Next Article in Journal
The First Report on the Application of ISSR Markers in Genetic Variance Detection among Butterfly Pea (Clitoria ternatea L.) Accession in North Maluku Province, Indonesia
Next Article in Special Issue
An Overview of the Phytochemical Composition of Different Organs of Prunus spinosa L., Their Health Benefits and Application in Food Industry
Previous Article in Journal
Comprehensive Genomic Analysis and Expression Profile of Hsp70 Gene Family Related to Abiotic and Biotic Stress in Cucumber
Previous Article in Special Issue
Ethanol and Methyl Jasmonate Fumigation Impact on Quality, Antioxidant Capacity, and Phytochemical Content of Broccoli Florets during Storage
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 9
Issue 9
10.3390/horticulturae9091058
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Exogenous Substance K2SO4 on the Nutritional Quality of Broccoli and Its Metabolic Regulation Mechanism

by
Meng Liu
1,2,†,
Wei Huang
2,†,
Junhua Zhang
2,
Zixuan Zhao
2,
Yaqin Wang
1,
Nazim S. Gruda
3,
Guangmin Liu
1,* and
Hongju He
1,*
1
Institute of Agri-Food Processing and Nutrition, Beijing Academy of Agriculture and Forestry Sciences, Beijing 100097, China
2
College of Agriculture and Forestry Science and Technology, Hebei North University, Zhangjiakou 075000, China
3
Institute of Plant Sciences and Resource Conservation, Division of Horticultural Sciences, University of Bonn, 53012 Bonn, Germany
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2023, 9(9), 1058; https://doi.org/10.3390/horticulturae9091058
Submission received: 22 August 2023 / Revised: 13 September 2023 / Accepted: 19 September 2023 / Published: 21 September 2023
(This article belongs to the Special Issue Bioactive Compounds and Antioxidant Capacity in Fruits and Vegetables)
Browse Figures
Review Reports Versions Notes

Abstract

:
The impact of exogenous sulfate components on the nutritional quality of vegetables has been well documented. In this study, we examined the effects of adding K2SO4 to broccoli on its nutritional quality, active components, and the genes involved in glucosinolate synthesis. Different concentrations of exogenous K2SO4 of 25, 75, and 150 g·m−2 were applied to the “Naihan Youxiu” broccoli cultivar, while the control treatment received no potassium sulfate. Our primary objective was to gain insights into strategies for enhancing broccoli’s nutritional and active components. The results showed that broccoli’s vitamin C content in each treatment was lower than that in the control treatment. The contents of soluble protein, soluble sugar, polyphenols, and total flavonoids in the treatment of 150 g·m−2 K2SO4 were the highest. They increased by 23.51%, 87.49%, 146.00%, and 22.73% more than the control, respectively. MDA was significantly inhibited after the 75 g·m−2 treatment, whereas SOD had the highest activity under the 75 g·m−2 treatment. Therefore, the 150 g·m−2 treatment was beneficial in improving the nutritional quality and antioxidant capacity of broccoli. The contents of PRO, SIN, NAP, GBC, 4ME, NEO, total indole glucosinolates, and total glucosinolates reached the peak at the 150 g·m−2 K2SO4 treatment, RAA and total aliphatic glucosinolates reached the peak at the 75 g·m−2 K2SO4 treatment, and ERU and 4OH reached the highest at the 25 g·m−2 K2SO4 treatment. The sulforaphane content was the highest in the 150 g·m−2 treatment, and myrosinase activity was the highest in the 75 g·m−2 treatment. It can be seen that the 150 g·m−2 treatment significantly increased the content of glucosinolates, total indole glucosinolates, total glucosinolates, and sulforaphane in broccoli. CYP79B2, CYP83B1, CYP83A1, AOP2, UGT74B1, and MYB34 were significantly up-regulated under 150 g·m−2 K2SO4 treatment and reached the peak value. CYP79F1, CYP81F4, and MAM1 showed significant inhibitory effects when treated with 150 g·m−2 of K2SO4. The expression levels of BCAT4, CYP81F1, ST5a, ST5c, and SUR1 were down-regulated under the 150 g·m−2 K2SO4 treatment, but not significantly. In summary, the K2SO4 150 g·m−2 treatment had the best effect on nutritional quality, antioxidant activity, the content of glucosinolates, total glucosinolates, sulforaphane, and expression of CYP79B2, CYP83B1, CYP83A1, FMO2, UGT74B1, AOP2, and MYB34 genes.

1. Introduction

Broccoli (Brassica oleracea var. italica) is an important economic crop with rich nutritional value [1]. Because of its high content of glucosinolates (GS) and secondary sulfur-containing compounds, it has become the research object of many researchers [2]. In addition, the degradation products of glucosinolate have a strong antibacterial effect and play a role in preventing prostate, gastrointestinal, and lung cancers [3].
The basic structure of all glucosinolates consists of β-glucosinolates, sulfonated oxime, and a branched R chain [4]. According to the structure of variable side chain R, glucosinolates can be divided into three categories: aliphatic glucosinolates, aromatic glucosinolates, and indole glucosinolates [5]. The enzymes BCAT4, MAM1, MAM2, and MAM3 play a crucial role in the initial stage of glucosinolate synthesis. MYB28 regulates MAM1 and MAM3, while the BCAT4 catalytic chain’s first growth reaction occurs in the cytosol [6]. Cytochrome P450 of the CYP79 family converts precursor amino acids into acetaldoxime [7,8]. Next, cytochrome P450 of the CYP83 family oxidizes acetaldoxime into tempting compounds, such as nitrile oxides or acyl nitro compounds [9,10]. These compounds continue the central structure of glucosinolate synthesis under the catalysis of other enzymes.
Different genes are involved in the biosynthesis of the core structure of glucosinolates [11], resulting in different kinds of glucosinolates. For example, ST5B, plST5C, FMO, AOP2, AOP3, and GSL-OH are involved in the biosynthesis of aliphatic glucosinolates, while MYB34, CYP83B1, ST5A, CYP81, and IGM are involved in the biosynthesis of indole glucosinolates [12]. Therefore, it is important to study which specific genes are involved in enhancing glucosinolate content induced by exogenous substances.
The results showed that the combined treatment of 4 mM ZnSO4 and 0.1 mM Na2SeO3 up-regulated the expression of UGT74B1 and BoHMTI genes in broccoli sprouted 6 days after germination, and the content of total glucosinolates was significantly higher than that of the control [13]. Yang et al. [14] found that ZnSO4 significantly increased the expression of FMOGS-OX and MYR but significantly decreased the expression of AOP2 and ESP. K2SO4 and Met increased the expression of AOP2 and ESP, while K2SO4 down-regulated the expression of FMOGS-OX. After ZnSO4 and K2SO4 treatment, the glucosinolate content in broccoli increased by 58.2% and 20%, respectively. Mao Shuxiang [15] found that at 1 mM sulfur concentration, the expressions of CYP79F1, CYP83A1, SUR1, and UGT74C1 were significantly up-regulated after 50 μM of selenium treatment, but at 4 mM sulfur concentration, the expressions of CYP79F1, CYP83A1, SUR1, and UGT74C1 were significantly inhibited after the 50 μM selenium treatment but reached the peak at the 150 μM selenium treatment.
The application of exogenous substances can not only induce the effect of glucosi-nolate gene expression but also affect the nutritional quality. The results of Chengkai [16] showed that the content of soluble sugar and soluble protein could be significantly increased by applying nutrient solution containing 1 mmol·L−1 of sulfur and 10 μmol·L−1 of selenium. Still, the content of soluble sugar and soluble protein in broccoli seedling leaves could be reduced by applying nutrient solution containing 5 mmol·L−1 of sulfur and 20 μmol·L−1 of selenium, 10 mmol·L−1 of sulfur, and 20 μmol·L−1 of selenium. Therefore, in this study, “excellent cold-resistant” broccoli varieties were used as test materials to study the effects of different concentrations of potassium sulfate on the nutritional quality and metabolic regulation mechanism of broccoli to provide a reference for strengthening the nutritional quality and metabolic regulation mechanism of broccoli.

