Abstract
Postharvest fungal infections, particularly by Botrytis cinerea, can cause up to 50% losses in fruits and vegetables, and the overuse of synthetic fungicides has led to resistant pathogen strains. We hypothesized that hexane (Hex) and methanolic (MeOH) extracts from peanut (P) and pecan nut (PN) shells possess antifungal properties effective against B. cinerea in strawberries. To test this, we conducted both in vitro and ex vivo assays using strawberries inoculated with B. cinerea, comparing two controls (T0: water; T1: commercial synthetic fungicide) with four treatments—Hex-P, MeOH-P, Hex-PN, and MeOH-PN—at 1000 and 2000 ppm (in vitro) and 4000 ppm (ex vivo). Total phenolic content (TPC) and antioxidant activity (AA) were also measured. MeOH-P and Hex-PN extracts at 2000 ppm significantly inhibited fungal mycelial growth in vitro. In ex vivo assays, MeOH-P reduced both disease incidence and severity comparably to the synthetic fungicide. MeOH-PN exhibited the highest TPC and AA. These findings support the potential use of MeOH-P extract as a natural alternative to synthetic fungicides for controlling B. cinerea in strawberries during postharvest storage.
1. Introduction
During transportation, commercialization, and storage, fruits are susceptible to infections that can result in significant economic losses, including the deterioration of quality, nutrient reduction, and decreased market value. These losses account for approximately 40% of fresh produce, representing around 1.3 billion tons of global production. Fungal microorganisms are responsible for approximately 85% of post-harvest fruit diseases [1,2]. During the storage period, fungi can sporulate, and their conidia may contaminate the surfaces of storage bins, where they can survive for extended periods and serve as a source of contamination for healthy fruit [3]. Notably, Romanazzi et al. [4] ranked Botrytis cinerea (the causal agent of gray mold) as the second most economically and scientifically significant fungal pathogen. This pathogen affects over 200 plant species, including strawberry crops (Fragaria × ananassa), likely due to its ability to secrete nonspecific phytotoxins that kill a broad range of cells [5]. In this context, the sesquiterpene botrydial, which induces chlorosis and cell collapse, plays a key role in facilitating pathogen penetration and colonization.
Synthetic fungicides are the most commonly used method for controlling such pathogens. However, their repeated application has led to the development of resistant biotypes and has raised concerns about their negative effects on the environment and human health. Recently, the use of plant extracts for post-harvest disease control has gained increasing interest as an alternative to commercial synthetic fungicides. The active compounds (secondary metabolites) in plant extracts offer various health benefits for both humans and fruit. These compounds possess strong antioxidant and antimicrobial properties and can inhibit enzymes involved in oxidation, thereby extending the shelf life of fruit (e.g., polyphenol oxidase and peroxidase) [6]. Furthermore, several studies have demonstrated that the antioxidant properties of certain plant-derived products can protect human health from oxidative stress caused by excessive free radicals and enhance the nutritional quality of food [7,8]. This protective effect may also extend to preventing pathogen attacks by suppressing or delaying potential infections.
Fruit shells, often considered waste, contain high concentrations of bioactive chemicals that can offer valuable properties. The challenge of reusing and recycling waste to create value-added products aligns with the principles of a circular bioeconomy [9].
Pecan nut shells (Carya illinoinensis), which make up about 50% of the total weight of the fruit, represent a significant waste product from pecan nut processing [10]. These shells are rich in carbon, lignocellulosic compounds (cellulose, hemicellulose, lignin), and phenolic compounds such as gallic acid, vanillic acid, ellagic acid, chlorogenic acid, 4-hydroxybenzoic acid, caffeic acid-3-glucoside, 3-p-coumaroylquinic acid, catechin, epigallocatechin, epicatechin gallate, phlorizin glucoside, and hydrolysable tannins [10,11,12,13,14,15]. Various studies have demonstrated the bioactivity of methanolic, hydroalcoholic, and aqueous extracts from pecan nut residues, which exhibit allelopathic [16] and antiproliferative properties [12], potential as solid biofuel [11], and bio-absorbent capacity for removing dyes (acid blue 25) and heavy metals (Cu, Pb, and Zn) from water [17,18,19]. Additionally, their antioxidant and food-stabilizing properties have been demonstrated [12,20,21,22,23]. In recent years, pecan nut shells have been used to synthesize green nanoparticles, which exhibit excellent antibacterial and antioxidant activities [24,25]. Furthermore, pecan nut shells have shown nematicide activity against agronomically important nematodes like Meloidogyne incognita [26,27] and can induce resistance against the oomycete Phytophthora capsici, the cause of root, stem, and fruit rot, as well as leaf blight [28]. Additionally, antibacterial activity against Staphylococcus aureus, Escherichia coli, Listeria monocytogenes, Salmonella enteritidis, Aeromonas hydrophila, Pseudomonas aeruginosa, Enterococcus faecalis, and Vibrio parahaemolyticus has been documented [12,22,29,30,31,32,33]. Finally, antifungal activity against agronomically relevant fungi such as Rhizoctonia solani, Pythium sp., Colletotrichum truncatum, C. coccodes, Alternaria alternata, Fusarium verticillioides, F. solani, F. sambucinum, and F. oxysporum has also been reported [34,35].
Peanut shells (Arachis hypogaea) are a byproduct of peanut production, mainly for seed and oil extraction. It is estimated that 0.74 million tons of peanut shells are produced annually, accounting for 25–30% of the total weight of the fruit at the final processing stage [36]. This makes peanut shells a valuable waste product with potent properties. Peanut shells are rich in cellulose, hemicellulose, sucrose, lignin, pectin, luteolin, lupeol, palmitic acid, 5,7-dihydroxychromone, 3′,4′,7-trihydroxyflavanone, octadecane, procyanidin, carotenes, flavonoids, and polyphenols (such as gallic acid, epicatechin, quercetin, and taxifolin), as well as essential and non-essential amino acids (L-Isoleucine, L-Valine, L-Leucine, L-Arginine, L-aspartic acid, proline, and β-alanine), sugars, fats, and other compounds [9,36,37,38,39,40]. Several studies have reported the bioactive potential of peanut shells for various applications, including their use as bio-composites in biodegradation processes for plastics [41], as catalysts for the production of syngas, biogas, bioethanol, and biodiesel [9,42,43], and for their ability to adsorb heavy metals such as Cu, Pb, Cr, Cd, Co, Ni, and Sr [44,45,46]. Furthermore, their antioxidant capacity has been confirmed by various studies [39,40,47,48]. Antibacterial activity against S. aureus, Klebsiella pneumoniae, L. monocytogenes, E. coli, S. enterica, S. typhimurium, and Shigella flexneri has also been demonstrated [30,48,49,50,51]. Regarding antifungal properties, peanut shells exhibited significant activity against humans (Candida albicans, Aspergillus fumigatus) and agricultural pathogens (Phytophthora infestans, P. capsici, Sclerotium rolfsii, Aspergillus versicolor, A. niger, Penicillium funiculosum) [49,50,52,53].
Agricultural waste is a rich source of bioactive compounds with diverse applications. While the potential uses of pecan and peanut shells in biodiesel production and their antioxidant and antibacterial properties have been widely explored, few studies have investigated their antifungal capacity. Specifically, no research has assessed the antifungal activity of pecan and peanut shells against Botrytis cinerea, a major pathogen that affects a variety of crops. Therefore, this study aims to evaluate the antifungal properties of hexane and methanolic extracts from the shells of peanut (A. hypogaea) and pecan nut (C. illinoinensis) against B. cinerea in post-harvest strawberries.
2. Materials and Methods
2.1. Preparation of the Extracts
Peanut and pecan nut shells were sourced from local producers in Esperanza, Santa Fe, Argentina, after fruit harvest. The shells were dried in a controlled environment with low humidity. To prepare the extracts, 100 g of peanut and pecan nut shells were ground and successively macerated with hexane (Hex) and methanol (MeOH) under mechanical stirring for 24 h each (3 cycles), ensuring the extraction of a wide range of compounds. The macerated material was separated by vacuum filtration, and the final extracts were concentrated using a rotary evaporator. The yield of each extract was calculated as a percentage (g of extract obtained from 100 g of dry material processed).
2.2. Fungal Strain Isolation and Characterization
A strain of Botrytis cinerea was isolated from strawberry fruits with the characteristic symptoms of gray mold disease. The strain was first identified based on morphological characteristics, following the methodology described by Di Liberto et al. [54], and deposited at the Mycology Reference Centre (CEREMIC, Rosario, Argentina) under the code CCC-100. Then, the identity of the isolate was molecularly confirmed by PCR amplification of a segment of the ITS (Internal Transcribed Spacer) region of ribosomal nuclear DNA (rDNA) [55]. This region is widely recognized as the universal DNA barcode for fungi due to its high interspecific variability and broad coverage across fungal taxa [56]. For that, fungal genomic DNA was extracted from 7-day-old cultures grown on PDA at 20–25 °C and was used as the template for PCR amplification of a segment of the ITS region of ribosomal nuclear DNA (rDNA) using the primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) [55]. PCR reactions were performed on a Techne TC-312 thermal cycler (Techne, Cambridge, UK) in 20 µL reaction mixtures containing 1xPCR buffer, 2.5 mM MgCl2, 0.4 µM each primer, 0.2 mM dNTPs, 1 U of Taq DNA polymerase (PB-L, Productos Bio-Lógicos®, Rosario, Argentina), and 100 ng of genomic DNA. Amplifications were programmed to carry out an initial denaturation at 94 °C for 5 min, followed by 36 cycles, each consisting of a denaturation step at 94 °C for 30 s, an annealing step, and an extension step at 57 °C for 30 s and at 72 °C for 30 s. The final extension was carried out at 72 °C for 7 min. PCR products were visualized under ultraviolet light on a 1.5% (w/v) agarose gel in 1x TAE buffer stained with GelRed (Biotium Inc., Fremont, CA, USA). A UST-30 M-8E, Biostep transilluminator (Biostep, Jahnsdorf, Germany) was used. The PCR products were purified and sequenced at Macrogen (Seoul, Republic of Korea). Fungal identification was performed by comparing the obtained sequence with all fungal sequences available in the GenBank Nucleotide Database (National Center for Biotechnology Information, NCBI; https://www.ncbi.nlm.nih.gov/), accessed on 15 December 2024, using the BLASTn (Basic Local Alignment Search Tool) algorithm. The sequences generated in this study were submitted to GenBank.
Before the in vitro and ex vivo assays were developed, the strain was grown on Potato Dextrose Agar (PDA) plates and incubated for 7–9 days at 20 °C. The inoculum for the spore suspension was prepared according to CLSI-reported procedures and adjusted to a concentration of 10⁵ CFU/mL [57].
2.3. Total Phenolic Compounds (TPC) and Antioxidant Activity (AA) of Extracts
The pecan nut and peanut shells were ground into powders and subjected to extraction in absolute methanol (1:10 w/v) for 24 h at room temperature in the dark. Twelve independent extractions were performed for each type of shell (peanut and pecan nut) to ensure sufficient replicates for statistical analysis and reproducibility. The samples were centrifuged at 4000 rpm for 15 min, and the supernatants were filtered. Total phenolic content (TPC) was measured according to Singleton et al. [58]. In this method, phenolic compounds reduce the Folin–Ciocalteu reagent (phosphotungstic and phosphomolybdic acid), forming a blue complex that absorbs at 765 nm. To determine TPC, 250 µL of the extract was mixed with 1250 µL of distilled water, followed by the addition of 100 µL of Folin–Ciocalteu reagent. The mixture was allowed to rest for 2 min at room temperature, and 80 µL of 7.5% Na2CO3 was added. The mixture was then heated at 50 °C for 5 min, and absorbance was measured at 765 nm. TPC was expressed as mg of gallic acid equivalent per gram of sample (mg GAE/g).
Antioxidant activity (AA) was assessed using the ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonate)) radical cation method [59]. ABTS undergoes discoloration when reduced by an antioxidant molecule, and the degree of discoloration correlates with the antioxidant capacity of the sample. For the assay, 0.015 mg of the extract was dissolved in 2 mL of methanol. Subsequently, 250 µL of the solution was mixed with 250 µL of ABTS solution, and absorbance was read at 734 nm. AA was expressed as the percentage of ABTS radical decolorization.
2.4. In Vitro Antifungal Assays of Pecan Nut and Peanut Shell Extracts Against B. cinerea
Antifungal activity was assessed using a diffusion test in 6 cm diameter sterile Petri dishes. Stock solutions of peanut and pecan nut shell extracts were prepared in DMSO at two concentrations (1000 and 2000 ppm) and then diluted in PDA media. The media with the extract incorporated was poured into the Petri dishes and cooled down. A conidia solution of B. cinerea was prepared to a concentration of 10⁵ CFU/mL and inoculated into the center of the dishes. The plates were stored at 20 °C. Treatments included: (T0) positive control with DMSO (to assure the completely growth of the fungi); (T1) negative control with synthetic fungicide carbendazim (CZ) at 100 ppm (to assure the no growth of the fungi); (Hex-P) hexane extract of peanut shells; (MeOH-P) methanolic extract of peanut shells; (Hex-PN) hexane extract of pecan nut shells; and (MeOH-PN) methanolic extract of pecan nut shells. Each treatment was tested in triplicate. After the mycelium completely covered the surface of the positive control plates, the diameter of the mycelial growth in each treated plate was measured, and the percentage of mycelial growth inhibition (MGI%) was calculated using the following Formula (1) [60]:
where C is the average area of the positive control and M is the average area of the treated plate [55,61].
MGI (%) = (C − M)/C × 100
2.5. Ex Vivo Antifungal Assays of Pecan Nut and Peanut Shell Extracts Against B. cinerea on Strawberry Fruits
Strawberries (Fragaria × ananassa cv. ‘San Andreas’) at the commercial mature stage (2/3 of the surface red) were provided by a local producer in Coronda City, Santa Fe, Argentina. The assay was conducted following the methodology described by Di Liberto et al. [62]. The fruits were disinfected with 1% sodium hypochlorite for 1 min and then rinsed with demineralized water. Afterward, the fruits were artificially inoculated with a conidia suspension of B. cinerea (10⁵ CFU/mL) at two equatorial wounds. Six treatment groups were established with 10 strawberries per group: (T0) positive control with sterile water; (T1) negative control with synthetic fungicide CZ at 100 ppm; (Hex-P) 4000 ppm aqueous solution of peanut shells hexane extract; (MeOH-P) 4000 ppm aqueous solution of peanut shells methanolic extract; (Hex-PN) 4000 ppm aqueous solution of pecan nut shells hexane extract; and (MeOH-PN) 4000 ppm aqueous solution of pecan nut shells methanolic extract. The fruits were immersed in the respective solutions for 5 s at 3 and 24 h post-inoculation. The concentration of 4000 ppm was chosen based on the results from in vitro assays. The treated fruits were stored in individual trays at 20 °C and 85% relative humidity (RH) for 6 days.
Disease incidence (DI) was calculated using the following Formula (2) [63]:
DI (%) = (number of infected fruit)/(total number of fruit) × 100
Additionally, disease severity (DS) was assessed visually based on an empirical scale from Romanazzi et al. [64], with the following grades: (0) healthy fruit; (1) 1–20% of fruit surface infected; (2) 21–40% infected; (3) 41–60% infected; (4) 61–80% infected; (5) ≥81% infected with sporulation. The evaluator was trained before the assessments to ensure consistency and reduce subjectivity. The severity (McKinney index) was calculated using formula 3 from Singh et al. [65]:
DS (%) = [(∑ (severity rating × number of fruit with that rating))/(total number of fruits assessed × highest scale)] × 100
2.6. Statistical Analysis
Data from in vitro and ex vivo assays were subjected to a one-way analysis of variance (ANOVA), and the treatment means were compared to the positive control (T0) using Dunnett’s test. In the particular case of incidence and severity, percentages were converted to proportion values and subjected to the arcsine-square root transformation before statistical analysis [66].
3. Results
3.1. Fungal Strain Obtaining
A fungal isolate obtained from symptomatic strawberries was morphologically identified by CEREMIC as B. cinerea (CCC-100). Figure 1 shows the typical symptoms and signs caused by the fungus on strawberries, along with the morphological characteristics of the colonies developed after isolation, and the microscopic features of the conidia. Typical white to gray sporulation was observed above the rots and in the culture plates. To confirm the morphological identification, DNA was extracted from the CCC-100 isolate, and the ITS region was amplified and sequenced. BLASTn analysis revealed 100% identity with previously characterized B. cinerea strains (KT723005, MH329278, MZ148644, KT723007). The nucleotide sequence was deposited in GenBank under the accession number PV455610.
Figure 1.
Typical symptoms caused by B. cinerea on strawberry (A,B), morphological characteristics of the colonies (C), and microscopic features of the conidia (D,E).
3.2. Extract Yield, Total Phenolic Compounds (TPC), and Antioxidant Activity (AA)
The highest yield was observed on methanolic pecan nut shell extract (MeOH-PN), with a yield of 24.35% (Table 1). Regarding TPC and AA, both methanolic extracts showed significant values; however, the pecan nut shell extract (MeOH-PN) displayed considerably higher TPC and AA values compared to the peanut shell extract (MeOH-P) (Table 1).
Table 1.
Plant material yield (g of crude extracts obtained from 100 g of dry material) and average and standard deviation of total phenolic compounds (TPC) and antioxidant activity (AA) of peanut and pecan nut shell extracts.
3.3. In Vitro Antifungal Assays of Peanut and Pecan Nut Shell Extracts Against B. cinerea
The in vitro antifungal activities of the shell extracts are summarized in Table 2. At a concentration of 1000 ppm, none of the extracts, except for Hex-PN, showed significant mycelial growth inhibition (MGI) against B. cinerea (MGI of 66.7%). At a concentration of 2000 ppm, the MeOH-P completely inhibited the mycelial growth of B. cinerea, similar to the synthetic fungicide control (T1), while Hex-PN achieved an MGI of 93.4%. Both treatments showed significant differences regarding T0. MeOH-PN displayed moderate antifungal activity, but it was not significant regarding T0 (Table 2).
Table 2.
In vitro mycelial growth inhibition (MGI%) of peanut (P) and pecan nut (PN) shell extracts against B. cinerea. Different letters indicate significant differences between treatments compared to the control T0 (Dunnett’s test, p < 0.05).
3.4. Ex Vivo Antifungal Assays of Peanut and Pecan Nut Shell Extracts Against B. cinerea on Strawberry Fruits
In all treatments, the first symptoms caused by B. cinerea were observed starting from the second day of inoculation (Figure 2). Concerning disease incidence and severity, peanut shell treatments showed the best performance. MeOH-P showed a significant reduction in disease incidence (42%), similar to the synthetic fungicide T1 (50% reduction). Hex-P (peanut shell hexane extract) followed with a 37.5% reduction (Figure 3). In terms of disease severity, both T1 and MeOH-P displayed the most significant reductions, with values of 76.2% and 63.2%, respectively (Figure 3).
Figure 2.
Degrees of infection by B. cinerea in the ex vivo assay according to the empirical scale of Romanazzi et al. [64]: (A) degree 0, healthy fruit; (B) degree 1, 1–20% infected; (C) degree 2, 21–40% infected; (D) degree 3, 41–60% infected; (E) degree 4, 61–80% infected; and (F) degree 5, ≥81% infected.
Figure 3.
Percentages of disease incidence (DI, black) and severity (DS, gray) caused by B. cinerea on strawberries in the ex vivo assay. Treatments: (T0) control with distilled water; (T1) control with commercial fungicide; (Hex-P) aqueous solution of peanut shells hexane extract; (MeOH-P) aqueous solution of peanut shells methanolic extract; (Hex-PN) aqueous solution of pecan nut shells hexane extract; and (MeOH-PN) aqueous solution of pecan nut shells methanolic extract. Different letters indicate significant differences between treatments compared to the control T0 (Dunnett’s Test, p < 0.05).
In contrast to the in vitro results, treatments with pecan nut shell extracts did not show significant antifungal activity in the ex vivo assay, demonstrating less efficacy compared to the peanut shell extracts.
From these results, we can highlight the following.
- Peanut shell extracts, particularly MeOH-P, exhibited superior antifungal activity in reducing mycelial growth in vitro, disease incidence, and disease severity in strawberries infected by B. cinerea, showing similar effectiveness to the synthetic fungicide (T1);
- The pecan nut shell extracts performed less effectively in the ex vivo assays, with lower reductions in both disease incidence and severity compared to peanut shell treatments;
- MeOH-P was the most effective treatment for controlling B. cinerea in strawberries, achieving substantial reductions in disease development, while Hex-P also showed moderate effectiveness.
This section provided a comparison between the antifungal effectiveness of the different shell extracts in controlling B. cinerea in a real fruit model, with peanut shell extracts emerging as more potent candidates for ex vivo applications.
4. Discussion
The demand for safe and high-quality fresh fruit has been increasing in recent years, as fruits are highly perishable foods that are susceptible to fungal pathogens due to their high-water content. Fungal infections are responsible for approximately 85% of post-harvest diseases in fruits, leading to a significant decline in fruit quality, sugar content, antioxidant activity, and firmness, while often releasing unpleasant odors that can spread throughout the environment [1,67]. The global economic losses due to these infections are considerable. While synthetic fungicides are commonly used to protect crops, their repeated application has led to the development of fungal resistance and posed risks to human health. As a result, there is a clear need to identify new alternatives to synthetic fungicides. Plant extracts with antifungal properties have garnered increasing attention as viable solutions. Peanut and pecan nut shells are readily available byproducts in the region with potential as natural products for disease control. This study evaluated the antifungal activity of pecan nut and peanut shell extracts against B. cinerea under both in vitro and ex vivo conditions.
Although studies on the antifungal properties of pecan and peanut shells are limited, our findings show that peanut shell extracts, particularly the methanolic extract (MeOH-P), exhibited superior performance compared to pecan nut shell extracts. Specifically, MeOH-P inhibited 100% of the mycelial growth of B. cinerea in vitro and showed significant reductions in disease incidence and severity in the ex vivo assay, with results comparable to those of commercial fungicide treatment. This is consistent with previous studies where peanut-derived compounds exhibited antifungal activity. For instance, Staroń et al. [68] observed that modified peanut shells with silver ions had biocidal properties against Aspergillus niger, and peanut skin extracted with acidified ethanol inhibited the growth of Fusarium oxysporum [69]. Additionally, A. hypogaea root proteins and stilbene resveratrol, a compound found in peanuts, have been shown to inhibit B. cinerea growth in vitro [70,71]. Other peanut-derived compounds, including proteins and stilbenes, also demonstrated antifungal activity against agricultural fungi like Phomopsis obscurans and F. oxysporum [72,73], as well as the clinical pathogen Candida albicans [74]. However, to the best of our knowledge, this study is the first report about the antifungal activity of hexane and methanolic extracts from peanut shells.
Moreover, pecan nut shell extracts also demonstrated strong antifungal activity in vitro. The hexane extract (Hex-PN) inhibited B. cinerea mycelial growth by 66.7% at 1000 ppm and 93.4% at 2000 ppm. Despite this, pecan shell extracts did not perform as well in the ex vivo assay. The relatively low efficacy of Hex-PN in the ex vivo assay may be attributed to the physicochemical properties of hexane extracts, particularly their high lipid content and poor solubility in aqueous environments. Hexane is a non-polar solvent that extracts primarily lipophilic compounds, which tend to have low solubility and dispersion in water-based solutions. In our study, the addition of Hex-PN to the aqueous medium resulted in visible separation and minimal mixing, indicating poor solubility. This likely hindered uniform coverage and absorption of the active compounds by the fruit surface. Similar limitations have been reported by different studies on bioformulations for clinical and agricultural applications [75,76,77], where phase separation impacted extract bioavailability and performance in biological assays. These observations suggest that the reduced antifungal activity of Hex-PN is due, at least in part, to solubility and absorption constraints. Further studies involving emulsifiers or formulation strategies could help improve the dispersion and efficacy of non-polar extracts in ex vivo applications. Although methanolic extracts from pecan shells (MeOH-PN) exhibited in vitro antifungal activity and demonstrated to reduce the disease incidence and severity in the ex vivo assay, these results were lower than those observed with peanut shell extracts. Previous research has shown that pecan nut shell polyphenolic extracts inhibited the growth of various fungi, including Pythium sp., Colletotrichum coccodes, and Fusarium species [35,78]. However, there are no studies evaluating the antifungal activity of pecan nut shell extracts specifically against B. cinerea.
The antifungal activity of these extracts may be attributed to the complex mixture of major and minor compounds in the shells and their interactions [79]. Although Hex-PN exhibited good antifungal activity in vitro, the best results were observed with the MeOH-P extract in both in vitro and ex vivo assays. According to the literature, the greater antifungal activity of methanolic extracts is due to their higher content of phenolic compounds, which are often responsible for antifungal activity [20,80,81,82]. Several studies have confirmed that high total phenolic compounds (TPC) are correlated with enhanced antioxidant activity [20,21,23,47]. This aligns with our findings, as both pecan and peanut shell extracts exhibited a high TPC and strong antioxidant activity, which could explain their observed antifungal efficacy. Antioxidants help retard oxidative degradation of lipids, thereby improving food quality and contributing to the antifungal activity observed, particularly in the ex vivo assay. Indeed, phenolic-rich plant extracts have been shown to possess strong antifungal properties against various human and agricultural pathogens [81,83,84].
Interestingly, while the pecan nut shell extracts contained a higher TPC than peanut shell extracts, the lower antifungal activity of the former may be attributed to the difficulty in dissolving these extracts in an aqueous solution for treatment applications. The high content of insoluble-bound phenolics, such as hydrolysable tannins and proanthocyanins, may require additional treatments (e.g., acid hydrolysis, enzymatic, or high-temperature extraction) to release these bound phenolics into the solution matrix [85,86,87].
Finally, food safety concerns, particularly regarding the cytotoxicity of these plant extracts, are crucial for their potential use in agricultural applications. Research has shown that both peanut and pecan nut shell extracts did not cause significant toxicological effects in animal models [88,89]. However, further studies are needed to confirm their safety in food applications and determine the optimal doses for controlling B. cinerea infection in strawberries. The chemical composition of peanut and pecan nut shell extracts can be influenced by several factors, including the source of the shells, postharvest processing, and storage conditions. Variations in cultivar, geographic origin, and growing conditions (e.g., soil, climate, and agricultural practices) can lead to differences in the accumulation of phenolic compounds and other bioactive metabolites. Additionally, processing methods such as drying temperature and duration may affect the stability and retention of heat-sensitive compounds. Prolonged storage or exposure to humidity and light can also promote oxidative degradation of antioxidants and phenolics, thereby altering extract potency. These variables may contribute to the observed differences in antifungal and antioxidant activity among the extracts. Future studies should consider standardizing and documenting shell sourcing and handling conditions to better control for these factors and ensure reproducibility. Overall, these findings suggest that peanut and pecan nut shell extracts, particularly MeOH-P, hold promise as natural fungicides for reducing B. cinerea infection in strawberries, with the added benefit of utilizing agricultural waste to support a circular economy.
5. Conclusions
This study demonstrated that the methanolic extract of peanut shell (MeOH-P) and the hexane extract of pecan nut shell (Hex-PN) exhibited strong antifungal activity against B. cinerea in vitro, inhibiting mycelial growth by 100% and 93.4%, respectively, at a concentration of 2000 ppm. In ex vivo assays, only MeOH-P significantly reduced disease incidence and severity on strawberries, showing results comparable to the synthetic fungicide carbendazim. Both extracts also displayed high total phenolic content and antioxidant activity, which may contribute to their antifungal effects. These findings suggest that MeOH-P, in particular, has potential as a natural alternative to synthetic fungicides for postharvest control of B. cinerea in strawberries. Further studies are needed to evaluate its efficacy under commercial conditions, confirm activity against other pathogens, and assess safety and optimal application parameters.
Author Contributions
Conceptualization, M.G.D.; methodology, G.M.S., M.A.F., L.N.F., V.E.R. and M.G.D.; software, G.M.S. and L.N.F.; validation, M.A.F. and M.G.D.; formal analysis, G.M.S., M.A.F., L.N.F. and M.G.D.; investigation, G.M.S., M.A.F. and M.G.D.; resources, M.A.F. and M.G.D.; data curation, V.E.R., M.A.F. and M.G.D.; writing—original draft preparation, G.M.S. and M.G.D.; writing—review and editing, G.M.S., M.A.F. and M.G.D.; visualization, M.G.D.; supervision, M.G.D.; project administration, M.G.D.; funding acquisition, M.G.D. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT), grant numbers PICT-2020-SERIEA-02504, PICT-2021-CAT-II-00097; Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) under grant code PIP 11220210100388CO; and Universidad Nacional de Rosario (UNR) under project 80020190400002UR.
Data Availability Statement
The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.
Acknowledgments
To CONICET for G.M.S. and L.N.F. scholarships and funding.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Matrose, N.A.; Obikeze, K.; Belay, Z.A.; Caleb, O.J. Plant extracts and other natural compounds as alternatives for post-harvest management of fruit fungal pathogens: A review. Food Biosci. 2021, 41, 100840. [Google Scholar] [CrossRef] [Scilit]
- Savary, S.; Ficke, A.; Aubertot, J.N.; Hollier, C. Crop losses due to diseases and their implications for global food production losses and food security. Food Secur. 2012, 4, 519–537. [Google Scholar] [CrossRef] [Scilit]
- Bernat, M.; Casals, C.; Teixidó, N.; Torres, R.; Carballo, B.C.; Usall, J. Efficacy of environmentally friendly disinfectants against the major postharvest pathogens of stone fruits on plastic and wood surfaces. Food Sci. Technol. Int. 2019, 25, 109–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Romanazzi, G.; Smilanick, J.L.; Feliziani, E.; Droby, S. Integrated management of postharvest gray mold on fruit crops. Postharvest Biol. Technol. 2016, 113, 69–76. [Google Scholar] [CrossRef] [Scilit]
- Choquer, M.; Fournier, E.; Kunz, C.; Levis, C.; Pradier, J.M.; Simon, A.; Viaud, M. Botrytis cinerea virulence factors: New insights into a necrotrophic and polyphageous pathogen. FEMS Microbiol. Lett. 2007, 277, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Bajaj, K.; Adhikary, T.; Gill, P.P.; Kumar, A. Edible coatings enriched with plant-based extracts preserve postharvest quality of fruits: A review. Prog. Org. Coat. 2023, 182, 107669. [Google Scholar] [CrossRef] [Scilit]
- Roidaki, A.; Kollia, E.; Panagopoulou, E.; Chiou, A.; Varzakas, T.; Markaki, P. Super foods and super herbs: Antioxidant and antifungal activity. Curr. Res. Nutr. Food Sci. J. 2016, 4, 138–145. [Google Scholar] [CrossRef] [Scilit]
- Wojdyło, A.; Oszmiański, J.; Czemerys, R. Antioxidant activity and phenolic compounds in 32 selected herbs. Food Chem. 2007, 105, 940–949. [Google Scholar] [CrossRef] [Scilit]
- Ajayi, V.A.; Lateef, A. Biotechnological valorization of agrowastes for circular bioeconomy: Melon seed shell, groundnut shell and groundnut peel. Clean. Circ. Bioecon. 2023, 4, 100039. [Google Scholar] [CrossRef] [Scilit]
- de Prá Andrade, M.; Piazza, D.; Poletto, M. Pecan nutshell: Morphological, chemical and thermal characterization. J. Mater. Res. Technol. 2021, 13, 2229–2238. [Google Scholar] [CrossRef] [Scilit]
- Ngangyo Heya, M.; Romo Hernández, A.L.; Foroughbakhch Pournavab, R.; Ibarra Pintor, L.F.; Díaz-Jiménez, L.; Heya, M.S.; Salas Cruz, L.R.; Carrillo Parra, A. Physicochemical characteristics of biofuel briquettes made from pecan (Carya illinoensis) pericarp wastes of different particle sizes. Molecules 2022, 27, 1035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flores-Estrada, R.A.; Gámez-Meza, N.; Medina-Juárez, L.A.; Castillón-Campaña, L.G.; Molina-Domínguez, C.C.; Rascón-Valenzuela, L.A.; García-Galaz, A. Chemical composition, antioxidant, antimicrobial and antiproliferative activities of wastes from pecan nut [Carya illinoinensis (Wagenh) K. Koch]. Waste Biomass Valori. 2020, 11, 3419–3432. [Google Scholar] [CrossRef] [Scilit]
- Kureck, I.; Policarpi, P.D.; Toaldo, I.M.; Maciel, M.V.; Bordignon-Luiz, M.T.; Barreto, P.L.; Block, J.M. Chemical characterization and release of polyphenols from pecan nut shell [Carya illinoinensis (Wangenh) C. Koch] in zein microparticles for bioactive applications. Plant Foods Hum. Nutr. 2018, 73, 137–145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ozcariz-Fermoselle, M.V.; Fraile-Fabero, R.; Girbés-Juan, T.; Arce-Cervantes, O.; de Rueda-Salgueiro, J.A.; Azul, A.M. Use of lignocellulosic wastes of pecan (Carya illinoinensis) in the cultivation of Ganoderma lucidum. Revista Iberoam. Micol. 2018, 35, 103–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De La Rosa, L.A.; Alvarez-Parrilla, E.; Shahidi, F. Phenolic compounds and antioxidant activity of kernels and shells of Mexican pecan (Carya illinoinensis). J. Agric. Food Chem. 2011, 59, 152–162. [Google Scholar] [CrossRef] [Scilit]
- Stafne, E.T.; Rohla, C.T.; Carroll, B.L. Pecan shell mulch impact on ‘Loring’peach tree establishment and first harvest. Horttechnology 2009, 19, 775–780. [Google Scholar] [CrossRef] [Scilit]
- Morgan, C.; Poor, C.; Giudice, B.; Bibb, J. Agricultural byproducts as amendments in bioretention soils for metal and nutrient removal. J. Environ. Eng. 2020, 146, 04020029. [Google Scholar] [CrossRef] [Scilit]
- Aguayo-Villarreal, I.A.; Ramírez-Montoya, L.A.; Hernández-Montoya, V.; Bonilla-Petriciolet, A.; Montes-Morán, M.A.; Ramírez-López, E.M. Sorption mechanism of anionic dyes on pecan nut shells (Carya illinoinensis) using batch and continuous systems. Ind. Crops Prod. 2013, 48, 89–97. [Google Scholar] [CrossRef] [Scilit]
- Hernández-Montoya, V.; Mendoza-Castillo, D.I.; Bonilla-Petriciolet, A.; Montes-Morán, M.A.; Pérez-Cruz, M.A. Role of the pericarp of Carya illinoinensis as biosorbent and as precursor of activated carbon for the removal of lead and acid blue 25 in aqueous solutions. J. Anal. Appl. Pyrolysis 2011, 92, 143–151. [Google Scholar] [CrossRef] [Scilit]
- Garcia-Larez, F.L.; Esquer, J.; Guzmán, H.; Zepeda-Quintana, D.S.; Moreno-Vásquez, M.J.; Rodríguez-Félix, F.; Del Toro-Sánchez, C.L.; López-Corona, B.E.; Tapia-Hernández, J.A. Effect of Ultrasound-Assisted Extraction (UAE) parameters on the recovery of polyphenols from pecan nutshell waste biomass and its antioxidant activity. Biomass Convers. Biorefin. 2024, 15, 10977–10995. [Google Scholar] [CrossRef] [Scilit]
- Dunford, N.T.; Gumus, Z.P.; Gur, C.S. Chemical composition and antioxidant properties of pecan shell water extracts. Antioxidants 2022, 11, 1127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arciello, A.; Panzella, L.; Dell’Olmo, E.; Abdalrazeq, M.; Moccia, F.; Gaglione, R.; Salazar, S.A.; Napolitano, A.; Mariniello, L.; Giosafatto, C.V. Development and characterization of antimicrobial and antioxidant whey protein-based films functionalized with pecan (Carya illinoinensis) nut shell extract. Food Packag. Shelf Life 2021, 29, 100710. [Google Scholar] [CrossRef] [Scilit]
