Functional Identification of Apple MdCBL5 in Improving Fruit Quality and Its Response Under Salt Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification of the MdCBL Gene Family
2.2. Analysis of Basic Physicochemical Properties and Subcellular Localization
2.3. Analysis of Cis-Acting Elements and Phylogenetic Relationships
2.4. Protein Structure and Phosphorylation Site Analysis
2.5. Determination of Physiological Indicators
2.6. Determination of Chlorophyll Content
- (1)
- Take about 1 g of plant material, add 95% ethanol, and soak overnight at room temperature in the dark
- (2)
- When all the tissues turn white, it indicates that chlorophyll has been completely extracted
2.7. Determination of Relative Electrical Conductivity
2.8. Reactive Oxygen Species (ROS) Staining
2.9. Determination of Anthocyanin Content
2.10. Determination of Sugar Content
2.11. Quantitative Real-Time PCR (qPCR) Analysis
2.12. Plant Growth Conditions and Treatments
2.13. Obtaining the Transgenic Materials
2.14. Data Analysis
3. Results
3.1. Identification of the MdCBL Gene Family
3.2. Analysis of Chromosomal Localization, Gene Structure, and Cis-Acting Elements of MdCBL Genes
3.3. Analysis of Phosphorylation Sites, Protein Structure, and Phylogenetic Relationships of MdCBL Proteins
3.4. MdCBL5 Enhances Salt Tolerance in Apple Seedlings
3.5. MdCBL5 Suppresses Reactive Oxygen Species Burst Under Salt Stress
3.6. MdCBL5 Improves Apple Fruit Quality
4. Discussion
Limitations of the Study
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Wang, W.-X.; Zhang, Z.-X.; Wang, X.; Han, C.; Dong, Y.-J.; Wang, Y.-X. Functional Identification of ANR Genes in Apple (Malus Halliana) That Reduce Saline–Alkali Stress Tolerance. Plant Biol. 2023, 25, 892–901. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zahid, G.; Iftikhar, S.; Shimira, F.; Ahmad, H.M.; Aka Kaçar, Y. An Overview and Recent Progress of Plant Growth Regulators (PGRs) in the Mitigation of Abiotic Stresses in Fruits: A Review. Sci. Hortic. 2023, 309, 111621. [Google Scholar] [CrossRef] [Scilit]
- Sîrbu, C.E.; Deșliu-Avram, M.; Cioroianu, T.M.; Constantinescu-Aruxandei, D.; Oancea, F. High-Temperature Influences Plant Bio-Stimulant-like Effects of the Combination Particle Film-Forming Materials-Foliar Fertilizers on Apple Trees. Agriculture 2023, 13, 178. [Google Scholar] [CrossRef] [Scilit]
- Cuevas, J.; Daliakopoulos, I.N.; del Moral, F.; Hueso, J.J.; Tsanis, I.K. A Review of Soil-Improving Cropping Systems for Soil Salinization. Agronomy 2019, 9, 295. [Google Scholar] [CrossRef] [Scilit]
- Perri, S.; Molini, A.; Hedin, L.O.; Porporato, A. Contrasting Effects of Aridity and Seasonality on Global Salinization. Nat. Geosci. 2022, 15, 375–381. [Google Scholar] [CrossRef] [Scilit]
- Kour, J.; Khanna, K.; Singh, A.D.; Dhiman, S.; Bhardwaj, T.; Devi, K.; Sharma, N.; Ohri, P.; Bhardwaj, R. Calcium’s Multifaceted Functions: From Nutrient to Secondary Messenger during Stress. S. Afr. J. Bot. 2023, 152, 247–263. [Google Scholar] [CrossRef] [Scilit]