2. Materials and Methods

2.1. Test Materials and Design

The field experiments were carried out from July to October 2020 at the Dongshengfangyuan Vegetable Research Station (39°53′ N, 116°03′ E,) at 43.5 m altitude in Beijing, China. The soil type is sandy loam, with a pH of 7.0. The variety of broccoli that was tested was “Naihan Youxiu”. The seeds were sown using a 96-hole plug on July 3rd for seedling raising. On August 1st, seedlings with three leaves and one heart were planted on a flat border with a plant-to-plant spacing and row spacing of 40 cm × 45 cm, respectively. On August 29th, K2SO4 fertilizer was applied for the first time, and on September 15th, for the second time. A randomized block design was adopted in the experiment. According to the concentration of sulfur fertilizer, three treatments were set up, which were named S25 (25 g·m−2), S75 (75 g·m−2), and S150 (150 g·m−2). The length × width = 9 m × 4. 5 m, the area is 40.5 m2, and the total area of the three treatment cells was 121.5 m2. K2SO4 fertilizer was applied to broccoli roots and then watered. Other farming operations were carried out according to the technical measures of high-quality broccoli production. A total of 5 broccoli were harvested for each treatment on September 29th. After harvest, laboratory experiments were conducted at the Vegetable Research Institute of the Beijing Academy of Agriculture and Forestry Sciences.

2.2. Test Reagents

The following materials were used in our research: K2SO4 (SDIC Xinjiang Lop Nur Potassium Salt Co., Ltd. (Xinjiang, China), with a sulfur content of at least 17.5%); a standard for propenyl glucosinolates (D1347, from Shanghai Baoman Biotechnology Co., Ltd. (Shanghai, China)); a kit for extracting RNA from polysaccharide polyphenol plants (model RC4-11, from Nanjing Nuoweizan Biotechnology Co., Ltd. (Nanjing, China)); HiScript® III All-in-one RT SuperMix Perfect for qPCR Kit (model R333-01, from Nanjing Nuoweizan Biotechnology Co., Ltd. (Nanjing, China)); and Taq Pro Universal SYBR qPCR Master Mix Kit (models Q712-02/03, from Nanjing Nuoweizan Biotechnology Co., Ltd. (Nanjing, China)).

2.3. Test Instruments

UV-2550 dual-beam ultraviolet-visible spectrophotometer (Shimadzu Corporation (Kyoto, Japan)); Infinite M1000 PRO multifunctional microplate reader (TECAN Group of Companies Beijing Representative Office (Beijing, China)); 762075 enzymes labeled plate (Greiner Bio-One Company (Nittingen, Germany)); and Roche LightCyler 480II Real-time Fluorescence Quantitative PCR Instrument (Roche (Shanghai, China)).

2.4. Item Determination

The determination of Vitamin C content was conducted using the Guo [17] method. The Bradford [18] method was utilized for measuring soluble protein content, while the Pramanik [19] method was used for determining soluble sugar content. The determination of polyphenol content was carried out using the Singleton [20] method, and the Wang [21] method was used for measuring the content of total flavonoids. The content of malondialdehyde was determined by Antonios [22]. The Tang [23] method was used for determining the activity of superoxide dismutase. The content of glucosinolates was determined by Wang [24], and the content of sulforaphane was measured using the method developed by Matusheski [25]. Myrosinase activity was measured with reference to the method developed by Guo [26].
To extract genomic RNA, use the RNA extraction kit from Nanjing Nuoweizan with the designated plate number. Next, reverse cDNA using the R333-01 reverse transcription kit from the same company. To perform fluorescence quantitative PCR, use the Q712-02/03 kit from Nanjing Nuoweizan. Then, synthesize specific primers for the internal reference gene and target gene using Premier 5 primer design software from the Beijing Ruibo Xingke Biotechnology Co., Ltd. (Table 1). Finally, calculate the results using the 2−ΔΔCT method [27].

2.5. Data Analysis and Processing

Unless otherwise specified, the data in the chart are the average of three repetitions, and the error bar shows the standard deviation. Duncan’s analysis of variance was used to analyze the difference (p < 0.05). SPSS 22.0 was used to analyze the difference and Origin Pro 8.0 was used to map the difference.

3. Results and Analysis

3.1. Effects of Exogenous K2SO4 Treatment on Nutritional Components and Antioxidant Activity of Broccoli

3.1.1. Effect of Exogenous K2SO4 Treatment on Vitamin C Content in Broccoli

Figure 1A reveals that as the K2SO4 dosage increases gradually, the Vc content initially decreases and then increases afterwards. The lowest value of 75.90 mg·100g−1 was observed in the S25 treatment, indicating a 14.34% decrease compared with the control. On the other hand, the highest value of 88.61 mg·100 g−1 was recorded in the S0 treatment, with significant differences evident among all treatments. The highest dosage of K2SO4 resulted in a decrease of 3.75% compared with the control.

3.1.2. Effect of Exogenous K2SO4 Treatment on Soluble Protein Content in Broccoli

As the dosage of K2SO4 increased, the soluble protein content in broccoli showed a gradual increase. The differences among the treatments were significant, as shown in Figure 1B. In comparison to the control treatment, the soluble protein content experienced a rise of 11.32%, 20.01%, and 23.51% in S25, S75, and S150, respectively. The results indicate that the application of K2SO4 was beneficial to the increase in soluble protein content in broccoli.

