A Novel Oligonucleotide Pair for Genotyping Members of the Pseudomonas Genus by Single-Round PCR Amplification of the gyrB Gene
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains
2.2. Primer Design
2.3. PCR Reaction
2.4. PCR-RFLP
3. Results
3.1. Primer Pair Design and In Silico Tests
3.2. In Vitro Assay with Target Microorganisms
3.3. PCR-RFLP
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Reece, R.J.; Maxwell, A. DNA Gyrase: Structure and Function. Crit. Rev. Biochem. Mol. Biol. 1991, 26, 335–375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamamoto, S.; Kasai, H.; Arnold, D.L.; Jackson, R.W.; Vivian, A.; Harayama, S. Phylogeny of the genus Pseudomonas: Intrageneric structure reconstructed from the nucleotide sequences of gyrB and rpoD genes. Microbiology 2000, 146 Pt 1, 2385–2394. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huard, R.C.; Fabre, M.; De Haas, P.; Lazzarini, L.C.O.; Van Soolingen, D.; Cousins, D.; Ho, J.L. Novel genetic polymorphisms that further delineate the phylogeny of the Mycobacterium tuberculosis complex. J. Bacteriol. 2006, 188, 4271–4287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martinez-Murcia, A.J.; Monera, A.; Saavedra, M.J.; Oncina, R.; Lopez-Alvarez, M.; Lara, E.; Figueras, M.J. Multilocus phylogenetic analysis of the genus Aeromonas. Syst. Appl. Microbiol. 2011, 34, 189–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Avalos, E.; Catanzaro, D.; Catanzaro, A.; Ganiats, T.; Brodine, S.; Alcaraz, J.; Rodwell, T. Frequency and geographic distribution of gyrA and gyrB mutations associated with fluoroquinolone resistance in clinical Mycobacterium tuberculosis isolates: A systematic review. PLoS ONE 2015, 10, 1–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chan, P.F.; Srikannathasan, V.; Huang, J.; Cui, H.; Fosberry, A.P.; Gu, M.; Hann, M.M.; Hibbs, M.; Homes, P.; Ingraham, K.; et al. Structural basis of DNA gyrase inhibition by antibacterial QPT-1, anticancer drug etoposide and moxifloxacin. Nat. Commun. 2015, 6, 10048. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gomila, M.; Peña, A.; Mulet, M.; Lalucat, J.; García-Valdés, E. Phylogenomics and systematics in Pseudomonas. Front. Microbiol. 2015, 6, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brady, C.; Cleenwerck, I.; Venter, S.; Vancanneyt, M.; Swings, J.; Coutinho, T. Phylogeny and identification of Pantoea species associated with plants, humans and the natural environment based on multilocus sequence analysis (MLSA). Syst. Appl. Microbiol. 2008, 31, 447–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pascual, J.; Macián, M.C.; Arahal, D.R.; Garay, E.; Pujalte, M.J. Multilocus sequence analysis of the central clade of the genus Vibrio by using the 16S rRNA, recA, pyrH, rpoD, gyrB, rctB and toxR genes. Int. J. Syst. Evol. Microbiol. 2010, 60, 154–165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martens, M.; Dawyndt, P.; Coopman, R.; Gillis, M.; De Vos, P.; Willems, A. Advantages of multilocus sequence analysis for taxonomic studies: A case study using 10 housekeeping genes in the genus Ensifer (including former Sinorhizobium). Int. J. Syst. Evol. Microbiol. 2008, 58, 200–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Young, J.M.; Park, D.C.; Shearman, H.M.; Fargier, E. A multilocus sequence analysis of the genus Xanthomonas. Syst. Appl. Microbiol. 2008, 31, 366–377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamamoto, S.; Harayama, S. PCR amplification and direct sequencing of gyrB genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl. Environ. Microbiol. 1995, 61, 1104–1109. [Google Scholar] [PubMed]