- Moccia, F.; Agustin-Salazar, S.; Berg, A.L.; Setaro, B.; Micillo, R.; Pizzo, E.; Weber, F.; Gamez-Meza, N.; Schieber, A.; Cerruti, P.; et al. Pecan (Carya illinoinensis (Wagenh.) K. Koch) nut shell as an accessible polyphenol source for active packaging and food colorant stabilization. ACS Sustain. Chem. Eng. 2020, 8, 6700–6712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neira-Vielma, A.A.; Meléndez-Ortiz, H.I.; García-López, J.I.; Sanchez-Valdes, S.; Cruz-Hernández, M.A.; Rodríguez-González, J.G.; Ramírez-Barrón, S.N. Green synthesis of silver nanoparticles using pecan nut (Carya illinoinensis) shell extracts and evaluation of their antimicrobial activity. Antibiotics 2022, 11, 1150. [Google Scholar] [CrossRef] [Scilit]
- Sahar, J.D.; Hoorieh, D.; Farzaneh, N.; Malak, H. Characterization and the evaluation of antimicrobial activities of silver nanoparticles biosynthesized from Carya illinoinensis leaf extract. Heliyon 2020, 6, e03624. [Google Scholar]
- Cepeda-Siller, M.; García-Calvario, J.M.; Hernández-Juárez, A.; Ochoa-Fuentes, Y.M.; Garrido-Cruz, F.; Cerna-Chávez, E.; Dávila-Medina, M.D. Toxicity of Carya illinoinensis (Fágales: Junglandaceae) extracts against Meloidogyne incógnita (Tylenchida: Heteroderidae) in tomato. Ecosis. Recur. Agropec. 2018, 5, 143–148. [Google Scholar]
- Garrido, C.F.; Cepeda, S.M.; Hernández, C.F.; Ochoa, F.Y.; Cerna, C.E.; Morales, A.D. Efectividad biológica de extractos de Carya illinoensis, para el control de Meloidogyne incognita. Rev. Mex. Cienc. Agríc. 2014, 5, 1317–1323. [Google Scholar]
- Lujan, P.A.; Dura, S.; Guzman, I.; Steiner, R.; Sanogo, S. Comparison of proanthocyanidin and phenolic rich extracts derived from pecan shell and husk as elicitors of induced resistance against Phytophthora capsici on Chile pepper. Plant Health Prog. 2023, 24, 369–374. [Google Scholar] [CrossRef] [Scilit]
- Kharel, K.; Kraśniewska, K.; Gniewosz, M.; Prinyawiwatkul, W.; Fontenot, K.; Adhikari, A. Antimicrobial screening of pecan shell extract and efficacy of pecan shell extract-pullulan coating against Listeria monocytogenes, Salmonella enterica, and Staphylococcus aureus on blueberries. Heliyon 2024, 10, e29610. [Google Scholar] [CrossRef] [Scilit]
- Yemmireddy, V.K.; Cason, C.; Moreira, J.; Adhikari, A. Effect of pecan variety and the method of extraction on the antimicrobial activity of pecan shell extracts against different foodborne pathogens and their efficacy on food matrices. Food Cont. 2020, 112, 107098. [Google Scholar] [CrossRef] [Scilit]
- Caxambu, S.; Biondo, E.; Kolchinski, E.M.; Padilha, R.L.; Brandelli, A.; Sant’Anna, V. Evaluation of the antimicrobial activity of pecan nut [Carya illinoinensis (Wangenh) C. Koch] shell aqueous extract on minimally processed lettuce leaves. Food Sci. Technol. 2016, 36, 42–45. [Google Scholar] [CrossRef] [Scilit]
- do Prado, A.C.; da Silva, H.S.; da Silveira, S.M.; Barreto, P.; Vieira, C.R.; Maraschin, M.; Salvador Ferreira, S.R.; Block, J.M. Effect of the extraction process on the phenolic compounds profile and the antioxidant and antimicrobial activity of extracts of pecan nut [Carya illinoinensis (Wangenh) C. Koch] shell. Ind. Crop. Prod. 2014, 52, 552–561. [Google Scholar] [CrossRef] [Scilit]
- Babu, D.; Crandall, P.G.; Johnson, C.L.; O’Bryan, C.A.; Ricke, S.C. Efficacy of antimicrobials extracted from organic pecan shell for inhibiting the growth of Listeria spp. J. Food Sci. 2013, 78, 1899–1903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernández-Castillo, F.D.; Castillo-Reyes, F.; Gallegos-Morales, G.; Rodríguez-Herrera, R.; Aguilar-González, C.N. Lippia graveolens and Carya illinoensis organic extracts and their in vitro effect against Rhizoctonia Solani Kuhn. Am. J. Agric. Biol. Sci. 2010, 5, 380–384. [Google Scholar] [CrossRef] [Scilit]
- Osorio, E.; Flores, M.; Hernández, D.; Ventura, J.; Rodríguez, R.; Aguilar, C.N. Biological efficiency of polyphenolic extracts from pecan nuts shell (Carya Illinoensis), pomegranate husk (Punica granatum) and creosote bush leaves (Larrea tridentata Cov.) against plant pathogenic fungi. Ind. Crops Prod. 2010, 31, 153–157. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.; Chen, J.; Du, F. Potential use of peanut by-products in food processing: A review. J. Food Sci. Technol. 2012, 49, 521–529. [Google Scholar] [CrossRef] [Scilit]
- Mohd Zaini, N.A.; Azizan, N.A.; Abd Rahim, M.H.; Jamaludin, A.A.; Raposo, A.; Raseetha, S.; Zandonadi, R.P.; BinMowyna, M.N.; Raheem, D.; Lho, L.H.; et al. A narrative action on the battle against hunger using mushroom, peanut, and soybean-based wastes. Front. Public Health 2023, 11, 1175509. [Google Scholar] [CrossRef] [Scilit]
- Gao, A.X.; Xiao, J.; Xia, T.C.; Dong, T.T.; Tsim, K.W. The extract of peanut shells enhances neurite outgrowth of neuronal cells: Recycling of agricultural waste for the development of nutraceutical products. J. Funct. Foods 2022, 91, 105023. [Google Scholar] [CrossRef] [Scilit]
- Meng, W.; Shi, J.; Zhang, X.; Lian, H.; Wang, Q.; Peng, Y. Effects of peanut shell and skin extracts on the antioxidant ability, physical and structure properties of starch-chitosan active packaging films. Int. J. Biol. Macromol. 2020, 152, 137–146. [Google Scholar] [CrossRef] [Scilit]
- Adhikari, B.; Dhungana, S.K.; Ali, M.W.; Adhikari, A.; Kim, I.D.; Shin, D.H. Antioxidant activities, polyphenol, flavonoid, and amino acid contents in peanut shell. J. Saudi Soc. Agric. Sci. 2019, 18, 437–442. [Google Scholar] [CrossRef] [Scilit]
- Oulidi, O.; Nakkabi, A.; Boukhlifi, F.; Fahim, M.; Lgaz, H.; Alrashdi, A.A.; Elmoualij, N. Peanut shell from agricultural wastes as a sustainable filler for polyamide biocomposites fabrication. J. King Saud Univ. Sci. 2022, 34, 102148. [Google Scholar] [CrossRef] [Scilit]
- Kim, M.; Jung, J.M.; Jung, S.; Kim, J.; Bhatnagar, A.; Tsang, Y.F.; Lin, K.A.; Kwon, E.E. Biochar as a catalyst in the production of syngas and biodiesel from peanut waste. Int. J. Ener. Res. 2022, 46, 19287–19299. [Google Scholar] [CrossRef] [Scilit]
- Kim, M.; Lee, D.J.; Jung, S.; Chang, S.X.; Lin, K.Y.; Bhatnagar, A.; Kwon, E.E.; Tsang, Y.F. Valorization of peanut wastes into a catalyst in the production of biodiesel. Int. J. Ener. Res. 2022, 46, 1299–1312. [Google Scholar] [CrossRef] [Scilit]
- Tsade, H.; Murthy, H.A.; Muniswamy, D. Bio-sorbents from agricultural wastes for eradication of heavy metals: A review. J. Mat. Environ. Sci. 2020, 11, 1719–1735. [Google Scholar]
- Shruthi, K.M.; Pavithra, M.P. A study on utilization of groundnut shell as biosorbent for heavy metals removal. Int. J. Eng. Technol. 2018, 4, 411–415. [Google Scholar]
- Oliveira, F.D.; Paula, J.H.; Freitas, O.M.; Figueiredo, S.A. Copper and lead removal by peanut hulls: Equilibrium and kinetic studies. Desalination 2009, 248, 931–940. [Google Scholar] [CrossRef] [Scilit]
- Salem, M.A.; Aborehab, N.M.; Al-Karmalawy, A.A.; Fernie, A.R.; Alseekh, S.; Ezzat, S.M. Potential valorization of edible nuts by-products: Exploring the immune-modulatory and antioxidants effects of selected nut shells extracts in relation to their metabolic profiles. Antioxidants 2022, 11, 462. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.; Hu, M.; He, L.; Fu, P.; Wang, L.; Zhou, J. Optimization of microwave-assisted enzymatic extraction of polyphenols from waste peanut shells and evaluation of its antioxidant and antibacterial activities in vitro. Food Bioprod. Proces. 2013, 91, 158–168. [Google Scholar] [CrossRef] [Scilit]
- Terea, H.; Selloum, D.; Rebiai, A.; Bouafia, A.; Ben Mya, O. Preparation and characterization of cellulose/ZnO nanoparticles extracted from peanut shells: Effects on antibacterial and antifungal activities. Biomass Convers. Biorefin. 2024, 14, 19489–19500. [Google Scholar] [CrossRef] [Scilit]
- Petropoulos, S.A.; Fernandes, Â.; Plexida, S.; Pereira, C.; Dias, M.I.; Calhelha, R.; Chrysargyris, A.; Tzortzakis, N.; Petrović, J.; Soković, M.D.; et al. The sustainable use of cotton, hazelnut and ground peanut waste in vegetable crop production. Sustainability 2020, 12, 8511. [Google Scholar] [CrossRef] [Scilit]
- Kyei, S.K.; Akaranta, O.; Darko, G. Synthesis, characterization and antimicrobial activity of peanut skin extract-azo-compounds. Sci. Afr. 2020, 8, e00406. [Google Scholar] [CrossRef] [Scilit]
- Velmurugan, P.; Sivakumar, S.; Young-Chae, S.; Seong-Ho, J.; Pyoung-In, Y.; Jeong-Min, S.; Sung-Chul, H. Synthesis and characterization comparison of peanut shell extract silver nanoparticles with commercial silver nanoparticles and their antifungal activity. J. Ind. Eng. Chem. 2015, 31, 51–54. [Google Scholar] [CrossRef] [Scilit]
- Rivilli, P.L.; Alarcón, R.; Isasmendi, G.L.; Pérez, J.D. Stepwise isothermal fast pyrolysis (SIFP). Part II. SIFP of peanut shells-Antifungal properties of phenolic fractions. BioResources 2012, 7, 0112–0117. [Google Scholar] [CrossRef] [Scilit]
- Di Liberto, M.G.; Stegmayer, M.I.; Svetaz, L.A.; Derita, M.G. Evaluation of Argentinean medicinal plants and isolation of their bioactive compounds as an alternative for the control of postharvest fruits phytopathogenic fungi. Rev. Bras. Farmacog. 2019, 29, 686–688. [Google Scholar] [CrossRef] [Scilit]
- Álvarez, N.H.; Stegmayer, M.I.; Seimandi, G.M.; Pensiero, J.F.; Zabala, J.M.; Favaro, M.A.; Derita, M.G. Natural products obtained from Argentinean native plants are fungicidal against citrus postharvest diseases. Horticulturae 2023, 9, 562. [Google Scholar] [CrossRef] [Scilit]
- Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Fungal Barcording Consortium. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef] [Scilit]
- Clinical and Laboratory Standards Institute (CLSI). Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi. CLSI Standard M38, 3rd ed.; Clinical and Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2017; pp. 1–35. [Google Scholar]
- Singleton, V.L.; Orthofer, R.; Lamuela-Raventos, R.M. Analysis of total phenols and other oxidation substrates and antioxidants by means of Folin Ciocalteu reagent. Method Enzymol. 1999, 299, 152–178. [Google Scholar]
- Miller, N.J.; Rice-Evans, C.; Davies, M.J.; Gopinathan, V.; Milner, A. A novel method for measuring antioxidant capacity and its application to monitoring the antioxidant status in premature neonates. Clin. Sci. 1993, 84, 407–412. [Google Scholar] [CrossRef] [Scilit]
- Magaldi, S.; Mata-Essayag, S.; De Capriles, C.H.; Pérez, C.; Colella, M.T.; Olaizola, C.; Ontiveros, Y. Well diffusion for antifungal susceptibility testing. Int. J. Infect. Dis. 2004, 8, 39–45. [Google Scholar] [CrossRef] [Scilit]
- Stegmayer, M.I.; Fernández, L.N.; Álvarez, N.H.; Seimandi, G.M.; Reutemann, A.G.; Derita, M.G. In vitro antifungal screening of Argentine native or naturalized plants against the phytopathogen Monilinia fructicola. Comb. Chem. High Throughput Screen. 2022, 25, 1158–1166. [Google Scholar]
- Di Liberto, M.G.; Seimandi, G.M.; Fernández, L.N.; Ruiz, V.E.; Svetaz, L.A.; Derita, M.G. Botanical control of citrus green mold and peach brown rot on fruits assays using a Persicaria acuminata phytochemically characterized extract. Plants 2021, 10, 425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hassan, H.; Mohamed, M.T.; Yusoff, S.F.; Hata, E.M.; Tajidin, N.E. Selecting antagonistic yeast for postharvest biocontrol of Colletotrichum gloeosporioides in papaya fruit and possible mechanisms involved. Agronomy 2021, 11, 760. [Google Scholar] [CrossRef] [Scilit]
- Romanazzi, G.; Nigro, F.; Ippolito, A.; Salerno, M. Effect of short hypobaric treatments on postharvest rots of sweet cherries, strawberries and table grapes. Postharvest Biol. Technol. 2001, 22, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Singh, V.; Deverall, B.J. Bacillus subtilis as a control agent against fungal pathogens of citrus fruit. Trans. Br. Mycol. Soc. 1984, 83, 487–490. [Google Scholar] [CrossRef] [Scilit]
- Favaro, M.A.; Roeschlin, R.A.; Ribero, G.G.; Maumary, R.L.; Fernández, L.N.; Lutz, A.; Sillon, M.; Rista, L.M.; Marano, M.R.; Gariglio, N.F. Relationship between copper content in orange leaves, bacterial biofilm formation and citrus canker disease control after different copper treatment. Crop Prot. 2019, 92, 182–189. [Google Scholar] [CrossRef] [Scilit]