3.1.3. Effect of Exogenous K2SO4 Treatment on Soluble Sugar Content in Broccoli

From Figure 1C, it is evident that the amount of soluble sugar in broccoli escalates as the dosage of K2SO4 increases. Moreover, this pattern of change is congruent with the alteration in the soluble protein content. The soluble sugar content of S25, S75, and S150 increased by 4.07%, 23.63%, and 87.49%, respectively, compared with S0. The results indicate that the application of K2SO4 was beneficial to the increase in soluble sugar content in broccoli.

3.1.4. Effect of Exogenous K2SO4 Treatment on Polyphenol Content in Broccoli

As can be seen from Figure 1D, the polyphenol content in broccoli gradually increased with the increase in K2SO4 dosage, and there was a significant difference between S150 and other treatments, but there was no significant difference between S25 and S75 treatments. The polyphenol content in S150 was 2.5 times higher than S0, and 38.85% and 48.43% higher than S25 and S75, respectively. The results showed that K2SO4 could increase the content of polyphenols in broccoli and improve the antioxidant capacity.

3.1.5. Effect of Exogenous K2SO4 Treatment on the Content of Total Flavonoids in Broccoli

Figure 1E displays that as the K2SO4 dosage increases, the broccoli’s total flavonoid content reaches its peak at S150, measuring at 6.33 mg·100g−1. There is a notable difference between S150 and S0, S25, and S75, but no significant difference among S0, S25, and S75. Although S75 shows a slight decrease, it is not significant. In comparison to S0, S25, and S75, S150 saw an increase of 22.73%, 22.40%, and 26.24%, respectively.

3.1.6. Effect of Exogenous K2SO4 Treatment on MDA Content in Broccoli

It can be seen from Figure 2A that the content of malondialdehyde in broccoli decreased first and then increased with the increase in K2SO4 dosage. The content of MDA (malondialdehyde) can directly reflect the damage to plants in adversity [28]. Therefore, it can be seen that broccoli is the least damaged in adversity under the S75 treatment.

3.1.7. Effect of Exogenous K2SO4 Treatment on Superoxide Dismutase Activity in Broccoli

From Figure 2B, it can be seen that SOD (superoxide dismutase) activity increased first and then decreased with the gradual increase in K2SO4 dosage, and the highest activity was 211.31 μ·g−1 at S75, which was significantly different from the other three treatments, and increased by 22.51% compared with the control.

3.2. Effect of Exogenous Substance K2SO4 Treatment on Active Substances in Broccoli

3.2.1. Effect of Exogenous K2SO4 Treatment on Glucosinolate Content in Broccoli

Nine glucosinolates were detected in broccoli in our experiment (Table 2). Table 2 reveals that the level of total aliphatic glucosinolate is greater in the K2SO4 treatments than in the control treatment. The difference between all treatments is significant, with the highest S75 content showing a 9.10% increase compared with the control. With the increase in K2SO4 concentration, the contents of PRO and SIN increased by 39.53% and 26.32%, respectively. The content of RAA was increased by 6.68%, 13.33%, and 8.97%, respectively, compared with the control. The changes in NAP and ERU were similar. The content of NAP and ERU increased by 36.36% and 4.31%, respectively, in the S25 treatment.
The content of glucosinolates in the total indole group accounted for 62.65–76.66% of total glucosinolates. In the total indole group, the glucosinolate content was highest in the S150 treatment, measuring 12.92 μmol·g−1. This was significantly greater than the other treatments and marked an 81.42% increase compared with the control. Compared with the control, only the S25 treatment promoted the accumulation of 4OH, and the other treatments inhibited the accumulation of 4OH. The changes in GBC, 4ME, and NEO were similar. With the increase in exogenous K2SO4 dosage, the changing trend of GBC, 4ME, and NEO decreased first and then increased. The inhibition phenomenon was most obvious in the S25 treatment, and the maximum accumulation was found in the S150 treatment.
The content of total glucosinolates also decreased first and then increased. Under S25 treatment, the content of total glucosinolates reached a minimum value of 10.37 μmol·g−1, which is 3.66% less compared with the control. The total glucosinolate content showed the highest increase of 56.63% compared with the control when the sulfur amount was raised to 150 g·m−2. In general, except ERU and 4OH, the content of glucosinolates and total glucosinolates increased the most under the S150 treatment.

3.2.2. Effect of Exogenous K2SO4 Treatment on Sulforaphane Content in Broccoli

As can be seen from Figure 3A, the greater the amount of K2SO4, the higher the sulforaphane content in broccoli. At a dosage of 150 g·m−2 of K2SO4, the sulforaphane content was 21.32 μg·mL−1, which was notably higher than all other treatments and doubled the amount of the control. Compared with S25 and S75, S150 increased by 104.10% and 39.61%, respectively.

3.2.3. Effect of Exogenous K2SO4 Treatment on Myrosinase Activity in Broccoli

Figure 3B clearly indicates that the S75 treatment exhibits the highest myrosinase activity among all other treatments. Conversely, the S150 treatment showed the lowest myrosinase activity, with a reduction of 23.10% compared with S75 and 13.08% compared with the control.

3.3. Effect of Exogenous Substance K2SO4 Treatment on the Expression of Key Genes of Glucosinolate Synthesis in Broccoli

3.3.1. Effect of Exogenous K2SO4 Treatment on the Expression of Key Genes for Aliphatic Glucosinolate Synthesis in Broccoli

The treatment with the highest total glucosinolate content and the control (S0, S150) were selected to detect the key synthesis and regulatory genes of the aliphatic glucosinolate synthesis pathway in broccoli. As shown in Figure 4, the expression patterns of MYB28, CYP83A1, GSTF, ST5b, FMO2, AOP3, AOP2, and GSL-OH were similar and increased gradually. Except for CYP83A1 and AOP2, MYB28, GSTF, ST5b, FMO2, AOP3, and GSL-OH were up-regulated under S150 treatment, but their expression levels did not change significantly. However, CYP83A1 and AOP2 were significantly up-regulated under S150 treatment and reached the peak value. The expression levels of BCAT4, SUR1, and ST5C were down-regulated slightly but not significantly under S150 treatment. Therefore, S150 treatment significantly inhibited the expression of CYP79F1 and MAM1.