- Santos, S.R.; Ochman, H. Identification and phylogenetic sorting of bacterial lineages with universally conserved genes and proteins. Environ. Microbiol. 2004, 6, 754–759. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mulet, M.; Lalucat, J.; García-Valdés, E. DNA sequence-based analysis of the Pseudomonas species. Environ. Microbiol. 2010, 12, 1513–1530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vaz-Moreira, I.; Nunes, O.C.; Manaia, C.M. Diversity and antibiotic resistance in Pseudomonas spp. from drinking water. Sci. Total Environ. 2012, 426, 366–374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rico, A.; López, R.; Asensio, C.; Aizpún, M.T.; Asensio-S-Manzanera, M.C.; Murillo, J. Nontoxigenic strains of Pseudomonas syringae pv. phaseolicola are a main cause of halo blight of beans in Spain and escape current detection methods. Phytopathology 2003, 93, 1553–1559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, C.S.; Wetzel, K.; Buckley, T.; Wozniak, D.; Lee, J. Rapid and sensitive detection of Pseudomonas aeruginosa in chlorinated water and aerosols targeting gyrB gene using real-time PCR. J. Appl. Microbiol. 2011, 111, 893–903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, J.; Brettar, I.; Luo, C.; Auchtung, J.; Konstantinidis, K.T.; Rodrigues, J.L.M.; Höfle, M.; Tiedje, J.M. Stability, genotypic and phenotypic diversity of Shewanella baltica in the redox transition zone of the Baltic Sea. Environ. Microbiol. 2014, 16, 1854–1866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goss, E.M.; Kreitman, M.; Bergelson, J. Genetic diversity, recombination and cryptic clades in Pseudomonas viridiflava infecting natural populations of Arabidopsis thaliana. Genetics 2005, 169, 21–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agaras, B.C.; Wall, L.G.; Valverde, C. Specific enumeration and analysis of the community structure of culturable pseudomonads in agricultural soils under no-till management in Argentina. Appl. Soil Ecol. 2012, 61, 305–319. [Google Scholar] [CrossRef] [Scilit]
- Schweizer, H.P.; de Lorenzo, V. Molecular Tools for Genetic Analysis of pseudomonads. In Pseudomonas; Springer US: Boston, MA, USA, 2004; pp. 317–350. [Google Scholar]
- Silby, M.W.; Winstanley, C.; Godfrey, S.A.C.; Levy, S.B.; Jackson, R.W. Pseudomonas genomes: Diverse and adaptable. FEMS Microbiol. Rev. 2011, 35, 652–680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mulet, M.; Bennasar, A.; Lalucat, J.; García-Valdés, E. An rpoD-based PCR procedure for the identification of Pseudomonas species and for their detection in environmental samples. Mol. Cell. Probes 2009, 23, 140–147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andreani, N.A.; Martino, M.E.; Fasolato, L.; Carraro, L.; Montemurro, F.; Mioni, R.; Bordin, P.; Cardazzo, B. Reprint of ’Tracking the blue: A MLST approach to characterise the Pseudomonas fluorescens group. Food Microbiol. 2015, 45, 148–158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moynihan, J.A.; Morrissey, J.P.; Coppoolse, E.R.; Stiekema, W.J.; Gara, F.O.; Boyd, E.F. Evolutionary History of the phl Gene Cluster in the Plant-Associated Bacterium Pseudomonas fluorescens. Appl. Environ. Microbiol. 2009, 75, 2122–2131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pezza, R.J.; Smania, A.M.; Barra, J.L.; Argaraña, C.E. Nucleotides and heteroduplex DNA preserve the active conformation of Pseudomonas aeruginosa MutS by preventing protein oligomerization. Biochem. J. 2002, 361, 87–95. [Google Scholar] [CrossRef] [PubMed]