- Hong-Bo, S.; Li-Ye, C.; Ming-An, S.; Shi-Qing, L.; Ji-Cheng, Y. Bioengineering Plant Resistance to Abiotic Stresses by the Global Calcium Signal System. Biotechnol. Adv. 2008, 26, 503–510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DeFalco, T.A.; Bender, K.W.; Snedden, W.A. Breaking the Code: Ca2+ Sensors in Plant Signalling. Biochem. J. 2010, 425, 27–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ormancey, M.; Thuleau, P.; Mazars, C.; Cotelle, V. CDPKs and 14-3-3 Proteins: Emerging Duo in Signaling. Trends Plant Sci. 2017, 22, 263–272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Q.; Gao, L.; Yu, F.; Lü, S.; Yang, P. Evolution and Diversification of CaM/CML Gene Family in Green Plants. Plant Physiol. Biochem. 2023, 202, 107922. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohanta, T.K.; Kumar, P.; Bae, H. Genomics and Evolutionary Aspect of Calcium Signaling Event in Calmodulin and Calmodulin-like Proteins in Plants. BMC Plant Biol. 2017, 17, 38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poovaiah, B.W. Role of Calcium and Calmodulin in Plant Growth and Development. HortScience 1985, 20, 347–352. [Google Scholar] [CrossRef] [Scilit]
- Dekomah, S.D.; Bi, Z.; Dormatey, R.; Wang, Y.; Haider, F.U.; Sun, C.; Yao, P.; Bai, J. The role of CDPKs in plant development, nutrient and stress signaling. Front. Genet. 2022, 13, 996203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boudsocq, M.; Sheen, J. CDPKs in Immune and Stress Signaling. Trends Plant Sci. 2013, 18, 30–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, X.; Li, Q.-H.; Yu, Y.-N.; Qiao, Y.-M.; Haq, S.u.; Gong, Z.-H. The CBL–CIPK Pathway in Plant Response to Stress Signals. Int. J. Mol. Sci. 2020, 21, 5668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bihani, S.C.; Tarushi; Srivastava, A.K. Decoding the Calcium Signal: Structural Insights into CBL-CIPK Pathway in Plants. Biochim. ET Biophys. Acta (BBA)-Gen. Subj. 2025, 1869, 130819. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mao, J.; Mo, Z.; Yuan, G.; Xiang, H.; Visser, R.G.F.; Bai, Y.; Liu, H.; Wang, Q.; van der Linden, C.G. The CBL-CIPK Network Is Involved in the Physiological Crosstalk between Plant Growth and Stress Adaptation. Plant Cell Environ. 2023, 46, 3012–3022. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.S.; Wang, S.T.; Mei, Q.; Sun, T.; Hu, J.T.; Xiao, G.S.; Chen, H.; Xuan, Y.H. The Role of CBL–CIPK Signaling in Plant Responses to Biotic and Abiotic Stresses. Plant Mol. Biol. 2024, 114, 53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Das, P.K.; Bhatnagar, T.; Banik, S.; Majumdar, S.; Dutta, D. Structural and Molecular Dynamics Simulation Studies of CBL-Interacting Protein Kinase CIPK and Its Complexes Related to Plant Salinity Stress. J. Mol. Model. 2024, 30, 248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kudla, J.; Xu, Q.; Harter, K.; Gruissem, W.; Luan, S. Genes for Calcineurin B-like Proteins in Arabidopsis Are Differentially Regulated by Stress Signals. Proc. Natl. Acad. Sci. USA 1999, 96, 4718–4723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mao, J.; Manik, S.; Shi, S.; Chao, J.; Jin, Y.; Wang, Q.; Liu, H. Mechanisms and Physiological Roles of the CBL-CIPK Networking System in Arabidopsis Thaliana. Genes 2016, 7, 62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, M.; Zhao, C.; Zhao, M.; Li, Y.; Wen, G. Phylogeny and Evolution of Calcineurin B-Like (CBL) Gene Family in Grass and Functional Analyses of Rice CBLs. J. Plant Biol. 2020, 63, 117–130. [Google Scholar] [CrossRef] [Scilit]