3.3.2. Effect of Exogenous K2SO4 Treatment on the Expression Level of Key Genes for Synthesis of Indole Glucosinolates in Broccoli

We detected the levels of expression of seven crucial genes involved in the regulation and synthesis pathway of indole glucosinolates in broccoli. As shown in Figure 5, the expression patterns of MYB34, CYP79B2, CYP83B1, UGT74B1, and CYP81F1 were similar under different concentrations of K2SO4. The expression levels of MYB34, CYP79B2, CYP83B1, UGT74B1, and CYP81F1 were higher than those of the control, except CYP81F1. The expression of CYP81F4 and ST5a decreased with the increase in K2SO4 concentration, and the expression of CYP81F4 was significantly inhibited at S150.

4. Correlation Analysis between Glucosinolate Content, Enzyme Activity, and Gene Expression Treated with Exogenous Substance K2SO4

To examine the uniformity of glucosinolate content, enzyme activity, and key gene expression in the glucosinolate synthesis pathway when treated solely with exogenous K2SO4, a correlation analysis was conducted using the Pearson correlation coefficient. The findings, shown in Table 3, reveal that sulforaphane exhibited a highly significant positive correlation with RAA and total aliphatic, total indole, and overall glucosinolate contents. It also displayed a very significant positive correlation with GBC. MYB34 and CYP83A1 were positively correlated with RAA, GBC, total aliphatic glucosinolates, total indole glucosinolates, and total glucosinolates, respectively. MYB34 was positively correlated with sulforaphane, while CYP83A1 was positively correlated with sulforaphane. CYP79B2 and FMO2 were positively correlated with RAA, GBC, total indole glucosinolates, and total glucosinolates, while CYP79B2 was positively correlated with total aliphatic glucosinolates and sulforaphane. There was a very significant negative correlation between FMO2 and myrosinase. MAM1 was negatively correlated with RAA, GBC, total aliphatic glucosinolates, total indole glucosinolates, and total glucosinolates, but negatively correlated with sulforaphane. There was a significant negative correlation between UGT74B1 and myrosinase.

5. Discussion

Sulfur is found in amino acids such as cysteine, methionine, and homocysteine and in some common enzymes. Therefore, sulfur is indispensable for proteins, enzymes, and physiologically active substances in crops. Sulfur fertilizer can promote protein synthesis, increase the oil content of oil crops, and enhance the nitrogen fixation ability of soybean crops. Applying sulfur fertilizer can also improve crop yield and quality. The results showed that the content of polyphenols in broccoli increased gradually with the increase in K2SO4 concentration. In contrast, the content of Vc in broccoli was lower than that in control under all sulfur treatments, which may be due to the stress effect of K2SO4. These results are similar to Chu Ting [29]. She treated cauliflower sprouts with four different concentrations of MgSO4 (0, 25, 50, and 75 mmol·L−1). It was also found that with the increase in MgSO4 concentration, the Vc content decreased, and the total phenol content increased.
In this study, the contents of soluble protein, soluble sugar, and total flavonoids increased gradually with the increase in K2SO4 concentration. The content of MDA was the lowest at 75 g·m−2 K2SO4, but the activity of SOD was the highest. The results indicate that with the increase in K2SO4 concentration, the stress effect became more and more obvious and the antioxidant capacity of broccoli became stronger and stronger. In a study conducted by Ding Yi [30], a similar conclusion was drawn. With the increase in sulfur concentration, the content of flavonoids in pakchoi gradually increased, and the antioxidant capacity also gradually increased.
Glucosinolate can be divided into aliphatic glycosinolate, indole glycosinolate, and aromatic glycosinolate. It is generally believed that aliphatic glycosinolate plays a significant role in the overall adaptability of plants. In contrast, indole glycosinolate is considered the critical determinant of pest and disease resistance [31]. RAA belongs to aliphatic glucosinolates, while GBC belongs to indole glucosinolates. RAA degrades to produce sulforaphane, the most potent anticancer substance found in vegetables so far [32]; therefore, it has been widely discussed. Broccoli, as a vegetable containing 14 kinds of glucosinolates and a high content of glucosinolates, has become a research hotspot. Researchers have been experimenting with increasing the content range of glucosinolate, a sulfur-containing substance, by adding sulfur fertilizer. The results showed that the content of glucosinolates and total glucosinolates in broccoli treated with K2SO4 increased, and the content of sulforaphane increased significantly compared with the control, which was similar to that of Runqiang Yang [14]. After ZnSO4 treatment, the content of total glucosinolates and sulforaphane in broccoli increased significantly. The reason may be that K2SO4 caused a stress effect on broccoli and accumulated glucosinolate content or that K2SO4 as a sulfur source promoted glucosinolate synthesis; however, this conclusion is related to a study conducted by Aires [33]. When KNO3, K2SO4, and KCl were applied to broccoli sprouts, it was found that broccoli sprouts did not need any S and N fertilization to increase glucosinolate levels because there were different conclusions drawn regarding whether this would have adverse effects. This difference may be due to the specifics of the study conducted by Aires [33]. Broccoli sprouts were used as the experimental material, but the results of the experiment were influenced by the different contents of glucosinolates in broccoli bulbs and broccoli in different periods.
Glucosinolate content will accumulate when plants are stressed, e.g., by high temperatures and hypoxia, or when exogenous substances such as methyl jasmonate and jasmonic acid are applied. However, the range of secondary metabolites will not continue to increase when the stress is to a certain extent [17,34,35,36,37]. Isothiocyanates are produced by the hydrolysis of glucosinolates by myrosinase, and epidermal-specific thionin exists in broccoli, which can make glucosinolates hydrolyze in the direction of nitriles, thus reducing the content of isothiocyanates. Still, nitriles have no anticancer activity [38]. Therefore, glucosinolate content and myrosinase activity are significant for forming isothiocyanate. The change in enzyme activity of black mustard is closely related to plant species, varieties, Vc content, and temperature [39]. It has been found that Vc can change the central conformation of myrosinase and affect its activity. When the concentration of Vc is low, it can increase the activity of myrosinase, but when the concentration of Vc is too high, it will inhibit its activity [39,40]. In this study, myrosinase activity was the highest under the 75 g·m−2 K2SO4 treatment, which may be due to the low content of Vc at this time. And the sulforaphane change trend is consistent with the change trend of total glucosinolate content. This result is the same as that found by Liping Guo [35]. It was found that the content of total glucosinolates and sulforaphane in broccoli treated by JA on the 3rd day of germination were similar.
In this study, CYP79B2, CYP83B1, CYP83A1, FMO2, UGT74B1, GSTF, ST5b, AOP3, AOP2, GSL-OH, CYP81F1, MYB28, and MYB34 were all up-regulated or significantly up-regulated under S150 treatment. Guo et al. [35] found that broccoli buds formed on the 5th and 7th days of germination. The expressions of ST5b, AOP2, UGT74B1, MYB28, and CYP83A1 were also up-regulated after 100 μM of JA treatment. The results indicate that the key genes in the glucosinolate anabolic pathway in broccoli had different responses to different concentrations of exogenous K2SO4, and exogenous K2SO4 treatment could regulate the synthesis and accumulation of glucosinolates in broccoli by regulating the expression of key genes in the glucosinolate anabolic pathway. However, the results of Guo [35] showed that the expression of CYP79F1 was up-regulated, and the expression of CYP79F1 was down-regulated after S150 treatment, which may be due to different experimental materials. In Guo’s study [35], broccoli sprouts were used, and in this study, mature broccoli bulbs were used, which may contain different exogenous substances. Similarly, Aghajanzadeh [11] et al. showed up-regulation of CYP79B2 in rapeseed stems, and the expressions of CYP83B1 and MYB34 were also up-regulated after 50 mM of Na2SO4 treatment.
The results of correlation analysis showed that CYP79B2, CYP83A1, CYP81F1, FMO2, UGT74B1, AOP2, and MYB34 had a significant or extremely significant positive correlation with RAA, GBC, total indole glucosinolates, total aliphatic glucosinolates, and total glucosinolates, respectively, which indicated that CYP79B2, CYP83A1, CYP81F1, FMO2, UGT74B1, AOP2, and MYB34 affected the components of glucosinolates and total glucosinolates. As a precursor of sulforaphane, RAA affected the accumulation of sulforaphane in broccoli. The contents of GBC, total indole glucosinolates, total glucosinolates, and sulforaphane were all at a high level under S150 treatment. Although the contents of RAA and total aliphatic glucosinolates did not reach the maximum, they increased significantly compared with the control. The expression levels of CYP79F1, BCAT4, ST5a, ST5c, CYP81F4, SUR1, and MAM1 were all down-regulated or significantly down-regulated under S150 treatment. Mao Shuxiang [15] showed that the expression levels of CYP79F1, BCAT4, and MAM1 were down-regulated with an increase in sulfur concentration. MAM1 and CYP81F4 were negatively correlated with the contents of RAA, GBC, total indole glucosinolates, total aliphatic glucosinolates, and total glucosinolates, respectively, which indicated that exogenous K2SO4 treatment could inhibit the contents of RAA, GBC, total indole glucosinolates, total aliphatic glucosinolates, and total glucosinolates by down-regulating the expression of MAM1. The results showed that the gene responses related to glucosinolate synthesis in broccoli were different under different K2SO4 treatments.

