Depth-Dependent Responses of Microbial Community Structure and Function to Reductive Soil Disinfestation
Abstract
1. Introduction
2. Materials and Methods
2.1. Field Site and Organic Amendments
2.2. Experimental Design and Soil Sampling
2.3. Measurement of Soil Physicochemical Properties
2.4. Determination of Soil Microbial Activity and Metabolic Activities
2.5. DNA Extraction and Quantitative PCR Analysis
2.6. MiSeq Sequencing and Bioinformation Analysis
2.7. Statistical Analysis
3. Results
3.1. Soil Physicochemical Properties
3.2. Soil Microbial Activity and Absolute Microbial Abundances
3.3. Soil Microbial Community Diversity and Structure
3.4. Microbial Community Composition
3.4.1. Bacterial-Fungal Co-Occurrence Networks
3.4.2. Composition of Dominant Phyla
3.4.3. Composition of Dominant Genera
3.5. Microbial Metabolic Activity
3.6. Relationships Among Microbial Community Structure, Metabolic Function, and Pathogen Abundance
4. Discussion
4.1. RSD Alleviates Soil Acidification and Secondary Salinization Across the 0–30 cm Soil Profile
4.2. Differential Pathogen Suppression by RSD Amendments Across the 0–30 cm Soil Profile
4.3. Liquid RSD Amendments More Strongly Shape Microbial Community Structure and Function Across the 0–30 cm Soil Profile
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, K.G.; Lu, Q.F.; Dou, Z.C.; Chi, Z.G.; Cui, D.M.; Ma, J.; Wang, G.W.; Kuang, J.L.; Wang, N.Q.; Zuo, Y.M. A review of research progress on continuous cropping obstacles. Front. Agric. Sci. Eng. 2024, 11, 253–270. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Yang, Z.; Liu, J.; Li, X.; Wang, X.; Dai, C.; Zhang, T.; Carrión, V.J.; Wei, Z.; Cao, F.; et al. Crop rotation and native microbiome inoculation restore soil capacity to suppress a root disease. Nat. Commun. 2023, 14, 8126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, C.; Geng, H.Y.; Li, W.X.; Li, Y.Y.; Lu, Y.S.; Xie, K.Z.; Sun, L.L.; Zhang, J.X.; Peng, H.L.; Shi, C.H.; et al. Innate root exudates contributed to contrasting coping strategies in response to Ralstonia solanacearum in resistant and susceptible tomato cultivars. J. Agric. Food Chem. 2023, 71, 20092–20104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gamliel, A.; Austerweil, M.; Kritzman, G. Non-chemical approach to soilborne pest management-organic amendments. Crop Prot. 2000, 19, 847–853. [Google Scholar] [CrossRef] [Scilit]
- Shao, Q.; Li, X.P.; Zhao, T.; Wu, Y.Y.; Xiang, L.Q.; Pan, S.F.; Guo, Z.H.; Liu, L.L. Role of reductive soil disinfestation and chemical soil fumigation on the Fusarium wilt of Dioscorea batatas Decne suppression. Sustainability 2023, 15, 11991. [Google Scholar] [CrossRef] [Scilit]
- Mendes, R.; Kruijt, M.; de Bruijn, I.; Dekkers, E.; van der Voort, M.; Schneider, J.H.M.; Piceno, Y.M.; DeSantis, T.Z.; Andersen, G.L.; Bakker, P.A.H.M.; et al. Deciphering the rhizosphere microbiome for disease-suppressive bacteria. Science 2011, 332, 1097–1100. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.Y.; Liang, S.W.; Wang, J.K.; Zhang, X.K.; Mahamood, M.; Yu, J.; Zhang, X.P.; Liang, A.Z.; Liang, W.J. Tillage and crop succession effects on soil microbial metabolic activity and carbon utilization in a clay loam soil. Eur. J. Soil Biol. 2018, 88, 97–104. [Google Scholar] [CrossRef] [Scilit]