- Holloway, B.W. Genetics of Pseudomonas. Bacteriol. Rev. 1969, 33, 419–443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeong, J.J.; Kim, J.H.; Kim, C.K.; Hwang, I.; Lee, K. 3- and 4-alkylphenol degradation pathway in Pseudomonas sp. strain KL28: Genetic organization of the lap gene cluster and substrate specificities of phenol hydroxylase and catechol 2,3-dioxygenase. Microbiology 2003, 149, 3265–3277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agaras, B.C.; Scandiani, M.; Luque, A.; Fernández, L.; Farina, F.; Carmona, M.; Gally, M.; Romero, A.; Wall, L.G.; Valverde, C. Quantification of the potential biocontrol and direct plant growth promotion abilities based on multiple biological traits distinguish different groups of Pseudomonas spp. isolates. Biol. Control 2015, 90, 173–186. [Google Scholar] [CrossRef] [Scilit]
- Weller, D.M.; Cook, R.J. Suppression of Take-All of wheat by seed treatments with fluorescent Pseudomonads. Phytopathology 1983, 73, 463–469. [Google Scholar] [CrossRef] [Scilit]
- Bailey, M.J.; Lilley, A.K.; Thompson, I.P.; Rainey, P.B.; Ellis, R.J. Site directed chromosomal marking of a fluorescent pseudomonad isolated from the phytosphere of sugar beet; stability and potential for marker gene transfer. Mol. Ecol. 1995, 4, 755–764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stutz, E.W.; Défago, G.; Kern, H. Naturally ocurring fluorescent pseudomonads involved in supression of black root rot of tobacco. Phytopathology 1986, 76, 181–185. [Google Scholar] [CrossRef] [Scilit]
- Howell, C.R.; Stipanovic, R.D. Control of Rhizoctonia solani on cotton seedlings with Pseudomonas fluorescens and with an antibiotic produced by the bacterium by the soil tube method described previously. Phytopathology 1979, 69, 480–482. [Google Scholar] [CrossRef] [Scilit]
- Stanier, R.Y.; Palleroni, N.J.; Doudoroff, M. The aerobic pseudomonads: A taxonomic study. J. Gen. Microbiol. 1966, 43, 159–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lifshitz, R.; Kloepper, J.W.; Scher, F.M.; Tipping, E.M.; Laliberté, M. Nitrogen-fixing pseudomonads isolated from roots of plants grown in the canadian high arctic. Appl. Environ. Microbiol. 1986, 51, 251–255. [Google Scholar] [PubMed]
- Bagdasarian, M.M.; Lurz, R.; Rückert, B.; Franklin, F.C.; Bagdasarian, M.M.; Frey, J.; Timmis, K.N. Specific-purpose plasmid cloning vectors II. Broad host range, high copy number, RSF1010-derived vectors, and a host-vector system for gene cloning in Pseudomonas. Gene 1981, 16, 237–247. [Google Scholar] [CrossRef] [Scilit]
- Ordoñez, O.F.; Flores, M.R.; Dib, J.R.; Paz, A.; Farías, M.E. Extremophile culture collection from Andean lakes: extreme pristine environments that host a wide diversity of microorganisms with tolerance to UV radiation. Microb. Ecol. 2009, 58, 461–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berendsen, R.L.; van Verk, M.C.; Stringlis, I.A.; Zamioudis, C.; Tommassen, J.; Pieterse, C.M.J.; Bakker, P.A.H.M. Unearthing the genomes of plant-beneficial Pseudomonas model strains WCS358, WCS374 and WCS417. BMC Genomics 2015, 16, 539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davis, K.R.; Schott, E.; Ausubel, F.M. Virulence of selected phytopathogenic pseudomonads in Arabidopsis thaliana. MPMI 1991, 4, 477–488. [Google Scholar] [CrossRef] [Scilit]
- Cuppels, D.M. Generation and characterization of Tn5 insertion mutations in Pseudomonas syringae pv. tomato. Appl. Environ. Microbiol. 1986, 51, 323–327. [Google Scholar] [PubMed]
- Parte, A.C. LPSN—List of prokaryotic names with standing in nomenclature. Nucleic Acids Res. 2014, 42, 613–616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jullien, N. AmplifX Version 1.7.0. Available online: http://crn2m.univ-mrs.fr/pub/amplifx-dist (accessed on 25 June 2018).