6. Conclusions

According to the comprehensive nutritional indexes, different dosages of K2SO4 treatment had different effects on the nutritional quality and antioxidant capacity of broccoli. The content of Vc in broccoli of all treatments was lower than that of the control. The content of soluble protein, soluble sugar, polyphenols, and total flavonoids in broccoli receiving the 150 g·m−2 treatment was the highest, which was significantly higher than that of the control. MDA was significantly inhibited after the 75 g·m−2 treatment, but SOD was the highest under the 75 g·m−2 treatment. We conclude that the treatment with 150 g·m−2 was beneficial in improving the nutritional quality and antioxidant capacity and significantly increased the content of glucosinolates, total indole glucosinolates, total glucosinolates, and sulforaphane in broccoli. The way certain genes were expressed, specifically CYP79B2, CYP83B1, CYP83A1, FMO2, UGT74B1, GSTF, ST5b, AOP3, AOP2, GSL-OH, CYP81F1, MYB28, and MYB34 showed similarities. Notably, under the 150 g·m−2 K2SO4 treatment, CYP79B2, CYP83B1, CYP83A1, AOP2, UGT74B1, and MYB34 were significantly up-regulated and reached their peak value. CYP79F1, CYP81F4, and MAM1 showed significant inhibitory effects when treated with 150 g·m−2 of K2SO4. The expression levels of BCAT4, CYP81F1, ST5a, ST5c, and SUR1 were down-regulated under the 150 g·m−2 K2SO4 treatment, but not significantly. According to our results, the change in glucosinolate content is consistent with the trend of gene expression of key enzymes in biosynthesis.

