The First Report on the Application of ISSR Markers in Genetic Variance Detection among Butterfly Pea (Clitoria ternatea L.) Accession in North Maluku Province, Indonesia
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area and Sample Collection
2.2. Plant Material
2.2.1. Sampling of Plant Material
2.2.2. Total DNA Isolation
2.2.3. PCR Amplification
2.2.4. ISSR-PCR Analysis
3. Results
Molecular Analysis of Butterfly Pea Genetic Diversity Using ISSR Markers
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Center for Agriculture Bioscience International (CABI). Clitoria ternatea L. (Butterfly-Pea). 2019. Available online: https://www.cabi.org (accessed on 26 July 2023).
- Oguis, G.K.; Gilding, E.K.; Jackson, M.A.; Craik, D.J. Butterfly pea (Clitoria ternatea), a cyclotide-bearing plant with applications in agriculture and medicine. Front. Plant Sci. 2019, 10, 645. [Google Scholar] [CrossRef] [PubMed]
- Jain, N.N.; Ohal, C.C.; Shroff, S.K.; Bhutada, R.H.; Somani, R.S.; Kasture, V.S.; Kasture, S.B. Clitoria ternatea and the CNS. Pharmacol. Biochem. Behav. 2003, 75, 529–536. [Google Scholar] [CrossRef]
- Weising, K.; Nybom, H.; Wolff, K.; Meyer, W. DNA Fingerprinting in Plants and Fungi; CRC Press Inc.: Boca Raton, FL, USA, 1995. [Google Scholar]
- Vanijajiva, O.; Suvachittanont, W.; Sirirugsa, P. Isozyme analysis of relationships among Boesenbergia (Zingiberaceae) and related genera in Southern Thailand. Bio. Syst. Eco. 2003, 31, 499–511. [Google Scholar] [CrossRef]
- Pradeep, R.M.; Sarla, N.; Siddiq, E.A. Inter simple sequence repeat (ISSR) polymorphism and its application in plant breeding. Euphytica 2002, 128, 9–17. [Google Scholar] [CrossRef]
- Karuniawan, A.; Ulimaz, T.A.; Kusumiyati, E.; Widiantini, F.; Wicaksana, N.; Dudi, T. Early Identification on the Genetic Diversity of Indonesian Butterfly Pea Accession as Colorant Food Based on Morphological Traits. [Online] PERIPI 2017 International Seminar. Bogor, Indonesia, 2 October. Available online: http://peripi.org/wp-content/uploads/2019/01/paper-09-page-78-83.pdf (accessed on 10 December 2022).
- Suarna, W.; Wijaya, M.S. Butterfly pea (Clitoria ternatea L.: Fabaceae) and its morphological variations in Bali. J. Trop. Biodivers. Biotechnol. 2021, 6, 63013. [Google Scholar] [CrossRef]
- Yeotkar, S.D.; Malode, S.N.; Waghmare, V.N.; Thakre, P. Genetic relationship and diversity analysis of Clitoria ternatea variants and Clitoria biflora using random amplified polymorphic DNA (RAPD) markers. African J. Biotechnol. 2011, 10, 18065–18070. [Google Scholar] [CrossRef]
- Ali, Z.; Ganie, S.H.; Narula, A.; Sharma, M.P.; Srivastava, P.S. Intra-specific genetic diversity and chemical profiling of different accessions of Clitoria ternatea L. Ind. Crops Prod. 2013, 43, 768–773. [Google Scholar] [CrossRef]
- Gu, X.Z.; Cao, Y.C.; Zhang, Z.H.; Zhang, B.X.; Zhao, H.; Zhang, X.M.; Wang, H.P.; Li, X.X.; Wang, L.H. Genetic diversity and population structure analysis of Capsicum germplasm accessions. J. Integr. Agric. 2019, 18, 1312–1320. [Google Scholar] [CrossRef]
- Hildebrand, C.E.; Torney D., C.; Wagner R., P. Informativeness of polymorphic DNA markers. Los Alamos Sci. 1992, 20, 100–102. [Google Scholar]
- Bishoyi, A.K.; Pillai, V.V.; Geetha, K.A.; Maiti, S. Assessment of genetic diversity in Clitoria ternatea populations from different parts of India by RAPD and ISSR markers. Genet. Resour. Crops Evol. 2014, 61, 1597–1609. [Google Scholar] [CrossRef]
- Souza, A.H.C.; Felix, T.M.d.S.; do Monte, A.P.O.; Queiroz, M.A.Á.; Mistura, C.; dos Santos, A.E.O.; Benício, C.A.; Mendes, C.Q. Características morfológicas e produtivas do capim buffel em consórcio com cunhã sob sombreamento. Biosci. J. 2017, 33, 979–990. [Google Scholar] [CrossRef]
- Campbell, S.M.; Pearson, B.J.; Christopher Marble, S. Substrate type and temperature on germination parameters of butterfly PEA. Horttechnology 2020, 30, 398–403. [Google Scholar] [CrossRef]
- Morris, J.B. Characterization of butterfly pea (Clitoria ternatea L.) accessions for morphology, phenology, reproduction and potential nutraceutical, pharmaceutical trait utilization. Genet. Resour. Crops Evol. 2009, 56, 421–427. [Google Scholar] [CrossRef]
- Balasubramanian, A. SOIL TAXONOMY & CLASSIFICATION. Technical Report. 2017. Available online: https://www.researchgate.net/publication/315785518 (accessed on 22 December 2022).
- Li, H.; Li, Z.; Cai, L.; Shi, W.; Mi, F.; Shi, F. Analysis of genetic diversity of Ruthenia medic. (Medicago ruthenica (L.) Trautv.) in Inner Mong olia using ISSR and SSR markers. Genet. Resour. Crops Evol. 2013, 60, 1687–1694. [Google Scholar] [CrossRef]
- Zietkiewicz, E.; Rafalski, A.; Labuda, D. Genome fingerprintingby simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 1994, 20, 176–183. [Google Scholar] [CrossRef]
- Parrota, J.A. Healing Plants of Peninsular India; CABI Publishers: New York, NY, USA, 2001; p. 382. [Google Scholar]
- Dhutmal, R.R.; Mundhe, A.G.; More, A.W. Molecular Marker Techniques: A Review. Int. J. Curr. Microbiol. App. Sci. 2018, 6, 816–825. [Google Scholar]
- Torrelo, A.; Valverde, E.; Zambrano, A. Informativeness of polymorphic markers for prenatal diagnosis of recessive dystrophic epidermolysis bullosa in Spanish families at risk. J. Dermatol. Sci. 1998, 17, 233–238. [Google Scholar] [CrossRef]
- Hartwell, L.H.; Hood, L.; Goldberg, M.L.; Reynolds, A.E.; Silver, L.M.; Veres, R.C. Genetics From Genes to Genomes; The McGraw-Hill Co. Inc.: New York, NY, USA, 2010; p. 816. [Google Scholar]
- McGregor, C.E.; Lambert, C.A.; Greyling, M.M.; Louw, J.H.; Warnich, L. A comparative assessment of DNA fingerprinting techniques (RAPD, ISSR, AFLP and SSR) in tetraploid potato (Solanum tuberosum L.) germplasm. Euphytica 2000, 113, 135–144. [Google Scholar] [CrossRef]
- Matus, I.A.; Hayes, P.M. Genetic diversity in three groups of barley germplasm assessed by simple sequence repeats. Genome 2002, 45, 1095–1106. [Google Scholar] [CrossRef]
- Serrote, C.M.L.; Reiniger, L.R.S.; Silva, K.B.; Rabaiolli, S.M.d.S.; Stefanel, C.M. Determining the Polymorphism Information Content of a molecular marker. Gene 2020, 726, 144175. [Google Scholar] [CrossRef]
- Naik, A.; Mishra, S.K.; Nag, A.; Soren, G.K.; Panda, A.K.; Panda, S.K.; Panigrahi, J. Cross-genera amplification of Cajanus spp. specific SSR markers in Clitoria ternatea (L.) and their application in genetic diversity studies. Physiol. Mol. Biol. Plants 2020, 26, 2371–2390. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhu, Z.Q.; Liu, G.S.; Qi, D.M.; Li, F.F. AFLP Variation Analysis on the Germplasm Resources of Leymus chinensis. Acta Botanica Sinic 2002, 47, 845–851. [Google Scholar]
- Ramos, R.; Song, G.; Navarro, J.; Zhang, R.; Symes, C.T.; Forero, M.G.; Lei, F. Population Genetic Structure and Long-Distance Dispersal of a Recently Expanding Migratory Bird; Elsevier Inc.: Amsterdam, The Netherlands, 2016; Volume 99. [Google Scholar]