- Feng, H.; Fu, R.; Luo, J.; Hou, X.; Gao, K.; Su, L.; Xu, Y.; Miao, Y.; Liu, Y.; Xu, Z.; et al. Listening to plant’s Esperanto via root exudates: Reprogramming the functional expression of plant growth-promoting rhizobacteria. New Phytol. 2023, 239, 2307–2319. [Google Scholar] [CrossRef] [Scilit]
- Hermans, S.M.; Buckley, H.L.; Case, B.S.; Curran-Cournane, F.; Taylor, M.; Lear, G. Soil plant growth-promoting bacterial diversity changes with land use intensity and environmental conditions. Glob. Ecol. Biogeogr. 2025, 34, e70092. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.Q.; Zhao, J.; Zhou, X.; Zhang, J.B.; Cai, Z.C. Differential responses of soil bacterial community and functional diversity to reductive soil disinfestation and chemical soil disinfestation. Geoderma 2019, 348, 124–134. [Google Scholar] [CrossRef] [Scilit]
- Zhao, J.; Liu, S.Z.; Zhou, X.; Xia, Q.; Liu, X.; Zhang, S.R.; Zhang, J.B.; Cai, Z.C.; Huang, X.Q. Reductive soil disinfestation incorporated with organic residue combination significantly improves soil microbial activity and functional diversity than sole residue incorporation. Appl. Microbiol. Biotechnol. 2020, 104, 7573–7588. [Google Scholar] [CrossRef] [Scilit]
- Yan, Y.Y.; Xie, Y.; Zhang, J.Q.; Li, R.M.; Ali, A.; Cai, Z.C.; Huang, X.Q.; Liu, L.L. Effects of reductive soil disinfestation combined with liquid−readily decomposable compounds and solid plant residues on the bacterial community and functional composition. Microb. Ecol. 2022, 86, 1132–1144. [Google Scholar] [CrossRef] [Scilit]
- Barbour, K.M.; Weihe, C.; Allison, S.D.; Martiny, J.B.H. Bacterial community response to environmental change varies with depth in the surface soil. Soil Blol. Blochem. 2022, 172, 108761. [Google Scholar] [CrossRef] [Scilit]
- Pei, J.; Li, J.; Luo, Y.; Rillig, M.C.; Smith, P.; Gao, W.; Li, B.; Fang, C.; Nie, M. Patterns and drivers of soil microbial carbon use efficiency across soil depths in forest ecosystems. Nat. Commun. 2025, 16, 5218. [Google Scholar] [CrossRef] [Scilit]
- Ben-Yephet, Y.; Reuven, M.; Genizi, A. Effects of inoculum depth and density on Fusarium wilt in carnations. Phytopathology 1995, 84, 1393–1398. [Google Scholar] [CrossRef] [Scilit]
- Bakker, P.A.H.M.; Pieterse, C.M.J.; de Jonge, R.; Berendsen, R.L. The Soil-Borne Legacy. Cell 2018, 172, 1178–1180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, L.L.; Huang, X.Q.; Zhao, J.; Zhang, J.B.; Cai, Z.C. Characterizing the key agents in a disease-suppressed soil managed by reductive soil disinfestation. Appl. Environ. Microb. 2019, 85, e02992-18. [Google Scholar] [CrossRef] [Scilit]
- Lopes, E.A.; Canedo, E.J.; Gomes, V.A.; Vieira, B.S.; Parreira, D.F.; Neves, W.S. Anaerobic soil disinfestation for the management of soilborne pathogens: A review. Appl. Soil Ecol. 2022, 174, 104408. [Google Scholar] [CrossRef] [Scilit]
- Butler, D.M.; Rosskopf, E.N.; Kokalis-Burelle, N.; Albano, J.P.; Muramoto, J.; Shennan, C. Exploring warm-season cover crops as carbon sources for anaerobic soil disinfestation (ASD). Plant Soil 2012, 355, 149–165. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.L.; Kong, J.J.; Cui, H.L.; Zhang, J.B.; Wang, F.H.; Cai, Z.C.; Huang, X.Q. Relationships of decomposability and C/N ratio in different types of organic matter with suppression of Fusarium oxysporum and microbial communities during reductive soil disinfestation. Biol. Control 2016, 101, 103–113. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.L.; Xie, Y.; Zhong, X.; Deng, Q.Q.; Shao, Q.; Cai, Z.C.; Huang, X.Q. Facilitating effects of the reductive soil disinfestation process combined with Paenibacillus sp. amendment on soil health and physiological properties of Momordica charantia. Front. Plant Sci. 2023, 13, 1095656. [Google Scholar] [CrossRef] [Scilit]
- Xia, Q.; Zeng, L.B.; Yu, W.H.; Liu, Z.H.; Wang, M.Q.; Yang, Y.R.; Dai, S.Y.; Zhang, J.B.; Cai, Z.C.; Liu, L.L.; et al. The efficacy of reductive soil disinfestations on disease control is highly dependent on the microbiomes they reconstructed. Agric. Ecosyst. Environ. 2025, 382, 109501. [Google Scholar] [CrossRef] [Scilit]
- Bremner, J.M.; Jenkinson, D.S. Determination of organic carbon in soil. I. Oxidation by dichromate of organic matter in soil and plant materials. Eur. J. Soil Sci. 1960, 11, 394–402. [Google Scholar] [CrossRef] [Scilit]
- Bremner, J.M. Determination of nitrogen in soil by the Kjeldahl method. J. Agric. Sci. 1960, 55, 11–33. [Google Scholar] [CrossRef] [Scilit]
- Robertson, J.A. Comparison of an acid and an alkaline extracting solution for measuring available phosphorus in Alberta soils. Can. J. Soil Sci. 1962, 42, 115–121. [Google Scholar] [CrossRef] [Scilit]
- Peck, N.H.; Macdonald, G.E. Table beet responses to residual and band-applied phosphorus and potassium. Agron. J. 1981, 73, 1037–1041. [Google Scholar] [CrossRef] [Scilit]
- Adam, G.; Duncan, H. Development of a sensitive and rapid method for the measurement of total microbial activity using fluorescein diacetate (FDA) in a range of soils. Soil Biol. Biochem. 2001, 33, 943–951. [Google Scholar] [CrossRef] [Scilit]
- Garland, J.L. Analytical approaches to the characterization of samples of microbial communities using patterns of potential C source utilization. Soil Biol. Biochem. 1996, 28, 213–221. [Google Scholar] [CrossRef] [Scilit]
- Fisk, M.C.; Ruether, K.F.; Yavitt, J.B. Microbial activity and functional composition among northern peatland ecosystems. Soil Biol. Biochem. 2003, 35, 591–602. [Google Scholar] [CrossRef] [Scilit]
- Lane, D.J. 16S/23S rRNA sequencing. In Nucleic Acid Techniques in Bacterial Systematics, 2nd ed.; Stackenbrandt, E., Goodfellow, M., Eds.; John Wiley and Sons: Chichester, UK, 1991; pp. 115–175. [Google Scholar]
- Muyzer, G.; de Waal, E.C.; Uitterlinden, A.G. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microb. 1993, 59, 695–700. [Google Scholar] [CrossRef] [Scilit]
- Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes-application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef] [Scilit]
- Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lievens, B.; Brouwer, M.; Vanachter, A.C.R.C.; Cammue, B.P.A.; Thomma, B.P.H.J. Real-time PCR for detection and quantification of fungal and oomycete tomato pathogens in plant and soil samples. Plant Sci. 2006, 171, 155–165. [Google Scholar] [CrossRef] [Scilit]
- Lievens, B.; Brouwer, M.; Vanachter, A.C.R.C.; Lévesque, C.A.; Cammue, B.P.A.; Thomma, B.P.H.J. Quantitative assessment of phytopathogenic fungi in various substrates using a DNA macroarray. Environ. Microbiol. 2005, 7, 1698–1710. [Google Scholar] [CrossRef] [Scilit]
- Caporaso, J.G.; Lauber, C.L.; Walters, W.A.; Berg-Lyons, D.; Lozupone, C.A.; Turnbaugh, P.J.; Fierer, N.; Knight, R. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proc. Natl. Acad. Sci. USA 2011, 108, 4516–4522. [Google Scholar] [CrossRef] [Scilit]
- Lane, D.J.; Pace, B.; Olsen, G.J.; Stahl, D.A.; Sogin, M.L.; Pace, N.R. Rapid determination of 16s ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci. USA 1985, 82, 6955–6959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [Scilit]
- Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2013, 41, D590–D596. [Google Scholar] [CrossRef] [Scilit]
- Kõljalg, U.; Nilsson, R.H.; Abarenkov, K.; Tedersoo, L.; Taylor, A.F.S.; Bahram, M. Towards a unified paradigm for sequence-based identification of fungi. Mol. Ecol. 2013, 22, 5271–5277. [Google Scholar] [CrossRef] [Scilit]
- McMurdie, P.J.; Holmes, S. Phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 2013, 8, e61217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oksanen, J.; Simpson, G.L.; Blanchet, G.; Kindt, R.; Legendre, P.; Minchin, P.R. Vegan: Community Ecology Package. Available online: https://cran.r-project.org/web/packages/vegan/index.html (accessed on 13 September 2025).
- Steinhauser, D.; Krall, L.; Mussig, C.; Bussis, D.; Usadel, B. Correlation networks. In Analysis of Biological Networks; Junker, B.H., Schreiber, F., Eds.; John Wiley & Sons Inc.: Hoboken, NJ, USA, 2007; pp. 305–333. [Google Scholar]
- Bastian, M.; Heymann, S.; Jacomy, M. Gephi: An open source software for exploring and manipulating networks. In Proceedings of the Third International AAAI Conference on Weblogs and Social Media, San Jose, CA, USA, 17–20 May 2009; Volume 3, pp. 361–362. [Google Scholar]
- Yan, Y.Y.; Zhou, X.; Liu, L.L.; Cai, Z.C.; Penuelas, J.; Huang, X.Q. Soil Nutrient Enrichment Induces Trade-Offs in Bacterial Life-History Strategies Promoting Plant Productivity. Adv. Sci. 2025, 12, e10066. [Google Scholar] [CrossRef] [Scilit]
- Li, X.G.; Chen, D.L.; Carrión, V.J.; Revillini, D.; Yin, S.; Dong, Y.H.; Zhang, T.L.; Wang, X.X.; Delgado-Baquerizo, M. Acidification suppresses the natural capacity of soil microbiome to fight pathogenic Fusarium infections. Nat. Commun. 2023, 14, 6188. [Google Scholar] [CrossRef] [Scilit]
- Janvier, C.; Villeneuve, F.; Alabouvette, C.; Edel-Hermann, V.; Mateille, T.; Steinberg, C. Soil health through soil disease suppression: Which strategy from descriptors to indicators? Soil Biol. Biochem. 2007, 39, 1–23. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.Q.; Liu, L.L.; Wen, T.; Zhang, J.B.; Shen, Q.R.; Cai, Z.C. Reductive soil disinfestations combined or not with Trichoderma for the treatment of a degraded and Rhizoctonia solani infested greenhouse soil. Sci. Hortic. 2016, 206, 51–61. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.Q.; Wen, T.; Zhang, J.B.; Meng, L.; Zhu, T.B.; Cai, Z.C. Toxic organic acids produced in biological soil disinfestation mainly caused the suppression of Fusarium oxysporum f. sp. cubense. BioControl 2015, 60, 113–124. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.L.; Chen, Z.Y.; Su, Z.; Li, S.; Ali, A.; Cai, Z.C.; Dai, C.C.; Huang, X.Q. Soil pH indirectly determines Ralstonia solanacearum colonization through its impacts on microbial networks and specific microbial groups. Plant Soil 2022, 482, 73–88. [Google Scholar] [CrossRef] [Scilit]
- Wei, Z.; Gu, Y.; Friman, V.P.; Kowalchuk, G.A.; Xu, Y.C.; Shen, Q.R.; Jousset, A. Initial soil microbiome composition and functioning predetermine future plant health. Sci. Adv. 2019, 5, eaaw0759. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghosheh, A.; Alon, M.; Kenneth-Mordoch, S.; Kleinman, Z.; Medema, M.H.; Finkel, O.M. Diverse rhizospheric Bacillus are required for protection against a leaf pathogen. ISME J. 2025, 34, 40590505. [Google Scholar] [CrossRef] [Scilit]
- Gauri, S.S.; Mandal, S.M.; Pati, B.R. Impact of Azotobacter exopolysaccharides on sustainable agriculture. Appl. Microbiol. Biotechnol. 2012, 95, 331–338. [Google Scholar] [CrossRef] [Scilit]
- Bastián, F.; Cohen, A.; Piccoli, P.; Luna, V.; Bottini, R.; Baraldi, R.; Bottini, R. Production of indole-3-acetic acid and gibberellins A1 and A3 by Acetobacter diazotrophicus and Herbaspirillum seropedicae in chemically-defined culture media. Plant Growth Regul. 1998, 24, 7–11. [Google Scholar] [CrossRef] [Scilit]
- Kinay, P.; Mansour, M.F.; Gabler, F.M.; Margosan, D.A.; Smilanick, J.L. Characterization of fungicide-resistant isolates of Penicillium digitatum collected in California. Crop Prot. 2007, 26, 647–656. [Google Scholar] [CrossRef] [Scilit]
- Rekdal, V.; Villalobos-Escobedo, J.; Rodriguez-Valeron, N.; Garcia, M.; Vásquez, D.; Rosales, A. Neurospora intermedia from a traditional fermented food enables waste-to-food conversion. Nat. Microbiol. 2024, 9, 2666–2683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, Z.; Zhao, W.C.; Ma, H.T.; Gao, J.; Wang, R.F.; Li, C.C.; Zhang, H.; Li, M.J.; Yang, Q.X. Characteristics of microbial community during the different growth stages of yam (Dioscorea opposita Thunb. cv. Tiegun). Appl. Soil Ecol. 2024, 201, 105519. [Google Scholar] [CrossRef] [Scilit]






| Target | Primer | Sequence (5′-3′) | Amplification Procedures | References |
|---|---|---|---|---|
| Bacterial 16S rRNA | 338F | ACTCCTACGGGAGGCAGCAG | Pre-denaturation at 95 °C for 1 min, followed by 39 cycles of denaturation at 95 °C for 5 s and annealing at 60 °C for 30 s | [30] |