Author Contributions

Conceptualization, M.L. and W.H.; software, H.H.; validation, M.L. and W.H.; formal analysis, M.L., Z.Z. and J.Z.; investigation, Y.W. and G.L.; data curation, M.L. and W.H.; writing—original draft preparation, G.L., N.S.G. and H.H.; writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Innovation and Capacity Building Project of the Beijing Academy of Agriculture and Forestry Sciences (KJCX20230212, KJCX20220419), the Beijing Innovation Consortium of Agriculture Research System (BAIC01-2023-22), and the Hebei province graduate student innovation ability training project (CXZZSS2022147).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Han, J.; Tao, W.; Hao, H.; Zhang, B.; Jiang, W.; Niu, T.; Li, Q.; Cai, T. Physiology and Quality Responses of Fresh-cut Broccoli Flores Pretreated with Ethanol Vapor. J. Food Sci. 2006, 71, S385–S389. [Google Scholar] [CrossRef]
  2. Del Carmen Mart í Nez-Ballesta, M.; Moreno, D.A.; Carvajal, M. The physiological impact of glucosinolates on plant response to abiotic stress in Brassica. Int. J. Mol. Sci. 2013, 14, 11607–11625. [Google Scholar] [CrossRef] [PubMed]
  3. Shapiro, T.A.; Fahey, J.W.; Wade, K.L.; Stephenson, K.K.; Talalay, P. Human Metabolism and Excretion of Cancer Chemoprotective Glucosinolates and Isotheocyanates of Cruciferous Vegetables. Cancer Epidemiol. Biomark. Prev. 1998, 7, 1091. [Google Scholar]
  4. Hanschen, F.S.; Rohn, S.; Mewis, I.; Schreiner, M.; Kroh, L.W. Influence of the chemical structure on the thermal degradation of the lucosinolates in broccoli sprouts. Food Chem. 2012, 130, 1–8. [Google Scholar] [CrossRef]
  5. Lin, L.Z.; Sun, J.; Chen, P.; Zhang, R.W.; Fan, X.E.; Li, L.W.; Harnly, J.M. Profiling of Glucosinolates and Flavonoids in Rorippa indica (Linn.) Hiern. (Cruciferae) by UHPLC-PDA-ESI/HRMSn. J. Financ. Food Chem. 2014, 62, 6118–6129. [Google Scholar] [CrossRef] [PubMed]
  6. Schuster, J.; Knill, T.; Reichelt, M.; Gershenzon, J.; Binder, S. Branched-chain aminotransferase 4 is part of the chain elongation path in the biosynthesis of methodine-derived glucosinolates in Arabidopsis. Plant Cell 2006, 18, 2664–2679. [Google Scholar] [CrossRef]
  7. Mikkelsen, M.D.; Hansen, C.H.; Wittstock, U.; Halkier, B.A. Cytochrome P450 CYP79B2 from Arabidopsis Catalyzes the Conversion of Tryptophan to Indole-3-acetaldoxime, a Precursor of Indole Glucosinolates and Indole-3-acetic Acid. J. Biol. Chem. 2000, 275, 33712–33717. [Google Scholar] [CrossRef]
  8. Hull, A.K.; Vij, R.; Celenza, J.L. Arabidopsis cytochrome P450s that catalyst the first step of tryptophan-dependent indole-3-acetic acid biosynthetic. Proc. Natl. Acad. Sci. USA 2000, 97, 2379–2384. [Google Scholar] [CrossRef]
  9. Hemm, M.R.; Ruegger, M.O.; Chapter, C. The Arabidopsis ref2 mutant is defective in the gene encoding CYP83A1 and shows both phenylpropanoid and glucosinolate phenotypes. Plant Cell 2003, 15, 179–194. [Google Scholar] [CrossRef]
  10. Hansen, C.H.; Du, L.; Naur, P.; Olsen, C.E.; Axelsen, K.B.; Hick, A.J.; Halkier, B.A. CYP83b1 is the oxime-metabolizing enzyme in the lucosinolate path in Arabidopsis. J. Biol. Chem. 2001, 276, 24790–24796. [Google Scholar] [CrossRef]
  11. Aghajanzadeh, T.A.; Reich, M.; Kopriva, S.; De Kok, L.J. Impact of chloride (NaCl, KCl) and sulphate (Na2SO4, K2SO4) salinity on lucosinolate metabolism in Brassica rapa. J. Agron. Crop Sci. 2018, 204, 137–146. [Google Scholar] [CrossRef]
  12. Yi, G.E.; Robin, A.H.K.; Yang, K.; Park, J.I.; Hwang, B.H.; Nou, I.S. Exogenous Method Jasmonate and Salicylic Acid Index Subspecies-Specific Patterns of Glucosinolate Accumulation and Gene Expression in Brassica learned L. Molecules 2016, 21, 1417. [Google Scholar] [CrossRef] [PubMed]
  13. Cheng, Y. Enrichment of Isothiocyanate in Western Blue Flower Buds by Selenium and Sulfur Interaction and Its Mechanism; Yangzhou University: Yangzhou, China, 2020. [Google Scholar]
  14. Yang, R.; Guo, L.; Jin, X.; Shen, C.; Zhou, Y.; Gu, Z. Enhancement of glucosinolate and sulforaphane formation of broccoli sprouts by zinc sulphate via its stress effect. J. Funct. Foods 2015, 13, 345–349. [Google Scholar] [CrossRef]
  15. Mao, S. Effect of Selenium and Sulfur Interaction on Sulforaphane Synthesis in Broccoli; Hunan Agricultural University: Changsha, China, 2019. [Google Scholar]
  16. Cheng, K. Effects of Selenium and Sulfur Interaction on Physiological and Photosynthetic Characteristics of Broccoli Seedlings; Sichuan Agricultural University: Chengdu, China, 2016. [Google Scholar]
  17. Guo, L.; Yang, R.; Wang, Z.; Guo, Q.; Gu, Z. Effect of NaCl stress on health-promoting compounds and antioxidant activity in the sprouts of three broccoli cultivars. Int. J. Food Sci. Nutr. 2014, 65, 476–481. [Google Scholar] [CrossRef]
  18. Bradford, M.M. A rapid and sensitive method for the quantification of microgram quantifications of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  19. Pramanik, B.K. Changes in acid invertase activity and sugar distribution during postharvest senescence in broccoli. Pak. J. Biol. Sci. 2004, 7, 679–684. [Google Scholar] [CrossRef]
  20. Orthofer, R.L.V.S. Analysis of total phenols and other oxidation substrates and antioxidants by means of Folin-Ciocalteu reagent. Methods Enzymol. 1998, 299, 152–178. [Google Scholar]
  21. Wang, L.I.; Shan, T.; Xie, B.; Ling, C.; Shao, S.; Jin, P.; Zheng, Y. Glycine betaine reduces chilling injection in peach fruit by enhancing phenolic and sugar metabolisms. Food Chem. 2019, 272, 530–538. [Google Scholar] [CrossRef]
  22. Papastergiadis, A.; Mubiru, E.; Van Langenhove, H.; De Meulenaer, B. Malondialdehyde Measurement in Oxidized Foods: Evaluation of the Spectrophotometric Thiobarbituric Acid Reactive Substances (TBARS) Test in Various Foods. J. Agric. Food Chem. 2012, 60, 9589–9594. [Google Scholar] [CrossRef]
