Effects of Long-Term High Temperatures in the Root Zone on the Physiological Characteristics of Grapevine Leaves and Roots: Implications for Viticulture Practices
Abstract
1. Introduction
2. Material and Methods
2.1. Test Materials and Treatment
2.2. Measurement Indexes and Methods
2.2.1. Determination of the Plant Growth Potential and Lignin Content
2.2.2. Determination of the Kinetic Curves of Fast Chlorophyll Fluorescence
2.2.3. Determination of Photosynthetic Gas Exchange Parameters
2.2.4. Determination of Chlorophyll, Malondialdehyde, and Hydrogen Peroxide Content in Grapevine Leaves
2.2.5. Determination of Antioxidant Enzymes and Proline Content in Grapevine Leaves
2.2.6. Determination of the Root Respiratory Pathway
2.2.7. Determination of Grapevine Root Activity
2.2.8. Determination of Lignin-Related Gene Expression
2.3. Data Analysis
3. Results
3.1. Effects of High Root Zone Temperatures on Grapevines’ Growth Potential
3.2. Effects of High-Root-Zone-Temperature Treatments on the Photosynthetic Performance of Grapevine Leaves
3.2.1. Effects of High-Root-Zone-Temperature Treatments on the Chlorophyll Content of Grapevine Leaves
3.2.2. Effects of the High-Root-Zone-Temperature Treatment on the Fluorescence Characteristics of Grapevine Leaves
3.2.3. Effects of the High-Root-Zone-Temperature Treatments on the Photosynthetic Gas Exchange Parameters of Grapevine Leaves
3.3. Effects of High-Root-Zone-Temperature Treatments on the Production and Scavenging of Reactive Oxygen Species in Grapevine Leaves
3.4. Effects of the High-Temperature Treatments in the Root Zone on the Respiration and Lignification of Grape Roots
3.4.1. Effects of the High-Root-Zone-Temperature Treatments on the Respiration Intensity of Grapevine Roots
3.4.2. Effects of the High-Root-Zone-Temperature Treatments on the Root Activity, Lignin Content, and Expression of Lignin-Synthase-Related Genes of Grapevines
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Song, M.L.; Wen, X.Z.; Li, Y.L. A review of the effects of rhizosphere high temperature on plant growth and metabolism. J. Ecol. 2010, 29, 2258–2264. [Google Scholar]
- Wang, H.; Li, Z.H.; Xu, L.C.; Wang, M.; Kang, H.; Yao, Y.X.; Du, Y.P.; Gao, Z. The effect of different air temperatures on the activity of PS Ⅱ in grape leaves and its recovery under root zone high temperature stress. Chin. Fruit Trees 2022, 23–28. [Google Scholar]
- Zou, H.; Wang, C.X.; Huang, D.F.; Wang, R.Z. Numerical study on the effect of optical properties of plastic film on root zone temperature of summer crops. Refrig. Technol. 2021, 41, 1–8. [Google Scholar]
- Walker, J.M. One-degree increments in soil temperatures affect maize seedling behavior. Soil Sci. Soc. Am. J. 1969, 33, 729–736. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.Z.; Zhang, X.B.; Yang, X.F. The effect of rhizosphere high temperature on the root structure, photosynthesis, and chlorophyll fluorescence parameters of fast cabbage. Chin. Melon Veg. 2020, 33, 48–52. [Google Scholar]
- Xia, Z.Q.; Si, L.Y.; Jin, Y.; Fu, Y.F.; Wang, Q.; Lu, H.D. Effects of root zone temperature increase on physiological indexes and photosynthesis of different genotype maize seedlings. Russ. J. Plant Physiol. 2021, 68, 169–178. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Wang, M.; Liang, T.; Yao, Y.X.; Du, Y.P.; Gao, Z. The effects of temperature and root zone temperature on the photosynthetic fluorescence characteristics of grape leaves. Acta Bot. Sin. 2022, 57, 209–216. [Google Scholar]