| 518R | ATTACCGCGGCTGCTGG | [31] | ||
| Fungal ITS | ITS1F | CTTGGTCATTTAGAGGAAGTAA | [32] | |
| ITS2 | GCTGCGTTCTTCATCGATGC | [33] | ||
| Fusarium solani | ITS1F | CTTGGTCATTTAGAGGAAGTAA | [32] | |
| AFP346 | GGTATGTTCACAGGGTTGATG | [34] | ||
| Fusarium oxysporum | ITS1F | CTTGGTCATTTAGAGGAAGTAA | Pre-denaturation at 95 °C for 1 min, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing at 58 °C for 15 s | [32] |
| AFP308 | CGAATTAACGCGAGTCCCAAC | [35] | ||
| 16S rRNA sequencing | 515F | GTGCCAGCMGCCGCGG | Pre-denaturation at 98 °C for 1 min, followed by 30 cycles of denaturation at 98 °C for 10 s and annealing at 50 °C for 30 s | [36] |
| 907R | CCGTCAATTCMTTTRAGTTT | [37] | ||
| ITS sequencing | ITS1F | CTTGGTCATTTAGAGGAAGTAA | [32] | |
| ITS2R | GCTGCGTTCTTCATCGATGC | [33] |
| Property | 0–15 cm Soil Layer | 15–30 cm Soil Layer | ||||
|---|---|---|---|---|---|---|
| CK | RB-RSD | MO-RSD | CK | RB-RSD | MO-RSD | |
| pH | 4.11 ± 0.11 b | 5.23 ± 0.03 a | 5.28 ± 0.08 a | 4.32 ± 0.06 C | 4.84 ± 0.02 A | 4.63 ± 0.08 B |
| EC (μS·cm−1) | 406.3 ± 33.06 a | 97.34 ± 10.52 b | 106.8 ± 5.72 b | 78.51 ± 7.92 A | 43.54 ± 1.27 B | 36.44 ± 0.41 B |
| NO3−-N (mg·kg−1) | 135.0 ± 2.25 a | 0.72 ± 0.38 b | 0.42 ± 0.11 b | 20.00 ± 2.19 A | 1.31 ± 0.84 B | 0.60 ± 0.10 B |
| NH4+-N (mg·kg−1) | 55.55 ± 16.41 b | 97.50 ± 2.45 a | 88.15 ± 5.27 a | 16.18 ± 1.87 C | 33.98 ± 4.99 A | 24.95 ± 2.17 B |
| TOC (g·kg−1) | 26.02 ± 0.46 b | 29.65 ± 0.70 a | 27.67 ± 1.57 ab | 11.56 ± 1.52 A | 12.13 ± 0.85 A | 11.67 ± 0.83 A |
| TN (g·kg−1) | 3.52 ± 0.11 a | 3.35 ± 0.06 b | 3.30 ± 0.02 b | 1.38 ± 0.15 A | 1.54 ± 0.16 A | 1.33 ± 0.10 A |
| AP (mg·kg−1) | 179.5 ± 6.77 a | 151.3 ± 10.09 b | 142.2 ± 9.75 b | 53.82 ± 0.68 A | 36.18 ± 4.39 B | 16.18 ± 5.51 C |
| AK (mg·kg−1) | 329.3 ± 37.54 a | 418.0 ± 93.72 a | 366.6 ± 16.65 a | 154.0 ± 109.48 A | 156.6 ± 38.69 A | 104.6 ± 12.70 A |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Wang, X.; Chen, H.; Zeng, J.; Chen, J.; Ma, Y.; Shao, Q.; Liu, L. Depth-Dependent Responses of Microbial Community Structure and Function to Reductive Soil Disinfestation. Horticulturae 2026, 12, 35. https://doi.org/10.3390/horticulturae12010035
Wang X, Chen H, Zeng J, Chen J, Ma Y, Shao Q, Liu L. Depth-Dependent Responses of Microbial Community Structure and Function to Reductive Soil Disinfestation. Horticulturae. 2026; 12(1):35. https://doi.org/10.3390/horticulturae12010035
Chicago/Turabian StyleWang, Xinyu, Hanlin Chen, Juntao Zeng, Jintao Chen, Yanru Ma, Qin Shao, and Liangliang Liu. 2026. "Depth-Dependent Responses of Microbial Community Structure and Function to Reductive Soil Disinfestation" Horticulturae 12, no. 1: 35. https://doi.org/10.3390/horticulturae12010035
APA StyleWang, X., Chen, H., Zeng, J., Chen, J., Ma, Y., Shao, Q., & Liu, L. (2026). Depth-Dependent Responses of Microbial Community Structure and Function to Reductive Soil Disinfestation. Horticulturae, 12(1), 35. https://doi.org/10.3390/horticulturae12010035