- Kalendar, R.; Lee, D.; Schulman, A.H. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analyses. Genomics 2011, 98, 137–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalendar, R.; Khassenov, B.; Ramankulov, Y.; Samuilova, O.; Ivanov, K.I. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics 2017, 109, 312–319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalendar, R.; Tselykh, T.V.; Khassenov, B.; Ramanculov, E.M. Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis; Springer: New York, NY, USA, 2017; pp. 33–64. [Google Scholar]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Perez, F. Serial Cloner 2.6.1. Available online: http://serialbasics.free.fr/Serial_Cloner.html (accessed on 25 June 2018).
- Frackman, B.S.; Kobs, G.; Simpson, D.; Storts, D. Betaine and DMSO: Enhancing Agents for PCR. Promega Notes 1998, 65, 9–12. [Google Scholar]
- Wu, M.; Wen, J.; Chang, M.; Yang, G.; Zhou, S. Pseudomonas sihuiensis sp. nov., isolated from a forest soil in South China. Antonie van Leeuwenhoek. Int. J. Gen. Mol. Microbiol. 2014, 105, 781–790. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waterhouse, A.M.; Procter, J.B.; Martin, D.M.A.; Clamp, M.; Barton, G.J. Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Crooks, G.; Hon, G.; Chandonia, J.; Brenner, S. WebLogo: A sequence logo generator. Genome Res. 2004, 14, 1188–1190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frasson, D.; Opoku, M.; Picozzi, T.; Torossi, T.; Balada, S.; Smits, T.H.M.; Hilber, U. Pseudomonas wadenswilerensis sp. nov. and Pseudomonas reidholzensis sp. nov., two new species within the Pseudomonas putida group isolated from forest soil. Int. J. Syst. Evol. Microbiol. 2017, 67, 2853–2861. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mulet, M.; Gomila, M.; Scotta, C.; Sánchez, D.; Lalucat, J.; García-Valdés, E. Concordance between whole-cell matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry and multilocus sequence analysis approaches in species discrimination within the genus Pseudomonas. Syst. Appl. Microbiol. 2012, 35, 455–464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peix, A.; Valverde, A.; Rivas, R.; Igual, J.M.; Ramírez-Bahena, M.-H.; Mateos, P.F.; Santa-Regina, I.; Rodríguez-Barrueco, C.; Martínez-Molina, E.; Velázquez, E. Reclassification of Pseudomonas aurantiaca as a synonym of Pseudomonas chlororaphis and proposal of three subspecies, P. chlororaphis subsp. chlororaphis subsp. nov., P. chlororaphis subsp. aureofaciens subsp. nov. Int. J. Syst. Evol. Microbiol. 2007, 57, 1286–1290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peix, A.; Ramírez-Bahena, M.-H.; Velázquez, E. Historical evolution and current status of the taxonomy of genus Pseudomonas. Infect. Genet. Evol. 2009, 9, 1132–1147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mulet, M.; Gomila, M.; Gruffaz, C.; Meyer, J.-M.; Palleroni, N.J.; Lalucat, J.; García-Valdés, E. Phylogenetic analysis and siderotyping as useful tools in the taxonomy of Pseudomonas stutzeri: Description of a novel genomovar. Int. J. Syst. Evol. Microbiol. 2008, 58, 2309–2315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garrido-Sanz, D.; Meier-Kolthoff, J.P.; Göker, M.; Martín, M.; Rivilla, R.; Redondo-Nieto, M. Genomic and genetic diversity within the Pseudomonas fluoresces complex. PLoS ONE 2016, 11. [Google Scholar] [CrossRef] [Scilit]
- Peix, A.; Ramírez-Bahena, M.H.; Velázquez, E. The current status on the taxonomy of Pseudomonas revisited: An update. Infect. Genet. Evol. 2018, 57, 106–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cladera, A.M.; Bennasar, A.; Barceló, M.; Lalucat, J.; García-valdés, E.; Cladera, A.M.; Bennasar, A.; Barcelo, M.; Lalucat, J.; García-valde, E. Comparative genetic diversity of Pseudomonas stutzeri genomovars, clonal structure, and phylogeny of the species. J. Bacteriol. 2004, 186, 5239–5248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, G.; Wu, J.; Liu, W.; Zhu, D.; Hu, Y.; Deng, J.; Zhang, X.-E.; Bi, L.; Wang, D.-C. Crystal structure of DNA gyrase B’ domain sheds lights on the mechanism for T-segment navigation. Nucleic Acids Res. 2009, 37, 5908–5916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lagares, A.; Agaras, B.; Bettiol, M.P.; Gatti, B.M.; Valverde, C. A cultivation-independent PCR-RFLP assay targeting oprF gene for detection and identification of Pseudomonas spp. in samples from fibrocystic pediatric patients. J. Microbiol. Methods 2015, 114, 66–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manceau, C.; Horvais, A. Assessment of genetic diversity among strains of Pseudomonas syringae by PCR-restriction fragment length polymorphism analysis of rRNA operons with special emphasis on P. syringae pv. tomato. Appl. Environ. Microbiol. 1997, 63, 498–505. [Google Scholar] [PubMed]
- Pesaro, M.; Widmer, F. Identification and specific detection of a novel pseudomonadaceae cluster associated with soils from winter wheat plots of a long-term agricultural field experiment. Appl. Environ. Microbiol. 2006, 72, 37–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Souza, J.T.; Raaijmakers, J.M. Polymorphisms within the prnD and pltC genes from pyrrolnitrin and pyoluteorin-producing Pseudomonas and Burkholderia spp. FEMS Microbiol. Ecol. 2003, 43, 21–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agaras, B.C.; Wall, L.G.; Valverde, C. Influence of agricultural practices and seasons on the abundance and community structure of culturable pseudomonads in soils under no-till management in Argentina. Plant Soil 2014, 382, 117–131. [Google Scholar] [CrossRef] [Scilit]
- Fernández, L.A.; Agaras, B.; Wall, L.G.; Valverde, C. Abundance and ribotypes of phosphate-solubilizing bacteria in Argentinean agricultural soils under no-till management. Ann. Microbiol. 2015, 65. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.T.; Lee, F.L.; Tai, C.J.; Kasai, H. Comparison of gyrB gene sequences, 16S rRNA gene sequences and DNA-DNA hybridization in the Bacillus subtilis group. Int. J. Syst. Evol. Microbiol. 2007, 57, 1846–1850. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Strain Designation | Origin | Reference or Source |
|---|---|---|
| P. aeruginosa DN | Clinical isolate; Hospital de Niños de La Plata, Argentina | Diego Noseda (CINDEFI—La Plata) |
| P. aeruginosa Hex1T | Hydrocarbon-contaminated soil | [26] |
| P. aeruginosa PAO1 | Clinical isolate; human wound; Melbourne, Australia | [27] |
| P. alkylphenolica KL28 | Soil from an industrial complex in Changwon, Korea | [28] |
| P. chlororaphis SMMP3 | Bulk soil from an agricultural plot under continuous soybean monocropping; Córdoba, Argentina | [29] |
| P. donghuensis SVBP6 | Bulk soil from a plot under good agricultural practices, Entre Ríos, Argentina | [29] |
| Pseudomonas sp. 1008 | Environmental isolate with high phosphate solubilization ability and used a biofertilizer | Rizobacter Argentina S.A. |
| P. fluorescens 2–79 | Soil from an agricultural plot under wheat monocropping; Washington, USA | [30] |
| P. fluorescens SBW25 | Phyllosphere from sugar cane; University Farm, Wytham, Oxford, UK | [31] |
| P. protegens CHA0 | Tobacco rhizosphere; Payerne, Switzerland | [32] |
| P. protegens Pf-5 | Cotton rhizosphere; Texas, USA | [33] |
| P. putida ATCC 17399 | Psycrophilic; Western Utilization Research and Development Division of the US. Department of Agriculture; Albany, California | [34] |
| P. putida GR12-2 | Psycrophilic bacteria isolated from an unidentified grass in the Canadian High Arctic | [35] |
| P. putida KT2440 | Grass rhizosphere, mt-2 derivative; Japan | [36] |
| P. sihuiensis 2013 | Clinical isolate, intrahospitalary infection; Buenos Aires, Argentina | Dr. D. Centrón (Faculty of Medicine; UBA, Argentina) |
| P. sihuiensis N23 | Laguna Negra, Catamarca, Argentina | [37] |
| P. simiae WCS417 | Wheat rhizosphere; Flevoland, The Netherlands | [38] |
| P. stutzeri 2014 | Clinical isolate, intrahospitalary infection; Buenos Aires, Argentina | Dr. D. Centrón (Faculty of Medicine; UBA, Argentina) |
| P. stutzeri 2018 | Clinical isolate, intrahospitalary infection; Buenos Aires, Argentina | Dr. D. Centrón (Faculty of Medicine; UBA, Argentina) |
| P. stutzeri ATCC 17588 | Clinical isolate; human spinal fluid; Copenhagen, Denmark | [34] |
| P. syringae pv. maculicola ES4326 | Radish rhizosphere; USA | [39] |
| P. syringae pv. tomato DC3000 | Spontaneous rifampicin resistant strain from the wild-type isolate DC52 | [40] |
| Pseudomonas sp. 2019 | Clinical isolate, intrahospitalary infection; Buenos Aires, Argentina | Dr. D. Centrón (Faculty of Medicine; UBA, Argentina) |
| Pseudomonas sp. CF5 | Feces from extreme high-altitude wetland | Dr. M.E. Farías (LIMLA; Tucumán, Argentina) |
| Pseudomonas sp. LDe | Salina Grande, Jujuy, Argentina | [37] |
| Gene | Amplicon Size (bp) a | Primer | Sequence (5′ → 3′) | Melting Temp. (°C) b | Annealing Temp. (°C) | |
|---|---|---|---|---|---|---|
| Recommended c | Optimal | |||||
| gyrB | 1461–1467 | gyrB-F | AGCATYAARGTGCTGAARGG | 55.3 | 55–59 | 57 |
| gyrB-R | GGTCATGATGATGATGTTGTG | 53.1 | ||||
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Agaras, B.C.; Valverde, C. A Novel Oligonucleotide Pair for Genotyping Members of the Pseudomonas Genus by Single-Round PCR Amplification of the gyrB Gene. Methods Protoc. 2018, 1, 24. https://doi.org/10.3390/mps1030024
Agaras BC, Valverde C. A Novel Oligonucleotide Pair for Genotyping Members of the Pseudomonas Genus by Single-Round PCR Amplification of the gyrB Gene. Methods and Protocols. 2018; 1(3):24. https://doi.org/10.3390/mps1030024
Chicago/Turabian StyleAgaras, Betina Cecilia, and Claudio Valverde. 2018. "A Novel Oligonucleotide Pair for Genotyping Members of the Pseudomonas Genus by Single-Round PCR Amplification of the gyrB Gene" Methods and Protocols 1, no. 3: 24. https://doi.org/10.3390/mps1030024
APA StyleAgaras, B. C., & Valverde, C. (2018). A Novel Oligonucleotide Pair for Genotyping Members of the Pseudomonas Genus by Single-Round PCR Amplification of the gyrB Gene. Methods and Protocols, 1(3), 24. https://doi.org/10.3390/mps1030024