  23. Tang, B.; Wang, Y.; Ma, L. Simple and rapid catalytic spectrophotometric determination of superoxide anion radical and superoxide dismutase activity in natural medical vegetables using phenol as the substrate for horseradish peroxidase. Anal. Bioanal. Chem. 2004, 378, 523–528. [Google Scholar] [CrossRef]
  24. Wang, Y.-Q.; Hu, L.-P.; Liu, G.-M.; Zhang, D.-S.; He, H.-J. Evaluation of the Nutritional Quality of Chinese Kale (Brassica alboglabra Bailey) Using UHPLC-Quadrupole-Orbitrap MS/MS-Based Metabolomics. Molecules 2017, 22, 1262. [Google Scholar] [CrossRef] [PubMed]
  25. Matusheski, N.V.; Juvik, J.A.; Jeffery, E.H. Heating decisions epithiospecifier protein activity and increments sulforaphane formation in broccoli. Phytochemistry 2004, 65, 1273–1281. [Google Scholar] [CrossRef] [PubMed]
  26. Guo, R.; Yuan, G.; Wang, Q. Effect of sucrose and mannitol on the accumulation of health-promoting compounds and the activity of metabolic enzymes in broccoli sprouts. Sci. Hortic. 2011, 128, 159–165. [Google Scholar] [CrossRef]
  27. Czechowski, T.; Bari, R.P.; Stitt, M.; Scheible, W.R.; Udvardi, M.K. Real-Time RT-PCR profiling of over 1400 Arabidopsis translation factors: Unpreceded sensitivity reveals novel root-And shoot-Specific genes. Plant J. Cell Mol. Biol. 2004, 38, 366–379. [Google Scholar] [CrossRef] [PubMed]
  28. Zhang, Y.; Lv, C.; Sun, J.; Song, X.; Makaza, N.; Wu, Y. Protective effects of broccoli extracts and sulforaphane against hydrogen peroxide induced oxidative stress in B16 cells. J. Funct. Foods 2021, 87, 104833. [Google Scholar] [CrossRef]
  29. Chu, T.; Peng, C.; Guo, L. MgSO4 Effects of treatment on physiological active substances and antioxidant capacity of broccoli sprouts. Food Sci. 2018, 39, 53–59. [Google Scholar]
  30. Ding, Y. Effects of Selenium and Sulfur Interaction on Growth and Antioxidant Quality of Pakchoi Plants; Zhejiang Agriculture and Forestry University: Hangzhou, China, 2014. [Google Scholar]
  31. Augustine, R.; Bisht, N.C. Biofortification of oilseed Brassica juncea with the anti-cancer compound glucoraphanin by supporting GSL-ALK gene family. Sci. Rep. 2015, 5, 18005. [Google Scholar] [CrossRef]
  32. Juge, N.; Mithen, R.F.; Traka, M. Molecular basis for chemoprevention by sulforaphane: A comprehensive review. Cell. Mol. Life Sci. 2007, 64, 1105–1127. [Google Scholar] [CrossRef]
  33. Aires, A.; Rosa, E.; Carvalho, R. Effect of nitrogen and sulfur fertilisation on glucosinolates in the leaves and roots of broccoli sprouts (Brassica oleracea var. italica). J. Sci. Food Cult. 2006, 86, 1512–1516. [Google Scholar] [CrossRef]
  34. Guo, L.; Yang, R.; Zhou, Y.; Gu, Z. Heat and hypoxia stresses enhance the accumulation of aliphatic glucosinolates and sulforaphane in broccoli sprouts. Eur. Food Res. Technol. 2015, 242, 107–116. [Google Scholar] [CrossRef]
  35. Guo, L.; Yang, R.; Gu, Z. Cloning of genes related to aliphatic glucosinolate metabolism and the mechanism of sulforaphane accumulation in broccoli sprouts under jasmonic acid treatment. J. Sci. Food Agric. 2016, 96, 4329–4336. [Google Scholar] [CrossRef] [PubMed]
  36. Baenas, N.; Garcia-Viguera, C.; Moreno, D.A. Biotic elicitors effectually increase the glucosinolates content in Brassicaceae sprouts. J. Agric. Food Chem. 2014, 62, 1881–1889. [Google Scholar] [CrossRef] [PubMed]
  37. Guo, R.; Hou, Q.; Yuan, G.; Zhao, Y.; Wang, Q. Effect of 2, 4-epibrassinolide on main health-promoting compounds in broccoli sprouts. LWT-Food Sci. Technol. 2014, 58, 287–292. [Google Scholar] [CrossRef]
  38. Angelino, D.; Jeffery, E. Glucosinolate hydrolysis and bioavailability of resulting isotheocyanates: Focus on glucoraphanin. J. Funct. Foods 2014, 7, 67–76. [Google Scholar] [CrossRef]
  39. Guo, Q.; Guo, L.; Wang, Z.; Zhuang, Y.; Gu, Z. Response surface optimization and identification of isotheocyanates produced from broccoli sprouts. Food Chem. 2013, 141, 1580–1586. [Google Scholar] [CrossRef]
  40. Gu, Z.-X.; Guo, Q.-H.; Gu, Y.-J. Factors Influencing Glucoraphanin and Sulforaphane Formation in Brassica Plants: A Review. J. Integr. Agric. 2012, 11, 1804–1816. [Google Scholar] [CrossRef]
Horticulturae 09 01058 g001
Figure 1. Effect of exogenous substance K2SO4 treatment on vitamin C content (A), soluble protein content (B), soluble sugar content (C), polyphenol content (D), and total flavonoids content (E) in broccoli. Note: Significant differences among different samples are indicated by different lowercase letters (a–d).
Figure 1. Effect of exogenous substance K2SO4 treatment on vitamin C content (A), soluble protein content (B), soluble sugar content (C), polyphenol content (D), and total flavonoids content (E) in broccoli. Note: Significant differences among different samples are indicated by different lowercase letters (a–d).
Horticulturae 09 01058 g001
Horticulturae 09 01058 g002
Figure 2. Effect of exogenous substance K2SO4 treatments on malondialdehyde content (A) and superoxide dismutase activity (B) in broccoli. Note: Significant differences among different samples are indicated by different lowercase letters (a–c).
Figure 2. Effect of exogenous substance K2SO4 treatments on malondialdehyde content (A) and superoxide dismutase activity (B) in broccoli. Note: Significant differences among different samples are indicated by different lowercase letters (a–c).
Horticulturae 09 01058 g002
Horticulturae 09 01058 g003
Figure 3. Effect of exogenous substance K2SO4 treatment on sulforaphane content (A) and myrosinase activity (B) in broccoli. Note: Significant differences among different samples are indicated by different lowercase letters (a–c).
Figure 3. Effect of exogenous substance K2SO4 treatment on sulforaphane content (A) and myrosinase activity (B) in broccoli. Note: Significant differences among different samples are indicated by different lowercase letters (a–c).
Horticulturae 09 01058 g003
Horticulturae 09 01058 g004