- Zhang, J.F.; Kimatu, J.N.; Guo, W.L.; Liu, B. Habitat fragmentation causes rapid sgenetic differentiation and homogenization in natural plant populations—A case study in Leymus chinensis. African J. Biotechnol. 2009, 8, 3440–3447. [Google Scholar]
Districts | Sum of Accessions | Accession Codes | Longitude E | Latitude N |
---|---|---|---|---|
North Halmahera | 1 | Hal 01 | 127°46′55.513″ | 1°14′03.224″ |
South Halmahera | 1 | Hal 01 | 127°26′10.100″ | 0°06′59.400″ |
South Morotai | 6 | Mor 01 | 128°16′05.502″ | 1°59′21.498″ |
Mor 02 | 128°16′08.003″ | 1°59′24.420″ | ||
Mor 03 | 128°16′07.776″ | 1°59′24.156″ | ||
Mor 04 | 128°16′09.174″ | 1°59′26.736″ | ||
Mor 05 | 128°16′29.682″ | 1°59′52.223″ | ||
Mor 06 | 128°22′48.263″ | 2°3′11.193″ | ||
North Tidore | 5 | TDR 01 | 127°21′55.741″ | 0°40′56.199″ |
East Tidore | TDR 02 | 127°27′06.416″ | 0°42′07.130″ | |
South Tidore | TDR 08 | 127°22′2.755″ | 0°38′29.887″ | |
TDR 010 | 127°21′57.475″ | 0°39′28.701″ | ||
North Tidore | TDR 011 | 127°22′49.284″ | 0°41′0,5.041″ | |
Central Ternate | 5 | TTE 02 | 127°22′32.977″ | 0°47′19.263″ |
South Ternate | TTE 03 | 127°22′07.081″ | 0°46′18.963″ | |
TTE 07 | 127°21′54.190″ | 0°45′43.103″ | ||
North Ternate | TTE 015 | 127°22′34.723″ | 0°48′47.968″ | |
Ternate Island | TTE 016 | 127°18′42.710″ | 0°45′38.461″ |
No | Primers | Sequence (5′-3′) | Tm (°C) | TB | PB | MB | P | %M | PIC |
---|---|---|---|---|---|---|---|---|---|
1 | (AG)8 | AGAGAGAGAGAGAGAGG | 54.5 | 8 | 7 | 1 | 88 | 12 | 0.35 |
2 | (CA)6GG | CACACACACACAGG | 42.0 | 6 | 5 | 1 | 83 | 17 | 0.40 |
3 | 25CC | AGGGCTGGAGGAGGGC | 50.0 | 6 | 6 | 0 | 100 | 0 | 0.33 |
4 | (AC)8C | ACACACACACACACACC | 52.0 | 6 | 6 | 0 | 100 | 0 | 0.21 |
5 | (AG)8C | AGAGAGAGAGAGAGAGC | 52.0 | 6 | 3 | 3 | 50 | 50 | 0.54 |
6 | (CT)8RC | CTCTCTCTCTCTCTCTRC | 54.0 | 7 | 7 | 0 | 100 | 0 | 0.34 |
7 | (GAA)6 | GAAGAAGAAGAAGAAGAA | 50.0 | 6 | 6 | 0 | 100 | 0 | 0.33 |
8 | UBC 887 | AGTACGAGTTCTCTCTCTCTCTC | 55.0 | 7 | 7 | 0 | 100 | 0 | 0.31 |
9 | UBC 889 | ACTCGTAGTACACACACACACAC | 60.0 | 7 | 6 | 1 | 86 | 14 | 0.35 |
10 | (GT) 8T | GTGTGTGTGTGTGTGTT | 54 | 6 | 6 | 0 | 100 | 0 | 0.23 |
Total | 65 | 59 | 6 | 91 | 9 | 0.34 |
HAL 01 | MOR 06 | HAL 02 | TDR 11 | TDR 10 | TDR 08 | TDR 01 | TDR 02 | MOR 02 | MOR 03 | MOR 04 | MOR 01 | MOR 05 | TTE 07 | TTE 016 | TTE 02 | TTE 015 | TTE 03 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
HAL 01 | 1 | |||||||||||||||||
MOR 06 | 0.823 | 1 | ||||||||||||||||
HAL 02 | 0.797 | 0.924 | 1 | |||||||||||||||
TDR 11 | 0.696 | 0.848 | 0.823 | 1 | ||||||||||||||
TDR 10 | 0.709 | 0.785 | 0.759 | 0.861 | 1 | |||||||||||||
TDR 08 | 0.671 | 0.747 | 0.722 | 0.722 | 0.861 | 1 | ||||||||||||
TDR 01 | 0.722 | 0.797 | 0.797 | 0.797 | 0.759 | 0.848 | 1 | |||||||||||