- de la Torre, F.; Gutierrez-Beltran, E.; Pareja-Jaime, Y.; Chakravarthy, S.; Martin, G.B.; del Pozo, O. The Tomato Calcium Sensor Cbl10 and Its Interacting Protein Kinase Cipk6 Define a Signaling Pathway in Plant Immunity. Plant Cell 2013, 25, 2748–2764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cho, J.H.; Sim, S.-C.; Kim, K.-N. Calcium Sensor SlCBL4 Associates with SlCIPK24 Protein Kinase and Mediates Salt Tolerance in Solanum Lycopersicum. Plants 2021, 10, 2173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xi, Y.; Liu, J.; Dong, C.; Cheng, Z.-M. (Max) The CBL and CIPK Gene Family in Grapevine (Vitis vinifera): Genome-Wide Analysis and Expression Profiles in Response to Various Abiotic Stresses. Front. Plant Sci. 2017, 8, 00978. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Long, Y.; Qi, G.-N.; Li, J.; Xu, Z.-J.; Wu, W.-H.; Wang, Y. The Os-AKT1 Channel Is Critical for K + Uptake in Rice Roots and Is Modulated by the Rice CBL1-CIPK23 Complex. Plant Cell 2014, 26, 3387–3402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Zhang, C.; Tang, R.-J.; Xu, H.-X.; Lan, W.-Z.; Zhao, F.; Luan, S. Calcineurin B-Like Proteins CBL4 and CBL10 Mediate Two Independent Salt Tolerance Pathways in Arabidopsis. Int. J. Mol. Sci. 2019, 20, 2421. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, F.; Li, L.; Jiao, Z.; Chen, Y.; Liu, H.; Chen, X.; Fu, J.; Wang, G.; Zheng, J. Characterization of the Calcineurin B-Like (CBL) Gene Family in Maize and Functional Analysis of ZmCBL9 under Abscisic Acid and Abiotic Stress Treatments. Plant Sci. 2016, 253, 118–129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, C.; Lu, S.; Zhou, R.; Wang, Z.; Li, Y.; Fang, H.; Wang, B.; Chen, M.; Cao, Y. The OsCBL8–OsCIPK17 Module Regulates Seedling Growth and Confers Resistance to Heat and Drought in Rice. Int. J. Mol. Sci. 2022, 23, 12451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tuteja, N.; Mahajan, S. Further Characterization of Calcineurin B-Like Protein and Its Interacting Partner CBL-Interacting Protein Kinase from Pisum sativum. Plant Signal. Behav. 2007, 2, 358–361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Yin, W.; Xia, X. Calcineurin B-Like Family in Populus: Comparative Genome Analysis and Expression Pattern under Cold, Drought and Salt Stress Treatment. Plant Growth Regul. 2008, 56, 129–140. [Google Scholar] [CrossRef] [Scilit]
- Reiser, L.; Proia, A.; Bakker, E.; Subramaniam, S.; Khosa, K.; Sawant, S.; Chen, X.; Prithvi, T.; Berardini, T.Z. Recent Major Changes to TAIR: Updates to the Database, Website, and Arabidopsis Genome. Genetics 2026, 232, iyaf248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, S.; Staton, M.; Lee, T.; Blenda, A.; Svancara, R.; Abbott, A.; Main, D. GDR (Genome Database for Rosaceae): Integrated Web-Database for Rosaceae Genomics and Genetics Data. Nucleic Acids Res. 2007, 36, D1034–D1040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, S.; Stecher, G.; Suleski, M.; Sanderford, M.; Sharma, S.; Tamura, K. MEGA12: Molecular Evolutionary Genetic Analysis Version 12 for Adaptive and Green Computing. Mol. Biol. Evol. 2024, 41, msae263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geourjon, C.; Deléage, G. SOPMA: Significant Improvements in Protein Secondary Structure Prediction by Consensus Prediction from Multiple Alignments. Bioinformatics 1995, 11, 681–684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abramson, J.; Adler, J.; Dunger, J.; Evans, R.; Green, T.; Pritzel, A.; Ronneberger, O.; Willmore, L.; Ballard, A.J.; Bambrick, J.; et al. Accurate Structure Prediction of Biomolecular Interactions with AlphaFold 3. Nature 2024, 630, 493–500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blom, N.; Sicheritz-Pontén, T.; Gupta, R.; Gammeltoft, S.; Brunak, S. Prediction of Post-translational Glycosylation and Phosphorylation of Proteins from the Amino Acid Sequence. Proteomics 2004, 4, 1633–1649. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Z.; Zhao, L.; Li, T.; Li, X.; Ma, S.; Gao, H.; Sha, R.; Tian, G.; Xu, X.; Xing, Y.; et al. Salt Stress Response Pathway and Regulatory Mechanism of the Malus Domestica G Protein-Coupled Receptor MdGPCR. Hortic. Plant J. 2025, 12, 1509–1520. [Google Scholar] [CrossRef] [Scilit]
- Feng, Z.-Q.; Li, T.; Wang, X.; Sun, W.-J.; Zhang, T.-T.; You, C.-X.; Wang, X.-F. Identification and Characterization of Apple MdNLP7 Transcription Factor in the Nitrate Response. Plant Sci. 2022, 316, 111158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanwar, P.; Sanyal, S.K.; Tokas, I.; Yadav, A.K.; Pandey, A.; Kapoor, S.; Pandey, G.K. Comprehensive Structural, Interaction and Expression Analysis of CBL and CIPK Complement during Abiotic Stresses and Development in Rice. Cell Calcium 2014, 56, 81–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qu, M.; Sun, Q.; Chen, N.; Chen, Z.; Zhang, H.; Lv, F.; An, Y. Functional Characterization of a New Salt Stress Response Gene, PeCBL4, in Populus Euphratica Oliv. Forests 2023, 14, 1504. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Guo, Y. Unraveling Salt Stress Signaling in Plants. J. Integr. Plant Biol. 2018, 60, 796–804. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.; Fu, C.; Li, G.; Khan, M.N.; Wu, H. ROS Homeostasis and Plant Salt Tolerance: Plant Nanobiotechnology Updates. Sustainability 2021, 13, 3552. [Google Scholar] [CrossRef] [Scilit]
- Anee, T.I.; Sewelam, N.A.; Bautista, N.S.; Hirayama, T.; Suzuki, N. Roles of ROS and NO in Plant Responses to Individual and Combined Salt Stress and Waterlogging. Antioxidants 2025, 14, 1455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, S.; Chen, W.; Sun, W. Comparative Proteomic Analysis of the Arabidopsis Cbl1 Mutant in Response to Salt Stress. Proteomics 2011, 11, 4712–4725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, Q.; Bai, B.; Almutairi, B.O.; Kudla, J. Emerging Roles of the CBL-CIPK Calcium Signaling Network as Key Regulatory Hub in Plant Nutrition. J. Plant Physiol. 2021, 257, 153335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.; Mao, Z.; Zhao, Z.; Gao, S.; Luo, Y.; Liu, Z.; Sheng, X.; Zhai, X.; Liu, J.; Li, C. CBL1/CIPK23 Phosphorylates Tonoplast Sugar Transporter TST2 to Enhance Sugar Accumulation in Sweet Orange (Citrus Sinensis). J. Integr. Plant Biol. 2025, 67, 327–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Primer Name | Primer-F | Primer-R |