Figure 4. Effect of exogenous substance K2SO4 treatment on the expression of key genes in aliphatic glucosinolate synthesis in broccoli. Note: Expression was normalized to that of actin and the values in control plants were set to 1. Each data point is the average for each of the three biological replicates with three technical replicates against each. Note: * indicates significant differences between treatments (p < 0.05).
Figure 4. Effect of exogenous substance K2SO4 treatment on the expression of key genes in aliphatic glucosinolate synthesis in broccoli. Note: Expression was normalized to that of actin and the values in control plants were set to 1. Each data point is the average for each of the three biological replicates with three technical replicates against each. Note: * indicates significant differences between treatments (p < 0.05).
Horticulturae 09 01058 g004
Horticulturae 09 01058 g005
Figure 5. Effect of exogenous substance K2SO4 treatment on the expression of key genes for indole glucosinolate synthesis in broccoli. Note: * indicates significant differences between treatments (p < 0.05).
Figure 5. Effect of exogenous substance K2SO4 treatment on the expression of key genes for indole glucosinolate synthesis in broccoli. Note: * indicates significant differences between treatments (p < 0.05).
Horticulturae 09 01058 g005
Table 1. Gene-specific primer sequences.
Table 1. Gene-specific primer sequences.
GeneSense Primer (5′-3′)Anti-Sense Primer (5′-3′)
ActinCTGTTCCAATCTACGAGGGTTTCGCTCGGCTGTGGTGGTGAA
MYB28AGACTGCGATGGACTAACTACCTCCGACCACTTGTTTCCACGA
MYB34CGGGACGAACTGACACGACCGAGTATTTGCT
CYP79B2CGGAGATGGTAAACAAATGGAGACGGAAAGC
CYP83B1AGCAGACGCAAAGATAACCCGAAAGGTAGGA
CYP79F1TAGACGAAGTGGTGGGAGGCTACCTTTGGGAAT
CYP83A1TCCTTATCCCTCGTGCACTCGTAGTCCGTGCC
BCAT4TAGCAGAGGCGAAAGTTGTAGCCGAAATCAC
MAM1GCCGAGGATAGTCATAATCTTCGCAACCAAA
FMO2GACCGTGGTTACGGGAGACTTGGTAGCCATTGTATAACAAGCAACCC
UGT74B1TCCACAGATTCACCCATAAGCCACGGACGAGA
ST5aCAATGGAACCAACCACGACTGGGAGGGAAGCGATG
ST5bCCGACACTACCTTACCGAACCACGTGAGGAAAAGAGGCGATG
ST5cCCACGCCCAAAACTTCTTCATGAGTGGAGAAGAGCGTGTT
AOP2 GAGTAACGGAAAGAAAGAAGACAAGG ATAAGCGTGAAGAGTAGAACGAGGT
AOP3AGGTGAAGACCAAAGAGGGGAATCGGTGATACGGTGAAGGGA
SUR1GCGGTTCGGTGGAGCTGATAAGGCGGAAGCAAGGATAGACGGAAG
GSTFGAGTCTTTCCTATCCCACATCTTCGGCAACAACG
CYP81F1AAGCAGAGCGGTTCAAGAAGGCGTGACCATTGTGTTACCA
CYP81F4CGGTGGAGGAGAAGGAGAAACTGACACATGGCTCGTAACG
GSL-OHCCAGGAAGTGAGAAGTGGGTTAGCACCATCACCAGCATCA
Table 2. Effect of exogenous substance K2SO4 treatment on glucosinolate content in broccoli (μmol·g−1DW).
Table 2. Effect of exogenous substance K2SO4 treatment on glucosinolate content in broccoli (μmol·g−1DW).
Aliphatic GlucosinolateTol Aliphatic GsIndole GlucosinolatesTol Indole GsTotal
PROSINRAANAPERU4OHGBC4MENEO
S00.129 d0.057 c2.933 d0.011 b0.510 b3.639 d0.478 b3.568 c0.987 c2.089 c7.123 c10.762 c
S250.140 c0.057 c3.129 c0.015 a0.532 a3.873 c0.513 a3.458 d0.894 d1.631 d6.496 d10.368 d
S750.145 b0.061 b3.324 a0.010 b0.430 d3.970 a0.304 d4.933 b0.994 b3.842 b10.072 b14.042 b
S1500.180 a0.072 a3.196 b0.014 a0.474 c3.935 b0.470 c6.464 a1.103 a4.884 a12.922 a16.857 a
Note: PRO for 2-hydroxy-3-butenyl glucoside; RAA for 4-methylthiooxybutylthioside; NAP for 3-Butenylthioglycoside; SIN for 2-propenyl thioglycoside; 4OH for 4-hydroxyindolyl-3-methylthioglycoside; ERU for 4-methylthiobutenyl thioglycoside; GBC for 4-methylthiobutenyl thioglycoside; 4ME for 4-methylindolyl-3-methylthioglycoside; and NEO for 1-methylindolyl-3-methylthioglycoside (similarly hereinafter). Significant differences among different samples are indicated by different lowercase letters (a–d).
Table 3. Correlation analysis between glucosinolate content, enzyme activity, and gene expression treated with exogenous substance K2SO4.
Table 3. Correlation analysis between glucosinolate content, enzyme activity, and gene expression treated with exogenous substance K2SO4.
PearsonRAAGBCTOLTol
Aliphatic Gs		Tol
Indole Gs		Sulfor-AphaneMyrosi-NaseMYB34CYP79B2CYP83A1MAM1FMO2
GBC1.000 **
TOL1.000 **1.000 **
Tol aliphatic Gs0.999 **1.000 **1.000 **
Tol indole Gs1.000 **1.000 **1.000 **1.000 **
Sulforaphane0.993 **0.994 **0.994 **0.995 **0.994 **
Myrosinase−0.782−0.774−0.773−0.755−0.774−0.734
MYB340.922 **0.921 **0.921 **0.921 **0.921 **0.888 *−0.719
CYP79B20.826 *0.830 *0.831 *0.844 *0.830 *0.824 *−0.3750.897 *
CYP83A10.981 **0.983 **0.983 **0.986 **0.983 **0.993 **−0.6770.853 *0.828 *
MAM1−0.920 **−0.922 **−0.922 **−0.928 **−0.922 **−0.904 *0.59−0.976 **−0.969 **−0.890 *
FMO20.827 *0.820 *0.819 *0.8020.820 *0.788−0.989 **0.750.4240.733−0.633
UGT74B10.992 **0.991 **0.990 **0.986 **0.991 **0.979 **−0.851 *0.908 *0.7580.957 **−0.881 *0.891 *
N = 6. * Significant correlation at 0.05 level; ** The correlation was significant at the level of 0.01. Note: Red colors indicate positive correlations; blue indicates negative correlations.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, M.; Huang, W.; Zhang, J.; Zhao, Z.; Wang, Y.; Gruda, N.S.; Liu, G.; He, H. Effect of Exogenous Substance K2SO4 on the Nutritional Quality of Broccoli and Its Metabolic Regulation Mechanism. Horticulturae 2023, 9, 1058. https://doi.org/10.3390/horticulturae9091058

AMA Style

Liu M, Huang W, Zhang J, Zhao Z, Wang Y, Gruda NS, Liu G, He H. Effect of Exogenous Substance K2SO4 on the Nutritional Quality of Broccoli and Its Metabolic Regulation Mechanism. Horticulturae. 2023; 9(9):1058. https://doi.org/10.3390/horticulturae9091058

Chicago/Turabian Style

Liu, Meng, Wei Huang, Junhua Zhang, Zixuan Zhao, Yaqin Wang, Nazim S. Gruda, Guangmin Liu, and Hongju He. 2023. "Effect of Exogenous Substance K2SO4 on the Nutritional Quality of Broccoli and Its Metabolic Regulation Mechanism" Horticulturae 9, no. 9: 1058. https://doi.org/10.3390/horticulturae9091058

APA Style

Liu, M., Huang, W., Zhang, J., Zhao, Z., Wang, Y., Gruda, N. S., Liu, G., & He, H. (2023). Effect of Exogenous Substance K2SO4 on the Nutritional Quality of Broccoli and Its Metabolic Regulation Mechanism. Horticulturae, 9(9), 1058. https://doi.org/10.3390/horticulturae9091058

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop