress, blood pressure, and lipid profile in rats fed a high-fat diet. They highlighted that the combination of these compounds exhibited hypoglycemic, hypolipidemic, and antioxidant actions, making it a valuable addition to diabetes management. Likewise, research has been carried out to understand the effect of sage oil on some fish species, such as tilapia hybrids (Oreochromis niloticus × Oreochromis aureus) [25], rainbow trout (Oncorhynchus mykiss) [26], sea bream (Sparus aurata) [27], European sea bass (Dicentrarchus labrax) [28] and common carp (Cyprinus carpio) [10], where they found that the addition of the oil improves fat production values by decreasing it, increases somatic growth and feed efficiency, causes a positive effect on oxidative stress, improves systemic immune response and blood indices, balances the intestinal microbiome and increases fertility in breeders.

Instead, tropical gar (Atractosteus tropicus, Gill 1863) is a fish of the Lepisosteidae family, distributed from southeastern Mexico to Central America, including the coasts of Guatemala, El Salvador, Honduras, Nicaragua, and Costa Rica [29]. The gar culture is divided into four main phases: reproduction, larviculture, pre-growing, and growing [30,31]. Adequate feeding and nutrition are essential for maintaining good health and preventing disease in captivity [32]. Culture and production of tropical gar (Atractosteus tropicus), valued for both its aquaculture potential and its cultural significance in southeastern Mexico and Central America, face significant challenges, particularly in its early stages, as the technology for its management is still considered incomplete or in pre-commercial development [33]. Although progress has been made in diverse specific areas, further research is still required on digestive physiology, appropriate stocking densities, and protocols that maximize growth for specific developmental stages to enhance commercial culture [34].

In this context, several studies have been conducted on the tropical gar (Atractosteus tropicus), focusing on its genetics [35,36,37,38,39,40,41], use of additives, prebiotics and probiotics [32,42,43,44,45], digestive physiology [23,46,47] and nutrition and ingredient use [48,49,50,51]. Thus, A. tropicus has been studied to understand the metabolic, biochemical, and molecular processes that enhance the aquaculture technological package in the southeastern region of Mexico. Therefore, it is relevant to evaluate the effect of supplementing Salvia officinalis essential oil in balanced diets for tropical gar (Atractosteus tropicus) larvae on growth, survival, digestive and antioxidant enzyme activity, and expression of immune system and antioxidant genes.

2. Materials and Methods

The Salvia officinalis essential oil used in this study was obtained from Perfumería Roxana, a local establishment located at Avenida José María Pino Suárez 702, Colonia Arboledas, Centro, Villahermosa, Tabasco, Mexico. It was characterized through chromatographic analysis and antimicrobial testing.

2.1. Chromatographic Characterization

To determine the main volatile compounds that are present in sage (Salvia officinalis) essential oil, the relevant analyses were performed at the Center for Research and Assistance in Technology and Design of the State of Jalisco, A.C. (CIATEJ). The compounds were identified by gas chromatography-mass spectrometry (GC-MS) and subsequently quantified by gas chromatography with flame ionization detection (GC-FID) under translated analytical conditions. The tentative identification of the most abundant compounds separated in the sample was performed by comparing the mass spectra of the chromatographic peaks in the total ion chromatogram (TIC) with those of the NIST 14 spectral base, as well as by comparing RIs available in the literature.

2.2. Antimicrobial Activity

The antimicrobial activity of Salvia officinalis essential oil was evaluated using the agar well diffusion and disk diffusion methods against a panel of fish pathogenic microorganisms. The bacterial strains tested included: Aeromonas hydrophila (NCIBM 11343), Aeromonas dhakensis (CAIM 1873), Aeromonas ichthiosmia (CAIM 1876), Staphylococcus arlettae (CAIM 658 and UJAT 002), Vibrio parahaemolyticus (ATCC 17802), Vibrio harveyi (CAIM 1622), Vibrio campbellii (CIBGEN 001), Vibrio diabolicus (CIBGEN 002), and Photobacterium damselae (CAIM 1910). The test organisms were cultured in tryptic soy broth (TSB) at 28 °C for 24 h. Bacterial suspensions were then adjusted to 1 × 10⁸ CFU/mL using a 0.5 McFarland standard. For each assay, 3.5 mL of the adjusted bacterial suspension was homogenized into 31.5 mL of molten Mueller-Hinton agar (cooled to 45–50 °C), and the mixture was immediately poured into sterile square Petri dishes (10 × 10 cm) previously fitted with 12 stainless steel cylinders (6 mm diameter). Each well was filled with 100 µL of S. officinalis essential oil at three concentrations: undiluted, 50%, and 25% (v/v in DMSO). Sterile DMSO: water (50:50, v/v) was used as the negative control, and amikacin (100 µg/mL) served as the positive control. Plates were incubated at 28 °C for 24 h, after which the diameter of the inhibition zones was measured in millimeters using a digital caliper. For the disk diffusion assay, sterile paper disks (6 mm diameter) were impregnated with 10 µL of the same essential oil concentrations (undiluted, 50%, and 25%) and placed onto the surface of the inoculated agar. Plates were incubated under the same conditions, and inhibition zones were measured after 24 h. All assays were performed in triplicate for each strain and concentration. Antimicrobial activity was expressed as the diameter (mm) of the inhibition zones, including the well or disk diameter.

2.3. Sampling and Larviculture

Eleutheroembryos of A. tropicus (2000 individuals) were obtained from a batch of broodstock from the Laboratory of Physiology in Aquatic Resources (LAFIRA) of the Academic Division of Biological Sciences at the Universidad Juárez Autónoma de Tabasco. In accordance with Márquez-Couturier et al. [31] a female (3.4 kg, 91 cm) was induced to spawn by intramuscular application of the LHRHa hormone (Sigma-Aldrich, Taufkirchen, Germany) (30 µg/kg fish). The female and three males (1.6 kg, 35 cm, without hormone induction) were subsequently placed in a circular tank (2000 L) with raffia thread to simulate the natural spawning site. Eleutheroembryos (0.1 ± 0.06 g, three days post fertilization, DPF) were placed in a recirculating system consisting of 18 circular tanks of 70 L, fed by a 0.5 HP water pump (Jacuzzi, JWPA5D-230A, Delavan, WI, USA) and a 1000 L reservoir for solids deposition and a biological filter. Once the yolk was absorbed (three days after hatching, DAH), the bioassay was initiated, which lasted 30 days (from larval to juvenile period), during which biometrics were performed every 15 days to monitor growth. The feeding protocol began with the supply of Artemia nauplii (5 nauplii/mL) from yolk absorption (3 DAH) until 30 DAH. Starting at 7 DAE, the co-feeding process was initiated by mixing the Artemia nauplii with the experimental feeds. Beginning at 10 DAH, the experimental feeds were supplied exclusively, considering 10% of the total biomass and adjusting it periodically as the fish grew five times a day (8:00, 10:30, 13:00, 16:00, and 18:00).

2.4. Experimental Design

The bioassay consisted of five treatments (Salvia officinalis oil supplementation doses, based on previous studies [10,26,27,28] in the feed: 0%, 0.5%, 1%, 1.5%, and 2%. There were three replicates per treatment. One hundred larvae were maintained per 70 L tank under a recirculating system. Water quality parameters were monitored daily (YSI multi parameter model Pro 2030, YSI Inc., Yellow Springs, OH, USA), with a temperature of 26 ± 1 °C, a dissolved oxygen concentration of 4.5 ± 0.1 mg L⁻¹, a pH of 7.3 ± 0.2, and a photoperiod of 12 h of light and 12 h of dark.

2.5. Preparation of Microparticulate Feeds

To prepare the experimental feeds, the meals were sieved, following the procedure described by Sepúlveda-Quiróz et al. [51] the sage essential oil was mixed with the fish oil in each of the previously established experimental proportions and the mixing continued with the aforementioned protocol (

Table 1. Composition of experimental diets with different concentrations of Salvia officinalis essential oil.

Ingredients g/kg	Concentration of Salvia officinalis Essential Oil (%)
	0	0.5	1	1.5	2
Fish meal a	431	431	431	431	431
Poultry meal a	150	150	150	150	150
Pork meal a	150	150	150	150	150
Corn starch b	159	154	149	144	139
Salvia sp. essential oil c	0	5	10	15	20
Fish oil d	40	40	40	40	40
Soy lecithin e	40	40	40	40	40
Grenetine f	20	20	20	20	20
Vit-Min Premix g	5	5	5	5	5
Vitamin C h	5	5	5	5	5
Chemical composition (g/100 g dry matter)
Gross energy (Kj/g)	17.69	17. 70	17.67	17.71	17.68
Protein (%)	43.69	44.57	43.33	42.99	43.14
Ether extract (%)	15.05	14.77	14.93	15.16	15.08
Fiber (%)	1.03	1.13	1.19	0.99	1.13
Ash (%)	15.06	14.92	14.16	15.26	14.38
NFE (%)	25.27	24.68	26.43	25.68	26. 25

^a Marine and agricultural proteins S.A. de C.V., Guadalajara, Jalisco; ^b IMSA Corn Industrializer S.A de C.V. Guadalajara, Jalisco, México; ^c Perfumería Roxana, Villahermosa, Tabasco, México; ^d PROTMAGRO Proteínas Marinas y Agropecuarias S.A. de C.V. Guadalajara, Jalisco, México; ^e Food Technologies trading S.A. de C.V. Cuautitlán Izcalli, México; ^f D’gari, food and diet products relámpago S.A. de C.V.; ^g Vitamin premix composition g, mg, or International Units per kg of diet: Vitamin A, 10,000,000 IU; Vitamin D3, 2,000,000 IU; Vitamin E, 100,000 IU; Vitamin K3, 4.0 g; Thiamine B1, 8.0 g; Riboflavin B2, 8.7 g; Pyridoxine B6, 7.3 g; Vitamin B12, 20.0 mg; Niacin, 50.0 g; Pantothenic acid, 22.2 g; Inositol, 0.15 mg; Nicotinic Acid, 0.16 mg; Folic Acid, 4.0 g; Biotin, 500 mg; Vitamin C, 10.0 g; Choline, 0.3 mg, Excipient q.s., 2 g; Manganese, 10 g; Magnesium, 4.5 g; Zinc, 1.6 g; Iron, 0.2 g; Copper, 0.2 g; Iodine, 0.5 g; Selenium, 40 mg; Cobalt, 60 mg; Excipient q.s., 1.5 g; ^h ROVIMIX^® STAY-C^® 35-DSM, Guadalajara, México; GELPHARMA, S.A. de C.V. NFE = nitrogen-free extract: 100 − (%protein − %ethereal extract − %ash − %fiber).