TDR 02 | 0.734 | 0.759 | 0.709 | 0.785 | 0.722 | 0.658 | 0.759 | 1 | ||||||||||
MOR 02 | 0.684 | 0.759 | 0.734 | 0.835 | 0.797 | 0.684 | 0.785 | 0.823 | 1 | |||||||||
MOR 03 | 0.684 | 0.785 | 0.81 | 0.81 | 0.797 | 0.759 | 0.81 | 0.747 | 0.848 | 1 | ||||||||
MOR 04 | 0.62 | 0.722 | 0.722 | 0.772 | 0.785 | 0.747 | 0.772 | 0.759 | 0.886 | 0.911 | 1 | |||||||
MOR 01 | 0.608 | 0.633 | 0.658 | 0.734 | 0.747 | 0.684 | 0.684 | 0.772 | 0.772 | 0.797 | 0.835 | 1 | ||||||
MOR 05 | 0.696 | 0.772 | 0.772 | 0.772 | 0.759 | 0.772 | 0.823 | 0.709 | 0.810 | 0.861 | 0.848 | 0.759 | 1 | |||||
TTE 07 | 0.722 | 0.823 | 0.823 | 0.797 | 0.785 | 0.823 | 0.823 | 0.684 | 0.734 | 0.835 | 0.772 | 0.658 | 0.873 | 1 | ||||
TTE 016 | 0.709 | 0.759 | 0.734 | 0.785 | 0.823 | 0.785 | 0.759 | 0.747 | 0.772 | 0.797 | 0.759 | 0.772 | 0.734 | 0.785 | 1 | |||
TTE 02 | 0.734 | 0.734 | 0.658 | 0.734 | 0.722 | 0.658 | 0.684 | 0.772 | 0.772 | 0.671 | 0.709 | 0.671 | 0.709 | 0.633 | 0.772 | 1 | ||
TTE 015 | 0.658 | 0.709 | 0.684 | 0.785 | 0.873 | 0.785 | 0.709 | 0.696 | 0.797 | 0.747 | 0.785 | 0.797 | 0.759 | 0.734 | 0.848 | 0.722 | 1 | |
TTE 03 | 0.684 | 0.759 | 0.759 | 0.785 | 0.747 | 0.684 | 0.684 | 0.696 | 0.797 | 0.797 | 0.81 | 0.747 | 0.81 | 0.785 | 0.722 | 0.696 | 0.797 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nurhasanah; Hindersah, R.; Suganda, T.; Concibido, V.; Sundari; Karuniawan, A. The First Report on the Application of ISSR Markers in Genetic Variance Detection among Butterfly Pea (Clitoria ternatea L.) Accession in North Maluku Province, Indonesia. Horticulturae 2023, 9, 1059. https://doi.org/10.3390/horticulturae9091059
Nurhasanah, Hindersah R, Suganda T, Concibido V, Sundari, Karuniawan A. The First Report on the Application of ISSR Markers in Genetic Variance Detection among Butterfly Pea (Clitoria ternatea L.) Accession in North Maluku Province, Indonesia. Horticulturae. 2023; 9(9):1059. https://doi.org/10.3390/horticulturae9091059
Chicago/Turabian StyleNurhasanah, Reginawanti Hindersah, Tarkus Suganda, Vergel Concibido, Sundari, and Agung Karuniawan. 2023. "The First Report on the Application of ISSR Markers in Genetic Variance Detection among Butterfly Pea (Clitoria ternatea L.) Accession in North Maluku Province, Indonesia" Horticulturae 9, no. 9: 1059. https://doi.org/10.3390/horticulturae9091059
APA StyleNurhasanah, Hindersah, R., Suganda, T., Concibido, V., Sundari, & Karuniawan, A. (2023). The First Report on the Application of ISSR Markers in Genetic Variance Detection among Butterfly Pea (Clitoria ternatea L.) Accession in North Maluku Province, Indonesia. Horticulturae, 9(9), 1059. https://doi.org/10.3390/horticulturae9091059