- Ding, X.; Jiang, Y.; He, L.; Zhou, Q.; Yu, J.; Hui, D.; Huang, D. Exogenous glutathione improves high root-zone temperature tolerance by modulating photosynthesis, antioxidant and osmolytes systems in cucumber seedlings. Sci. Rep. 2016, 6, 35424. [Google Scholar] [CrossRef] [Scilit]
- Qiu, Y.; Zhou, J.H.; Huang, S.L.; Li, Q.; Zhang, Y.; Lu, X.Y. The effect of the interaction between root temperature and nitrogen forms on the growth and potassium accumulation of flue-cured tobacco. Chin. J. Tob. 2015, 21, 88–92. [Google Scholar]
- Liu, B.Z.; Zhang, F.; Lei, L.; Meng, X.M.; Zang, M.X.; Dong, C.J.; Shang, Q.M. The effect of root zone temperature stress on the root growth and sucrose metabolism of tomato seedlings. Chin. Veg. J. 2023, 68–77. [Google Scholar]
- Li, R.R.; Zhu, Y.L.; Takayama, M.; Shi, S.H.; Yang, L.F. The effect of root zone temperature on the growth and mineral element content of hydroponic lettuce. Shanghai Agric. J. 2015, 31, 48–52. [Google Scholar]
- Han, Y.P.; Li, Y.L.; Lei, Z.H.; Zhao, D.; Jia, X.S. The effect of different root temperature treatments on the microstructure of tomato leaves. Agric. Sci. Technol. 2016, 17, 1834–1837+1841. [Google Scholar]
- Hmiz, D.J.; Ithbayyib, I.J. Effect of the root zone temperature and salt stress on plant growth, main branches and some other chemical characteristics of tomato fruit Solanum lycopersicum L. cv. memory. Basrah J. Agric. Sci. 2021, 34, 156–170. [Google Scholar] [CrossRef] [Scilit]
- Fu, G.H.; Liu, W.K. The diurnal variation characteristics of root zone temperature in ridge embedded substrate cultivation of sweet pepper in a solar greenhouse. Chin. J. Ecol. Agric. 2016, 24, 47–55. [Google Scholar]
- Peters-Lidard, C.D.; Blackburn, E.; Liang, X.; Wood, E.F. The Effect of Soil Thermal Conductivity Parameterization on Surface Energy Fluxes and Temperatures. J. Atmos. Sci. 1998, 55, 1209–1224. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Wang, Q.J.; Fan, J.; Wang, W.H. Comparative analysis of soil thermal conductivity measurement and calculation models. J. Agric. Eng. 2012, 28, 78–84. [Google Scholar]
- Steenwerth, K.L.; Jackson, L.E.; Calderón, F.J.; Stromberg, M.R.; Scow, K.M. Soil microbial community composition and land use history in cultivated and grassland ecosystems of coastal california. Soil Biol. Biochem. 2003, 34, 1599–1611. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Gao, M.; Wu, W.; Tanveer, S.K.; Wen, X.; Liao, Y. The effects of conservation tillage practices on the soil water-holding capacity of a non-irrigated apple orchard in the Loess Plateau, China. Soil Tillage Res. 2013, 130, 7–12. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Wei, K.; Wang, L.Y.; Cheng, H.; He, W.; Zhou, J. A study on the changes in tenderness of tea tree new shoots and stems based on texture analyzer. Tea Sci. 2012, 32, 173–178. [Google Scholar]
- Chen, Q.J. The Effect of Red and Blue Light Quality on the Growth, Development, and Photosynthetic Characteristics of M9 Apple Rootstock Seedlings; Shandong Agricultural University: Tai’an, China, 2022. [Google Scholar]
- Yin, N.W.; Li, J.N.; Liu, X.; Lian, J.P.; Fu, C.; Li, W.; Jiang, J.Y.; Xve, Y.F.; Wang, J.; Chai, Y.R. The lignification response of rapeseed under high temperature and drought and its differences in stem and root. J. Crops 2017, 43, 1689–1695. [Google Scholar]
- Strasser, B.J. Donor side capacity of photosystem II probed by chlorophyll a fluorescence transients. Photosynth. Res. 1997, 52, 147–155. [Google Scholar] [CrossRef] [Scilit]
- Li, P.M.; Gao, H.Y.; Strasser Reto, J. Application of rapid chlorophyll fluorescence induction kinetics analysis in photosynthesis research. J. Plant Physiol. Mol. Biol. 2005, 559–566. [Google Scholar]
- Zhang, Z.L.; Zai, W.Q. Guide to Plant Physiology Experiments, 3rd ed.; Higher Education Press: Beijing, China, 2016. [Google Scholar]
- Sun, Y.J. The Response Mechanism of Grape Photosystem Ii and Photosynthetic Carbon Assimilation to High Temperature and Strong Light; Shandong Agricultural University: Tai’an, China, 2016. [Google Scholar]
- Guo, D.; Chen, F.; Inoue, K.; Blount, J.W.; Dixon, R.A. Downregulation of caffeic acid 3-O-methyltransferase and caffeoyl CoA 3-O-methyltransferase in transgenic alfalfa: Impacts on lignin structure and implications for the biosynthesis of G and S lignin. Plant Cell 2001, 13, 73–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huntley, S.K.; Ellis, D.; Gilbert, M.; Chapple, C.; Mansfield, S.D. Significant increases in pulping efficiency in C4H-F5H-transformed poplars: Improved chemical savings and reduced environmental toxins. J. Agric. Food Chem. 2003, 51, 6178–6183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, Y.Y.; Xu, H.M.; Zhao, Y.Y.; Wu, H.Y.; Lin, J.X. Research progress on plant lignification process and its regulation. Chin. Sci. Life Sci. 2020, 50, 111–122. [Google Scholar]
- Jin, L.Q.; Che, X.K.; Zhang, Z.S.; Gao, H.Y. The relationship between the degree of injury on the donor and receptor sides of PSII in cucumber leaves under high temperature and strong light and the changes in rapid fluorescence parameter Wk. J. Plant Physiol. 2015, 51, 969–976. [Google Scholar]
- Xu, D.Q. Several issues in the study of plant light stress. Plant Physiol. Newsl. 2003, 493–495. [Google Scholar]
- Gerganova, M.; Popova, A.V.; Stanoeva, D.; Velitchkova, M. Tomato plants acclimate better to elevated temperature and high light than to treatment with each factor separately. Plant Physiol. Biochem. 2016, 104, 234–241. [Google Scholar] [CrossRef] [Scilit]
- Houborg, R.; Matthew, F.M.; Alessandro, C.; Anatoly, A.G. Leaf chlorophyll constraint on model simulated gross primary productivity in agricultural systems. Int. J. Appl. Earth Obs. Geoinf. 2015, 43, 160–176. [Google Scholar] [CrossRef] [Scilit]
- Liu, D.H.; Zhao, S.W.; Gao, R.F.; Zhang, Z.S.; Jiang, C.D.; Liu, Y.J. The response of plant photosynthesis to high temperature. Plant Res. 2002, 205–212. [Google Scholar]
- Wu, H.Y.; Shou, S.Y.; Zhu, Z.J.; Yang, X.T. The effects of high temperature stress on photosynthesis and chlorophyll fluores-cence in sweet pepper. J. Hortic. 2001, 517–521. [Google Scholar]
- Finkel, T. Signal transduction by reactive oxygen species. J. Cell Biol. 2011, 194, 7–15. [Google Scholar] [CrossRef] [Scilit]
- Huang, S.; Van Aken, O.; Schwarzländer, M.; Belt, K.; Millar, A.H. The Roles of Mitochondrial Reactive Oxygen Species in Cellular Signaling and Stress Response in Plants. Plant Physiol. 2016, 171, 1551–1559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pan, Y.Y.; Zhang, Y.; Shi, Y.; Li, S.; Li, X.F.; Hou, L.P. The effect of exogenous spermidine on the antioxidant system of tomato seedlings under osmotic salt stress. J. Northwest AF Univ. (Nat. Sci. Ed.) 2019, 47, 57–66. [Google Scholar]
- Zhu, H.; Bunn, H.F. Oxygen sensing and signaling: Impact on the regulation of physiologically important genes. Respir. Physiol. 1999, 115, 247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, J.; Jia, Y.X.; Guo, S.R. The effects of seawater stress on chloroplast reactive oxygen species and chlorophyll metabolism in spinach (Spinacia oleracea L.). J. Ecol. 2009, 29, 4361–4371. [Google Scholar]
- Zhang, Y.W.; Li, M.N.; Zhao, Y. The effect of rhizosphere high temperature on soluble protein and antioxidant enzyme activity in different tissues of alfalfa. West. For. Sci. 2019, 48, 66–71. [Google Scholar]
- Joshi, R.; Chinnusamy, V. Antioxidant Enzymes: Defense against High Temperature Stress. Oxidative Damage Plants 2014, 369–396. [Google Scholar]
- Feng, Y.L.; Jiang, S.M. Adaptation of Tomatoes to Leaf Water Stress Caused by High Root Temperature. J. Ecol. 2001, 747–751. [Google Scholar]
- Karlova, R.; Boer, D.; Hayes, S.; Testerink, C. Root plasticity under abiotic stress. Plant Physiol. 2021, 187, 1057–1070. [Google Scholar] [CrossRef] [Scilit]
- D E Lima, C.F.F.; Kleine-Vehn, J.; De Smet, I.; Feraru, E. Getting to the root of belowground high temperature re-sponses in plants. J. Exp. Bot. 2021, 72, 7404–7413. [Google Scholar]
- Escamilla-Treviño, L.L.; Shen, H.; Uppalapati, S.R.; Ray, T.; Tang, Y.; Hernandez, T.; Yin, Y.; Xu, Y.; Dixon, R.A. Switchgrass (Panicum virgatum) possesses a divergent family of cinnamoyl CoA reductases with distinct biochemical properties. New Phytol. 2010, 185, 143–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weng, J.K.; Mo, H.; Chapple, C. Over-expression of F5H in COMT-deficient Arabidopsis leads to enrichment of an unu-sual lignin and disruption of pollen wall formation. Plant J. 2010, 64, 898–911. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lynch, J.P. Root phenes that reduce the metabolic costs of soil exploration: Opportunities for 21st century agricul-ture. Plant Cell Environ. 2015, 38, 1775–1784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.S.; Du, G.D.; Lv, D.G. The effect of soil high-temperature treatment on the respiration metabolism and plant development of continuous cropping strawberry roots. J. Fruit Trees 2011, 28, 234–239. [Google Scholar]
- Xie, J.J. The Alternate Respiratory Pathway Maintains the Operation of Psii by Regulating Antioxidant Defense Levels under Environmental Stress; Northwest Normal University: Lanzhou, China, 2018. [Google Scholar]
- Chen, L.Z.; Zhang, X.B.; Yang, X.F. The effect of rhizosphere high temperature on the growth and photosynthetic physiology of Chinese cabbage. North. Hortic. 2020, 50–55. [Google Scholar]
- Du, Y.C.; Tachibana, S. Effect of supraoptimal root temperature on the growth, root respiration and sugar content of cucumber plants. Sci. Hortic. 1994, 58, 289–301. [Google Scholar] [CrossRef] [Scilit]






| Gene | Sequence (5′→3′) | Gene Sequence Number in NCBI |
|---|---|---|
| F5H | F: AAGAACTCGTGGGACGAACC R: CGACCCGATCCGAATGGAAT | AM428660.2:9990-10008 |
| COMT | F: TTTCCATGCAGCTCGTCAGT R: GTTGTGGGTGGGGATCTGAG | XM_003634113.2:140-1234 |
| C4H | F: GAACCACCTGAACCTCTCCG R: ATCCGAACTCCACTCCCTGA | XM_002266202.3:70-1587 |
| 4CL | F: TCAAGTCTGGGTCTTGTGGC R: GGATGCAAATTTCTCCGGGC | XM_002272746.4:98-1744 |
| CAD | F: GCATGAGGTGGTAGGTGAGG R: TGATTTGCATGGACGGCAGA | XM_002285358.4:73-1146 |
| HCT | F: CTGAGCAAGGTTTTGGTGCC R: CGATGACAGAGCCGGTATCC | XM_002268952.3:271-1560 |
| CCo AOMT | F: ACGAACCAAGAAGCTGGGAG R: ATGCTGGGCAGTCAACTCTC | NM_001281118.1:60-788 |
| CCR | F: GCAGTGTACATGGACCCCAA R: TTTCTCCTTCGCAACCTCCC | XM_002273418.3:86-1102 |
| PAL | F: CACACATTGCCTCACAGTGC R: GCAGAGGCAAGCAAGGACTA | XM_002285241.3:116-2269 |
| Treatment | Longitudinal Diameter (mm) | Horizontal Diameter (mm) | Pith Ratio | Stem Firmness (g) | Shoot Growth Length (cm) | Root–Shoot Ratio | Stem Lignin Content (A280 nm/mg) |
|---|---|---|---|---|---|---|---|
| CK | 4.69 ± 0.48 a | 4.49 ± 0.40 a | 0.48 ± 0.03 a | 3765.35 ± 343.06 c | 4.17 ± 0.98 a | 0.92 ± 0.05 a | 0.25 ± 0.01 c |
| T1 | 4.78 ± 0.20 a | 4.69 ± 0.12 a | 0.64 ± 0.02 b | 5553.17 ± 692.63 b | 3.33 ± 0.93 ab | 0.85 ± 0.02 ab | 0.32 ± 0.01 b |
| T2 | 4.83 ± 0.41 a | 4.63 ± 0.25 a | 0.69 ± 0.08 b | 6825.90 ± 245.45 a | 2.88 ± 0.83 b | 0.79 ± 0.04 b | 0.40 ± 0.02 a |
| Treatment | ABS/RC | DIo/RC | TRo/RC | ETo/RC | ABS/CSm | DIo/CSm | TRo/CSm | ETo/CSm |
|---|---|---|---|---|---|---|---|---|
| CK | 2.19 ± 0.12 b | 0.64 ± 0.02 b | 1.55 ± 0.06 b | 0.96 ± 0.08 a | 1731.00 ± 174.31 a | 405.67 ± 35.55 b | 1325.33 ± 163.18 a | 771.25 ± 113.26 a |
| T1 | 2.33 ± 0.09 b | 0.69 ± 0.14 b | 1.64 ± 0.03 a | 0.61 ± 0.02 b | 1492.00 ± 101.43 ab | 468.50 ± 4.04 b | 1023.50 ± 210.01 b | 519.67 ± 53.36 b |
| T2 | 2.87 ± 0.31 a | 1.17 ± 0.17 a | 1.71 ± 0.04 a | 0.44 ± 0.08 c | 1459.33 ± 28.54 b | 622.83 ± 133.50 a | 836.50 ± 96.15 b | 273.67 ± 18.50 c |
| Treatment | Ci (μmol·m−2·s−1) | Gs (μmol·m−2·s−1) | Pn (μmol·m−2·s−1) | E (mmol·m−2·s−1) |
|---|---|---|---|---|
| CK | 203.60 ± 3.43 b | 224.25 ± 15.50 a | 11.14 ± 1.60 a | 3.38 ± 0.26 a |
| T1 | 181.83 ± 7.78 c | 180.80 ± 9.44 b | 7.40 ± 0.46 b | 2.70 ± 0.27 b |
| T2 | 245.00 ± 20.67 a | 121.20 ± 17.71 c | 4.30 ± 0.79 c | 2.04 ± 0.17 c |
| Treatment | MDA (μmol·g−1 FW) | H2O2 (μmol·g−1 FW) | SOD (U·g−1 FW) | POD (U·g−1 FW) | CAT (U·g−1 FW) | Pro (ug·g−1) |
|---|---|---|---|---|---|---|
| CK | 33.02 ± 1.25 c | 6.83 ± 0.55 c | 743.37 ± 63.29 b | 124.20 ± 38.64 c | 16.42 ± 0.33 b | 130.68 ± 20.38 b |
| T1 | 36.83 ± 2.20 b | 10.83 ± 1.56 b | 984.79 ± 22.26 ab | 252.40 ± 52.39 b | 22.95 ± 0.24 b | 167.03 ± 19.47 ab |
| T2 | 40.49 ± 0.52 a | 13.39 ± 1.44 a | 1225.43 ± 205.63 a | 344.55 ± 6.94 a | 41.46 ± 7.04 a | 184.66 ± 29.61 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Su, Y.; Li, X.; Cao, Z.; Gao, Z.; Du, Y. Effects of Long-Term High Temperatures in the Root Zone on the Physiological Characteristics of Grapevine Leaves and Roots: Implications for Viticulture Practices. Horticulturae 2024, 10, 245. https://doi.org/10.3390/horticulturae10030245
Su Y, Li X, Cao Z, Gao Z, Du Y. Effects of Long-Term High Temperatures in the Root Zone on the Physiological Characteristics of Grapevine Leaves and Roots: Implications for Viticulture Practices. Horticulturae. 2024; 10(3):245. https://doi.org/10.3390/horticulturae10030245
Chicago/Turabian StyleSu, Yifan, Xinfeng Li, Zhiyi Cao, Zhen Gao, and Yuanpeng Du. 2024. "Effects of Long-Term High Temperatures in the Root Zone on the Physiological Characteristics of Grapevine Leaves and Roots: Implications for Viticulture Practices" Horticulturae 10, no. 3: 245. https://doi.org/10.3390/horticulturae10030245
APA StyleSu, Y., Li, X., Cao, Z., Gao, Z., & Du, Y. (2024). Effects of Long-Term High Temperatures in the Root Zone on the Physiological Characteristics of Grapevine Leaves and Roots: Implications for Viticulture Practices. Horticulturae, 10(3), 245. https://doi.org/10.3390/horticulturae10030245