|---|---|---|
| MdCBL5-F | TGATGACGGACTTATCCACAAGG | CCGAGAGTACCAGATCAGATTCG |
| Md18s-F | ACACGGGGAGGTAGTGACAA | CCTCCAATGGATCCTCGTTA |
| MdSOS1-F | AGGAAACCATGAAATTGTGTGG | GATCATGTCACAAATGTAGGGC |
| MdSOS2-F | AATCAATGGGTCTCAAGGTC | CCTCCTTCGGTTTCCAAATA |
| MdSOS3-F | GGGGTTATTGAGTTTGGAGA | GGATGCTTCGACACAAATTC |
| MdSPS6-F | CACATACCTGAATTCGTCGATG | GTGACCATGAATCACATAAGGC |
| MdVGT1-F | ATGTGCTACAATCTCCGTAGAG | CTACTGCTGTAACTAGAGCTCC |
| MdTMT2-F | GATCCTCTCGTCTCTCTCTTTG | GGACTCTGCAAATTGTCATCAG |
| MdSUT3-F | TATCGCCGTTTCCGTTCTAATA | CTGAGTGATCCAATTGCATAGC |
| MdSUSY2-F | GCCATTTAATGCATCATTCCCT | GCGGGAACTTGGAAAGATATTC |
| MdSUSY5-F | ATACTTTCTGGAGGCAGTTGAA | TTGAGATGCCTTAATGTGGTCT |
| MdCBL1 | GAAATGAAGCTGGCTGATGAGAC | ATGTAGCGATCTCATCAACCTCG |
| MdCBL2 | ACCCTGAAATTCTAGCAAGGGAG | TTGGGATGAAAGACAGAGAGAGC |
| MdCBL3 | CGTTAAACGGAAGGGTGTGATTG | GTCTCATCAGCCAGCTTCATTTC |
| MdCBL4 | GAAGTGGAGGCCTTGTATGAACT | CAATGTAACCAGTCTGTCCGAGA |
| MdCBL6 | CTCGCCGATGAAACCAGATTTAC | TCATCAATAGGGGCGTAAGGATG |
| MdCBL7 | TTCTAGCAAGGGAGACAGTGTTC | TTGGGATGAAAGACAGAGAGAGC |
| Gene Name | Sequence ID | Number of Amino Acid | Molecular Weight | Theoretical pI | Instability Index | Aliphatic Index | Grand Average of Hydropathicity | Subcellular Localization Prediction |
|---|---|---|---|---|---|---|---|---|
| MdCBL1 | MD00G1132600 | 213 | 24,520.95 | 4.75 | 41.54 | 88.78 | −0.182 | Nucleus |
| MdCBL2 | MD03G1036500 | 226 | 26,058.67 | 4.8 | 46.83 | 93.19 | −0.235 | Nucleus |
| MdCBL3 | MD06G1046100 | 213 | 24,515.92 | 4.75 | 38.82 | 90.61 | −0.186 | Nucleus |
| MdCBL4 | MD06G1109200 | 212 | 24,418.72 | 4.71 | 37.12 | 94.25 | −0.192 | Nucleus |
| MdCBL5 | MD07G1288800 | 212 | 24,387.71 | 4.63 | 37.47 | 85.52 | −0.302 | Cytosol |
| MdCBL6 | MD08G1043100 | 246 | 28,283.39 | 4.75 | 49.2 | 93.94 | −0.065 | Cytosol |
| MdCBL7 | MD11G1037200 | 210 | 24,196.73 | 4.97 | 48.76 | 97.52 | −0.205 | Chloroplast |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Lyu, X.; Li, T.; Sha, R.-X.; Zhang, Q.; Li, Z.; Luo, L.-X.; Ge, S.-F.; Zhu, Z.-L.; Zhang, Y.-L.; Wu, S.; et al. Functional Identification of Apple MdCBL5 in Improving Fruit Quality and Its Response Under Salt Stress. Horticulturae 2026, 12, 845. https://doi.org/10.3390/horticulturae12070845
Lyu X, Li T, Sha R-X, Zhang Q, Li Z, Luo L-X, Ge S-F, Zhu Z-L, Zhang Y-L, Wu S, et al. Functional Identification of Apple MdCBL5 in Improving Fruit Quality and Its Response Under Salt Stress. Horticulturae. 2026; 12(7):845. https://doi.org/10.3390/horticulturae12070845
Chicago/Turabian StyleLyu, Xiaoyang, Tong Li, Ru-Xue Sha, Qi Zhang, Zhi Li, Long-Xin Luo, Shun-Feng Ge, Zhan-Ling Zhu, Ya-Li Zhang, Shang Wu, and et al. 2026. "Functional Identification of Apple MdCBL5 in Improving Fruit Quality and Its Response Under Salt Stress" Horticulturae 12, no. 7: 845. https://doi.org/10.3390/horticulturae12070845
APA StyleLyu, X., Li, T., Sha, R.-X., Zhang, Q., Li, Z., Luo, L.-X., Ge, S.-F., Zhu, Z.-L., Zhang, Y.-L., Wu, S., Liang, C.-L., Jiang, Y.-M., Li, Y.-Y., Jiang, H., & Feng, Z.-Q. (2026). Functional Identification of Apple MdCBL5 in Improving Fruit Quality and Its Response Under Salt Stress. Horticulturae, 12(7), 845. https://doi.org/10.3390/horticulturae12070845