). To verify the protein, lipid, ash, and fiber levels of the diets, chemical proximal analyses were performed at the Faculty of Marine Sciences of the Autonomous University of Baja California, Mexico, using the AOAC method [52]. Additionally, Standard procedures determined the proximate composition of the diets. Crude protein (CP) was quantified through micro-Kjeldahl method with a conversion factor of 6.25.7. For crude lipids (CL), a variant of the Folch method was used, using dichloromethane–methanol (2:1) as the extract solvent. To determine moisture content, samples were dried at 105 °C until constant weight was achieved. Ash content was determined by incinerating the samples at 550 °C for 6 h. Nitrogen-free extract (NFE) was estimated by subtracting the percentages of moisture, crude protein, crude lipid, and ash from 100% of the sample. The gross energy was analyzed by direct combustion in an oxygen bomb calorimeter (PARR Instruments, model 1261).

2.6. Fish Sampling

The primacy of animal welfare over scientific interest and, ethical principles are aligned to Helsinki Declaration for scientific justification and minimization of animal suffering under experimentation in accordance with the 3R principles of this declaration (Replacement, Reduction, and Refinement), the recommendations for the welfare of farmed fish of the Aquatic Animal Health Code by the World Organization for Animal Health [53], the closest national regulatory framework for the use of animals in research NOM-062-ZOO-2000, NOM-033-SAG/ZOO-2014, and the protocol and experiment were approved by the Institutional Commission of Ethics in Research of the Universidad Juárez Autónoma de Tabasco, Mexico (CIEI-2025-073).

At the end of the bioassay, the larvae (5 individuals per tank, N = 15 per treatment) were euthanized with an overdose of anesthetic (clove oil, 0.1 mL/L of water) [51], Each organism was dissected to remove the visceral package, then homogenized in 5 volumes (w/v) of cold distilled water (4 °C) using a biological replicate and an Ultraturax tissue disruptor. The homogenate was centrifuged at 17,709× g for 15 min at 4 °C. The supernatant was recovered and stored at −80 °C until analysis.

2.7. Digestive Enzyme Analysis

To determine digestive enzyme activity, the soluble protein of each multi-enzyme extract was previously calculated using the Bradford technique [52]. The activities of alkaline protease, acid protease, trypsin, chymotrypsin, leucine aminopeptidase, lipase, and amylase were determined from these extracts.

Alkaline protease-like activity was estimated using the Walter method [54] with 0.25% casein as the substrate in a 50 mM Tris/HCl buffer at pH 9. Acid protease (pepsin activity) was measured using the Anson technique [55], in which 0.25% hemoglobin in a 0.1 mM Glycine/HCl buffer, pH 2, was the substrate. The mixtures were incubated at 37 °C, and the reaction was stopped by the addition of 0.5 mL of 10% TCA; the absorbance of the reaction products was measured at 280 nm in a light spectrophotometer. The unit of enzyme activity was defined as 1 μg of tyrosine released per minute, based on the molar extinction coefficient (0.005 mL μg⁻¹ cm⁻¹). Trypsin activity was measured as described by Erlanger et al. [56], at 37 °C and with BAPNA (N-α-benzoyl-DL-arginine p-nitroanilide) as substrate in 50 mM Tris-HCl buffer at pH 8.2 (with 10 mM CaCl₂). Chymotrypsin activity was identified using the method of DelMar et al. [57], at 37 °C with SAAPNA (N-succinyl-ala-ala-pro-phe p-nitroanilide) as substrate in 10 mM DMSO and 100 mM Tris/HCl (with 10 mM CaCl₂) at pH 7.8. Leucine aminopeptidase activity was determined using leucine p-nitroanilide in 0.1 mM DMSO, with 50 mM sodium phosphate buffer, at pH 7.2, and 37 °C [58]. In the techniques described above, reactions were stopped with 30% acetic acid. The enzyme activity was defined as 1 μg of nitroanilide released per minute, using the molar extinction coefficients of trypsin (8.8), chymotrypsin, and leucine-aminopeptidase (8.2 mL μg⁻¹ cm⁻¹). The amylase activity was determined according to [59] using 2% starch as the substrate in 100 mM citrate-phosphate buffer with 50 mM NaCl, pH 7.5; the reaction product was measured at 600 nm. The lipase activity was determined according to the technique of [60] using 100 mM β-naphthyl acetate as substrate in 50 mM Tris-HCl buffer (pH 7.5) with 100 mM sodium cholate; the reaction was measured at 540 nm. The specific activity of the extracts was expressed using the following equations: (1) Units per mL = (Δabs × final reaction volume (mL)/(MEC × time (min) × extract volume (mL)) and (2) Units per mg of protein = Units per mL/mg of soluble protein, where Δabs represents the absorbance increase at a given wavelength and MEC represents the molar extinction coefficient for the reaction product (mL μg⁻¹ cm⁻¹). All assays were performed in triplicate.

2.8. Antioxidant Enzyme Analysis

For the evaluation of antioxidant enzymes, the previously obtained extracts were used, and measurements of the following enzymes were performed: glutathione peroxidase (GPx) levels were determined kinetically using the glutathione peroxidase cellular activity assay kit (Cat. CGP1, Sigma-Aldrich, St. Louis, MO, USA). Catalase (CAT) enzyme activity was determined using the specific kinetic kit (Cat. 707002, Cayman Chem., Ann Arbor, MI, USA). The superoxide dismutase (SOD) assay kit (Cat. 19160, Sigma-Aldrich Corp., MO, USA) was used to examine the activities in spleen and liver. The assay kit (Cat. T5525, 3,3′, 5,5′-Tetramethylbenzidine, Sigma-Aldrich, MO, USA) was used to determine the peroxidase (PEROx) activity. The antioxidant enzyme activities were normalized to the soluble protein content by the Bradford technique [52]. SOD, GPx, PEROx U/mg protein (Units of enzymatic activity (U) are present for each milligram (mg) of total protein in the sample), and CAT nm/min/mg protein (nanometers per minute per milligram of protein) activities were calculated according to the supplier’s instructions.

2.9. Analysis of Immune System Gene Expression

Total RNA was extracted from visceral tissue using the RNeasy Mini kit (74102, Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Quantification and quality assessment of the RNA were performed by spectrophotometric analysis at 260 and 280 nm (NanoDrop 2000, Thermo Fisher Scientific, Madrid, Spain). RNA integrity of the extracted sample was verified by visualizing the ribosomal RNA subunits (28S and 18S) on a 1.2% agarose gel. cDNA was synthesized via the reverse transcription of RNA in 20 μL per reaction volume with 2 μg of total RNA using SuperScript™ First Strand Synthesis System for RT-PCR (Invitrogen, Waltham, MA, USA) with oligo (dT) (0.5 μg μL⁻¹), random hexamer primers (50 ng μL⁻¹) and 10 mmol L⁻¹ dNTP mix, 10× RT buffer [200 mmol L⁻¹ Tris-HCl (pH = 8.4), 500 mmol L⁻¹ KCl], 25 mmol L⁻¹ MgCl₂, 0.1 mol L⁻¹ DTT, RNaseOUT (40 U μL⁻¹) and SuperScript™ II RT, followed by RNase H treatment. The resulting cDNA was diluted 1:20 in DEPC-treated water, and the diluted samples were used for gene expression analysis.

qPCR reactions were performed in triplicate for each individual per treatment using a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Madrid, Spain). The reaction mixture was standardized to 20 μL, with a consistent aliquot of 10 μL of SsoAdvanced™ Universal SYBR ^® Green Supermix (Life Technologies, Carlsbad, CA, USA), 0.50 μL of forward primer, 0.50 μL of reverse primer, 2 μL of cDNA tissue sample, and 7 μL of RNase/DNase-free water. The qPCR assay workflow began at 95 °C for 3 min, followed by 40 cycles of 15 s at 95 °C, 30 s at the annealing temperature specific to each primer pair, and a 30 s melting curve step at 72 °C to establish the standard curve for each amplicon. Relative expression was determined via CFX Manager 3.0 software (Bio-Rad, Madrid, Spain), with elongation factor 1 alpha (EF1α) as an endogenous control, while basal samples (control) and sage groups were used to normalize relative quantification within each experimental diet group. All samples were run in triplicate to confirm the absence of genomic DNA contamination, using a negative control reaction in which the RT enzyme was omitted. Additionally, an extra negative control was placed on each plate, containing no cDNA. The primers used in this study (

Table 2. Oligonucleotide design for real-time polymerase chain reaction (qPCR) of immune and antioxidant system genes in A. tropicus larvae.

Gene Name	Symbol	Primer Sequence (5′-3′)	Amplicon Size (pb)	Reference
Elongation factor 1 α	ef-1	FW: ACGCTGAAGGCCGGCATGGTG RV: GGATGTCCTTCACCGACACGTTC	-	[61]
Mucin 2	muc-2	FW: GGCCTCCTCAAGAGCACGGTG RV: TCTGCACGCTGGAGCACTCAATG	100	[62]
Interleucin-10	il-10	FW: TTATAAAGCCATGGGGGAGCTG RV: CTGCACAGTCTGCCTCTAGT	91	[47]
Occludens zone 1	zo-1	FW: TGTGCCTCAGATCACTCCAC RV: AAAGGCAGAGGGTTGGCTTC	123	[43]
Occludens zone 2	zo-2	FW: TACCCATGGAAAATGTGCCTCA RW: CGGGGTCTCTTCACGGTAAT	88	[43]
Occludine	occ	FW: TGACGAATACCACAGACTGAAG RW: CGATCATAGTCGCTGACCATC	123	[61]
Nucleotide-binding oligomerization	nod-2	FW: GTAGTGAACAAGGAGGCGGAC RV: TGAGCTCATCCAGGCCATCG	295	[61]

) were previously designed from the A. tropicus larval transcriptome (BioProject PRJNA395289) and published by Martínez-Burguete et al. [40].

2.10. Statistical Analysis

To assess growth, enzyme activity, and gene expression, normality (Kolmogorov–Smirnov) and homoscedasticity (Levene) tests were performed, respectively. A one-way analysis of variance (ANOVA) was then performed to determine differences between treatments for each quality criterion, followed by Tukey’s post hoc test. To determine the optimal levels of supplementation of S. officinalis oil, a second-order quadratic model (Y = a + bX + cX2) was applied in relation to the average weight and total length growth values on the inclusion levels. All statistical analyses were performed using GraphPad Prism 10 software (La Jolla, CA, USA) with a significance level of 0.05.

3. Results

3.1. Chromatographic Characterization

Through chromatographic characterization, the predominant volatile compounds present in Salvia officinalis oil, characterized by its bioactive properties, were identified (

Table 3. GC/FID analysis was used to quantify the main volatile components in sage essential oil.

Compound Name	% Retention Area	Compound Name	% Retention Area
Camphor	27.368	trans-β-Ocimene	0.067
1,8-Cineole	18.514	cis-Sabinene hydrate	0.063
α-Pinene	11.547	cis-β-Ocimene	0.053
D-Limonene	8.582	δ-Cadinene	0.052
Linalyl acetate	5.981	α-Phellandrene	0.05
Camphene	4.641	Bornyl propionate	0.046
Borneol	4.014	Myrtenol	0.045
Bornyl acetate	2.978	α-Terpinene	0.041
β-Pinene	2.886	Neryl acetate	0.039
α-Terpineol	1.815	α-Campholenal	0.038
Linalool	1.672	Isoborneol	0.033
β-Myrcene	1.368	Pinocarvone	0.033
α-Terpinyl acetate	1.272	cis-Linalool oxide	0.031
trans-Sabinyl acetate	1.072	p-Cymen-8-ol	0.031
Sabinene	0.774	α-Gurjunene	0.030
β-Caryophyllene	0.636	α-Muurolene	0.029
p-Cymene	0.591	δ-Terpinyl acetate	0.028
cis-p-Mentha-2,8-dien-1-ol	0.558	trans-p-Mentha-2,8-dien-1-ol	0.026
4-Terpineol	0.412	γ-Cadinene	0.024
γ-Terpinene	0.321	Longifolene	0.023
α-Humulene	0.187	Fenchol	0.022
Tricyclene	0.185	β-Elemene	0.021
Geranyl propionate	0.184	Thujone	0.020
α-Terpinolene	0.165	Shyobunol	0.019
Spathulenol	0.142	tau.-Cadinol	0.017
Geranyl acetate	0.141	δ-3-carene	0.015
α-Thujene	0.114	Carvacrol	0.015
Bicyclogermacrene	0.089	Alloaromadendrene	0.013
Viridiflorol	0.083	Aromandendrene	0.011
β-Caryophyllene oxide	0.071	α-Cadinol	0.01

). Camphor, 1,8-cineole, α-pinene, D-limonene, and linalyl acetate are notable.

3.2. Antimicrobial Activity of S. officinalis Essential Oil

The antimicrobial activity of S. officinalis essential oil against ten fish pathogenic bacteria was evaluated using agar well diffusion and disk diffusion assays at three concentrations: undiluted, 50%, and 25%. In both assays, a dose-dependent effect was observed, with a progressive decrease in inhibition zone diameter as the concentration of the essential oil decreased (

Table 4. Inhibition zones (mm) of Salvia officinalis essential oil against fish pathogenic bacteria, evaluated by agar wells and disk diffusion assays at three concentrations.

Salvia officinalis Essential Oil (%)
Collection No.	Microorganism	Well Diffusion (mm)			Disk Diffusion (mm)
		100	50	25	100	50	25
NCIBM 11343	Aeromonas hydrophila	20.11	15.95	12.76	15.04	12.48	9.92
CAIM 1873	Aeromonas dhakensis	19.95	16.12	13.17	12.64	10.72	7.52
CAIM 1876	Aeromonas ichthiosmia	19.66	15.11	13.61	8.16	7.36	7.52
CAIM 658	Staphylococcus arlettae	16.68	14.35	12.69	NA	NA	NA
UJAT 002	Staphylococcus arlettae	15.94	13.83	12.51	NA	NA	NA
ATCC 17802	Vibrio parahaemolitycum	19.80	17.50	13.91	13.60	11.41	9.14
CAIM 1622	Vibrio harveyi	18.71	15.90	13.61	NA	NA	NA
CIBGEN 001	Vibrio campbellii	19.35	16.47	14.00	9.80	NA	NA
CIBGEN 002	Vibrio diabolicus	22.43	18.98	16.05	9.74	9.43	7.52
CAIM 1910	Photobacterium damselae	17.97	16.12	14.42	14.45	12.60	11.17

). In the well diffusion assay, the oil exhibited broad-spectrum activity, inhibiting the growth of all bacterial strains tested, regardless of the concentration applied. The highest antimicrobial effect was recorded against Gram-negative bacteria, particularly those of the genus Aeromonas. At the highest concentration, inhibition zones of 20.11 mm, 19.95 mm, and 19.66 mm were observed for A. hydrophila, A. dhakensis, and A. ichthiosmia, respectively (Figure 1). Moderate inhibition was also observed against V. harveyi, V. parahaemolyticum, and V. campbellii, with halos ranging from 18.71 mm to 13.61 mm depending on the dilution. The largest inhibition zone was recorded for Vibrio diabolicus, with a diameter of 22.43 mm. In contrast, the Gram-positive strains of Staphylococcus arlettae (CAIM 658 and UJAT 002) showed the lowest sensitivity, with inhibition zones ranging from 16.68 mm to 12.51 mm.

3.3. Growth and Survival

Growth, survival, and feed quality parameters in A. tropicus larvae (

Table 5. Growth variables, percent survival, and food quality indexes of A. tropicus larvae fed different dietary S. officinalis supplementation (Mean ± SD).

Indexes	0%S	0.5%S	1%S	1.5%S	2%S
Initial weight (g)	0.112 ± 0.061	0.111 ± 0.052	0.115 ± 0.041	0.117 ± 0.055	0.112 ± 0.057
Final weight (g)	0.23 ± 0.07 b	0.48 ± 0.22 a	0.42 ± 0.19 ab	0.39 ± 0.08 ab	0.49 ± 0.17 a
Weight gain (%) 2	47.1 ± 19.5	73.9 ± 9.6	69.1 ± 12.7	69.4 ± 6.4	75.1 ± 9.47
SGR (%/day) 1	5.2 ± 0.3	6.0 ± 0.4	5.8 ± 0.4	5.8 ± 0.2	6.0 ± 0.4
CF 3	0.29 ± 0.08	0.33 ± 0.03	0.37 ± 0.04	0.33 ± 0.05	0.33 ± 0.02
DFI (g) 4	1.12 ± 0.04	1.11 ± 0.07	1.15 ± 0.05	1.17 ± 0.03	1.12 ± 0.05
FCR 5	4.13 ± 2.17	1.34 ± 0.39	2.05 ± 0.74	2.71 ± 1.69	1.41 ± 0.73
Survival (%) 6	41.7 ± 11.5	58.3 ± 15.3	45.0 ± 10.0	41.7 ± 20.8	61.7 ± 27.5

Means in the same row with different superscripts are significantly different (p < 0.05). ¹ Specific growth rate (SGR): [(ln final weight − ln initial weight)/days] × 100. ² Weight gain (WG%): [final mean weight − initial mean weight)/final mean weight)] × 100. ³ Condition factor (CF): (final mean body weight/final mean body length³) × 100. ⁴ Daily Feed intake (DFI): [(feed intake, g dry matter/number of fish)]/days. ⁵ Feed conversion ratio (FCR): (feed intake, g dry matter)/(fish weight gain, g). ⁶ Survival (%): (final fish number/initial fish number) × 100.

) show significant differences (p < 0.05) only for final average weight (Figure 2A), where larvae fed with S. officinalis oil in their diet showed the greatest significant growth compared to larvae fed the control treatment, particularly with the 0.5% and 2% S. officinalis treatments (0.48 and 0.49 g, respectively). Regarding total length (Figure 2C), no statistically significant differences (p > 0.05) were found between larvae fed sage oil and those fed the control diet. As shown in Figure 2, the quadratic models demonstrated correlation coefficients of 0.43 for average weight and 0.48 for total length. Both models indicated that the optimal dietary supplementation of S. officinalis essential oil in a balanced diet for A. tropicus larvae was found to be 1.66% (Figure 2B) for maximum growth in average weight and 1.77% for maximum growth in total length (Figure 2D). Regarding survival, no significant differences (p > 0.05) were found between the treatments where sage oil was included in the larval diets. However, a pattern emerged in which larvae fed diets supplemented with 0.5% or 2% S. officinalis oil showed the highest values.

3.4. Digestive Enzymes

Regarding digestive enzyme activity, the activity of acid proteases (Figure 3A) and alkaline proteases (Figure 3B) in larvae fed the 1.5% sage oil diet was found to have statistically significantly higher values (p < 0.05) than in larvae fed the other experimental diets. Chymotrypsin (Figure 3D), leucine aminopeptidase (Figure 3E), and amylase (Figure 3G) activity in larvae fed the diet supplemented with 1% sage oil had statistically higher values (p < 0.05) compared to the other treatments. In the case of lipase activity (Figure 3F), larvae fed diets containing 0.5%, 1%, and 1.5% sage oil showed the highest values statistically (p < 0.05) compared to larvae fed 2% sage oil and those on the control diet. On the other hand, trypsin enzymatic activity (Figure 3C) is statistically higher in larvae fed the control diet (p < 0.05) compared to larvae fed diets supplemented with sage oil.

3.5. Oxidative Enzymes

Significant differences (p < 0.05) were detected in the activities of glutathione peroxidase (Gpx, Figure 4A), catalase (CAT, Figure 4B), and superoxide dismutase (SOD, Figure 4C), with larvae fed 1% sage oil showing higher activity than larvae fed the other treatments. In the case of peroxidase activity (PEROx, Figure 4D), values were statistically higher (p < 0.05) in larvae supplemented with 1.5% and 2% sage oil, and those fed the control diet.

3.6. Expression of Immune System Genes

Regarding the expression of mucin-2 (muc2, Figure 5A), higher expression (p < 0.05) was detected in larvae fed the control diet and larvae fed 0.5%, 1%, and 2% sage oil compared to larvae fed the diet supplemented with 1.5% sage oil. Regarding the expression of interleukin 10 (il10, Figure 5B), overexpression was seen in larvae fed the control diet and those fed 0.5% sage oil, which was statistically different (p < 0.05) compared to larvae fed the other treatments. On the other hand, the expression of occludins 1 (zo-1, Figure 5C) and occludins 2 (zo-2, Figure 5D) shows an overexpression in larvae fed with the diet supplemented with 2% sage oil, which is statistically different (p < 0.05) compared to larvae fed with the control diet and those fed with the other diets supplemented with sage oil. In the case of occ expression (Figure 5E), a higher expression was detected in the diet with 2% sage oil. Finally, the expression of nod (Figure 5F) showed a higher expression in larvae fed with diets containing 0.5%, 1% and 1.5% sage oil, being significantly different from the control diet and the diet with 2% sage oil.

4. Discussion

According to the results obtained through chromatographic characterization, the essential oil of Salvia officinalis presented a composition rich in bioactive compounds, including camphor, 1,8-cineole, α-pinene, D-limonene, and linalyl acetate. These compounds have been widely reported in the literature as major constituents of EOs from plants such as Cinnamomum camphora, Alpinia uraiensis, Rosmarinus officinalis, Eucalyptus globulus, Pinus sylvestris, and Citrus aurantifolia and are attributed antioxidant, antimicrobial, and anti-inflammatory properties [63,64,65,66].

On the other hand, antimicrobial analysis revealed that sage oil (Salvia officinalis) exhibits a significant inhibitory effect on bacterial growth, specifically against Aeromonas hydrophila, Aeromonas dhakensis, Aeromonas ichthiosmia, Staphylococcus arlettae, Vibrio parahaemolyticus, Vibrio harveyi, Vibrio campbellii, Vibrio diabolicus, and Photobacterium damselae. This can be attributed to the joint action of its bioactive compounds, primarily oxygenated monoterpenes such as 1,8-cineole, α-thujone, β-thujone, and camphor, which have demonstrated a high capacity to disrupt the integrity of bacterial cell membranes [67,68]. These lipophilic compounds penetrate the lipid bilayer, causing leakage of essential metabolites, membrane depolarization, and metabolic collapse; in addition, they have been observed to induce oxidative stress through the generation of reactive oxygen species (ROS), which damage cellular DNA, proteins, and lipids, affecting bacterial viability [69]. In recent studies, sage oil has shown significant zones of inhibition against Gram-positive bacteria, such as Staphylococcus spp., and Gram-negative bacteria, including Yersinia enterocolitica and Listeria monocytogenes, suggesting a broad spectrum of antimicrobial action [70].

In addition to its antimicrobial properties, sage oil (Salvia officinalis) also showed direct benefits in productive performance, such as growth and enzymatic activity, as well as in the expression of genes of the immune and antioxidant system, since it has various bioactive compounds such as steroids, polyphenols, triterpenoids, diterpenoids and sesquiterpenoids that stimulate good health of the organisms that consume it [15]. Fish fed diets supplemented with 0.5% and 2% sage oil showed greater weight growth compared to the control diet, which did not contain S. officinalis oil, which may be related to the polyphenolic compounds in the oil, since they have been reported as growth promoters in aquaculture [71]. In addition, it has been shown that ursolic acid (triterpenoid) stimulates muscle growth through hypertrophy of skeletal muscle fibers [72]. On the other hand, the digestive enzyme activity of acid proteases, alkaline proteases, chymotrypsin, leucine aminopeptidase (LAP), lipase and amylase of organisms fed with diets supplemented with 0.5%, 1% and 1.5% was higher than in the control diet (0% S. officinalis), which may be influenced by the action of sage oil compounds. In the case of 1,8 cineole, it stimulates gastric secretion and could stimulate pancreatic secretion, creating a favorable environment for the activation of these proteolytic enzymes [73,74] influencing the activity of acid proteases, alkaline proteases and chymotrypsin; phenolic diterpenes such as carnosic acid and carnosol have antioxidant properties that stabilize enzymes and protect their structures against oxidative stress, prolonging their activity [75,76] increasing the activity of LAP and lipases; rosmarinic acid modulates intestinal inflammation and improves the bioavailability of nutrients [77,78], which favors the action of enzymes that act in the small intestine such as amylase and lipases; and, in the case of terpenes such as α and β pinene, linalool and salveno, which have choleretic effects and the production of cholagogues, thus stimulating the production of bile and facilitating the digestion of fats and carbohydrates [79,80], influencing the enzymatic activity of the digestive enzymes. In contrast, trypsin activity was higher in the control treatment than in the treatments added with sage oil, which could be because, during the early stages of larval development, chymotrypsin can activate faster or reach higher levels as part of a compensatory mechanism to ensure efficient protein digestion [81], which agrees with results obtained in previous ontogeny investigations with A. tropicus larvae [49] and Cynoscion nebulosus [82], where they found that chymotrypsin exhibits higher activity than trypsin.

On the other hand, the activity of antioxidant enzymes such as glutathione peroxidase (GPx), catalase (CAT) and superoxide dismutase (SOD) increased in fish fed with the diet supplemented with 1% sage essential oil, while the activity of peroxidase (PEROx) was higher in the control diet and in the diets with 1.5% and 2% sage oil; For its part, the essential oil of S. officinalis contains bioactive compounds such as terpenoids, flavonoids and phenols, which have antioxidant properties, which can induce the activity of endogenous antioxidant enzymes such as GPx, CAT and SOD, which are part of the cellular defense system against oxidative stress, which agrees with studies carried out with Oncorhynchus mykiss, Sparus aurata and Cyprinus carpio [10,26,27]. On the other hand, PEROx, being a non-specific exogenous enzyme, is directly competing with the phenolic and terpenoid compounds of sage oil, such as rosmarinic acid, α-thujone, and 1,8-cineole, so these can directly interfere with the oxidation reaction of PEROx since the oxidizing intermediate (such as hydrogen peroxide) is reduced, binding to the peroxidase enzyme and inactivating it [83,84]. Regarding the expression of immune and antioxidant target genes, we found an overexpression of zo-1, zo-2, occ, and nod in fish fed with treatments supplemented with S. officinalis, which could be mainly due to the activation of the Keap1/Nrf2 (Kelch-like ECH-associated protein 1/Nuclear factor erythroid-related factor 2) antioxidant pathway and the inhibition of inflammation mediated by NF-κB (Nuclear factor kappa light chain-enhancer of activated B cells) and the NLRP3 (NOD-like receptor pyrin domain 3) inflammasome. A study in a DSS (dextran sodium sulfate)-induced colitis model in mice [85] demonstrated that carnosic acid blocks the Keap1–Cullin3 interaction, stabilizing Nrf2, which leads to the induction of antioxidant genes such as heme oxygenase-1, glutathione peroxidase 2, and superoxide dismutase 2 (HO-1, GPX 2, SOD 2). These actions were accompanied by epithelial preservation, decreased levels of proinflammatory cytokines, and reduced caspase-1/NLRP3 activation. As a result, an increase in the expression of tight junction proteins (such as zo-1 and occ) was observed, which underlies the improvement in epithelial integrity. Consequently, it is suggested that similar behavior could be observed in zo-2 and nod 1/nod 2, although these were not directly evaluated in the study.

On the contrary, concerning the muc-2 and il10 genes, no significant differences were found between the control treatment (0% sage) and diets supplemented with sage oil. This absence of effect can be explained by the fact that all treatments were maintained under normal physiological conditions, without exposure to stressors, intestinal inflammation, or immunological challenges, which are classic stimuli for the overexpression of these genes. Previous studies have shown that compounds such as carnosic acid and carnosol do not directly stimulate the expression of anti-inflammatory genes such as il10, but act by preventing the activation of proinflammatory pathways (such as NF-κB and NLRP3), which are not activated under basal experimental conditions [86,87]. Therefore, the function of sage oil can be considered more preventive than stimulatory, as it modulates the immune response only in the presence of an inflammatory stimulus. This hypothesis is supported by previous research, which shows that phytogenic compounds have more potent effects on immune and intestinal mucosal genes when applied in conjunction with infectious challenges or oxidative stress conditions [6,88]. Consequently, the similar levels of muc2 and il10 between groups could reflect a shared state of intestinal homeostasis, in which the mucosa does not require additional adjustments from either the immune system or its protective barrier. The results obtained in this research are consistent with previous research carried out with various aquatic organisms, where they found that sage oil (Salvia officinalis) has positive effects on the growth, immune system, and antioxidant capacities of the organisms that consume it [10,25,26,27,28].

Additionally, the application of EOs has been established as a promising and feasible strategy in modern aquaculture, due to their productivity and benefits for animal health and the sustainability of the system. Multiple recent studies have shown that bioactive compounds present in plant oils such as Origanum vulgare, Salvia officinalis, Thymus vulgaris, or Rosmarinus officinalis promote growth, improve feed conversion, and reduce mortality in commercial species such as tilapia, common carp, rainbow trout, and African catfish [26,89,90]. These positive effects are related to the stimulation of digestive enzymes (proteases, lipases, amylases) thanks to components such as cineole, thymol, or carnosic acid, as well as to the modulation of the intestinal microbiota and the integrity of tight junctions (zo-1, occ), which favor greater nutrient absorption [91,92]. Furthermore, EOs act as natural immunostimulants, inducing the expression of genes related to the innate immune response (NOD, IL-1β, TNF-α), and present antimicrobial properties against aquatic pathogens such as Aeromonas hydrophila, Vibrio spp., and Streptococcus iniae, reducing the need for antibiotics [93,94]. These effects significantly reduce antibiotic use, thereby contributing to the control of antimicrobial resistance—a critical problem in intensive aquaculture. Technologically, the encapsulation and emulsification of EOs have improved their stability during feed processing and their controlled release in the digestive tract, increasing their efficacy without compromising feed palatability [95]. However, their optimal application depends on factors such as species, dose, treatment duration, and synergy with other functional ingredients. Therefore, the development of specific protocols for each species and culture stage is recommended. Consequently, we believe that EOs offer a comprehensive solution that not only improves production performance but also contributes to sustainability and biosecurity in 21st-century aquaculture.

5. Conclusions

This study indicated that diets supplemented with 1.66% and 1.77% of sage (S. officinalis) essential oil for tropical gar (A. tropicus) larvae have multibeneficial effects on weight growth, digestive and antioxidant enzyme activity, as well as on the expression of immune and antioxidant system genes, which can be attributed to the synergy of the oil’s bioactive compounds such as terpenes and polyphenols, which act as growth promoters as well as preventive agents and modulators of intestinal and enzymatic health, so we consider that supplementation could strengthen the intestinal barrier and the body’s defense capacity against future pathogenic or stress challenges, contributing to a more sustainable aquaculture by reducing dependence on antibiotics and other additives; however, future research should attempt to replicate the study using a more diverse population and different life stages to increase the generalizability of this findings, and further analytics must be carried out to fully understand the impact on different mechanisms of action to determine the understand the long-term effects.