- Ngolong Ngea, G.L.; Qian, X.; Yang, Q.; Dhanasekaran, S.; Ianiri, G.; Ballester, A.R.; Zhang, X.; Castoria, R.; Zhang, H. Securing fruit production: Opportunities from the elucidation of the molecular mechanisms of postharvest fungal infections. Comp. Rev. Food Sci. Food Saf. 2021, 20, 2508–2533. [Google Scholar] [CrossRef] [Scilit]
- Staroń, P.; Pszczółka, K.; Chwastowski, J.; Banach, M. Sorption behavior of Arachis hypogaea shells against Ag+ ions and assessment of antimicrobial properties of the product. Environ. Sci. Pollut. Res. 2020, 27, 19530–19542. [Google Scholar] [CrossRef] [Scilit]
- Samir, R.M.; Osman, A.; El-Sayed, A.I.; Algaby, A.M. Physicochemical properties and antimicrobial effects of roselle corolla, onion peels and peanut skins anthocyanins. Zagazig J. Agric. Res. 2019, 46, 769–781. [Google Scholar]
- Chong, J.; Poutaraud, A.; Hugueney, P. Metabolism and roles of stilbenes in plants. Plant Sci. 2009, 177, 143–155. [Google Scholar] [CrossRef] [Scilit]
- Devi, S.I.; Pooja Vashista, P.V.; Sharma, C.B. Purification to homogeneity and characterization of two antifungal proteins from the roots of Arachis hypogaea L. Natl. Acad. Sci. Lett. 2005, 28, 21–28. [Google Scholar]
- Sobolev, V.S.; Khan, S.I.; Tabanca, N.; Wedge, D.E.; Manly, S.P.; Cutler, S.J.; Coy, M.R.; Becnel, J.J.; Neff, S.A.; Gloer, J.B. Biological activity of peanut (Arachis hypogaea) phytoalexins and selected natural and synthetic stilbenoids. J. Agric. Food Chem. 2011, 59, 1673–1682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, X.; Ng, T.B. Hypogin, a novel antifungal peptide from peanuts with sequence similarity to peanut allergen. J. Pept. Res. 2001, 57, 330–336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parveen, S.; Gupta, A.D.; Prasad, R. Arabinogalactan protein from Arachis hypogaea: Role as carrier in drug-formulations. Int. J. Pharm. 2007, 333, 79–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gomes, A.; de Figueiredo Furtado, G.; Lopes Cunha, R. Bioaccessibility of lipophilic compounds vehiculated in emulsions: Choice of lipids and emulsifiers. J. Agric. Food Chem. 2019, 67, 13–18. [Google Scholar] [CrossRef] [Scilit]
- O’Driscoll, C.M.; Griffin, B.T. Biopharmaceutical challenges associated with drugs with low aqueous solubility—The potential impact of lipid-based formulations. Adv. Drug Deliv. Rev. 2008, 60, 617–624. [Google Scholar] [CrossRef] [Scilit]
- Bromilow, R.H.; Evans, A.A.; Nicholls, P.H. The influence of lipophilicity and formulation on the distribution of pesticides in laboratoty-scale sediment/water systems. Pest Manag. Sci. 2003, 59, 238–244. [Google Scholar] [CrossRef] [Scilit]
- Tucuch-Pérez, M.A.; Arredondo-Valdés, R.; Hernández-Castillo, F.D. Antifungal activity of phytochemical compounds of extracts from Mexican semi-desert plants against Fusarium oxysporum from tomato by microdilution in plate method. Nova Sci. 2020, 12, 25. [Google Scholar] [CrossRef] [Scilit]
- Mirahmadi, S.F.; Norouzi, R. Chemical composition, phenolic content, free radical scavenging and antifungal activities of Achillea biebersteinii. Food Biosci. 2017, 18, 53–59. [Google Scholar] [CrossRef] [Scilit]
- Arumugam, M.; Manikandan, D.B.; Sridhar, A.; Palaniyappan, S.; Jayaraman, S.; Ramasamy, T. GC–MS based metabolomics strategy for cost-effective valorization of agricultural waste: Groundnut shell extracts and their biological inhibitory potential. Waste Biomass Valori. 2022, 13, 4179–4209. [Google Scholar] [CrossRef] [Scilit]
- Abdelshafy, A.M.; Belwal, T.; Liang, Z.; Wang, L.; Li, D.; Luo, Z.; Li, L. A comprehensive review on phenolic compounds from edible mushrooms: Occurrence, biological activity, application and future prospective. Crit. Rev. Food Sci. Nutr. 2022, 62, 6204–6224. [Google Scholar] [CrossRef] [Scilit]
- Hilbig, J.; Alves, V.R.; Müller, C.M.; Micke, G.A.; Vitali, L.; Pedrosa, R.C.; Block, J.M. Ultrasonic-assisted extraction combined with sample preparation and analysis using LC-ESI-MS/MS allowed the identification of 24 new phenolic compounds in pecan nut shell [Carya illinoinensis (Wangenh) C. Koch] extracts. Food Res. Int. 2018, 106, 549–557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oulahal, N.; Degraeve, P. Phenolic-rich plant extracts with antimicrobial activity: An alternative to food preservatives and biocides? Front. Microbiol. 2022, 12, 753518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Albuquerque, B.R.; Heleno, S.A.; Oliveira, M.B.; Barros, L.; Ferreira, I.C. Phenolic compounds: Current industrial applications, limitations and future challenges. Food Funct. 2021, 12, 14–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodrigues, N.P.; Pechina, B.D.; Sarkis, J.R. A comprehensive approach to pecan nut valorization: Extraction and characterization of soluble and insoluble-bound phenolics. J. Am. Oil Chem. Soc. 2022, 99, 843–854. [Google Scholar] [CrossRef] [Scilit]
- Cason, C.; Yemmireddy, V.K.; Moreira, J.; Adhikari, A. Antioxidant properties of pecan shell bioactive components of different cultivars and extraction methods. Foods 2021, 10, 713. [Google Scholar] [CrossRef] [Scilit]
- do Prado, A.C.; Aragão, A.M.; Fettand, R.; Block, J.M. Antioxidant properties of pecan nut [Carya illinoinensis (Wangenh.) C. Koch] shell infusion. Grasas Aceites 2009, 60, 330–335. [Google Scholar] [CrossRef] [Scilit]
- Porto, L.C.; da Silva, J.; Ferraz, A.D.; Corrêa, D.S.; dos Santos, M.S.; Porto, C.D.; Picada, J.N. Evaluation of acute and subacute toxicity and mutagenic activity of the aqueous extract of pecan shells [Carya illinoinensis (Wangenh.) K. Koch]. Food Chem. Toxicol. 2013, 59, 579–585. [Google Scholar] [CrossRef] [Scilit]
- Gao, F.; Ye, H.; Yu, Y.; Zhang, T.; Deng, X. Lack of toxicological effect through mutagenicity test of polyphenol extracts from peanut shells. Food Chem. 2011, 129, 920–924. [Google Scholar] [CrossRef] [Scilit]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).


