Next Article in Journal
Genome-Wide Association Analyses Defined the Interplay between Two Major Loci Controlling the Fruit Texture Performance in a Norwegian Apple Collection (Malus × domestica Borkh.)
Previous Article in Journal
Early Chilling Injury Symptom Development and Recovery of Mature Green Banana: Involvement of Ethylene under Different Severities of Chilling Stress
Previous Article in Special Issue
Availability Evaluation and Application of MNP (Multiple Nucleotide Polymorphism) Markers in Variety Identification of Chrysanthemum
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Biological Characterization of Green Alga on Oil-Tea Camellia Leaves

Hainan Key Laboratory of Tropical Oil Crops Biology, Coconut Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang 571339, China
*
Author to whom correspondence should be addressed.
Horticulturae 2024, 10(10), 1047; https://doi.org/10.3390/horticulturae10101047
Submission received: 18 August 2024 / Revised: 25 September 2024 / Accepted: 26 September 2024 / Published: 1 October 2024
(This article belongs to the Special Issue New Advances in Molecular Biology of Horticultural Plants)

Abstract

Between 2023 and 2024, a type of green alga was observed for the first time settling on Oil-tea Camellia leaves and branches in the eastern Oil-tea Camellia planting area of Hainan Island, forming a layer of gray-green moss with a rough surface that seriously interfered with the leaves’ normal photosynthesis. To further research the issue, this study used the plant photosynthesis measurement system and the paraffin sectioning technique to compare and analyze the changes in photosynthetic characteristics and anatomical structure of healthy and green algal-covered Oil-tea Camellia leaves. At the same time, the algal strain was effectively separated and purified using the plate delineation method, and its species classification was determined by combining morphological observation and molecular identification based on SSU-ITS sequences. The results of the study demonstrated that the coating of green alga facilitated the lignification of the leaf’s epidermal cell walls. After being covered by the green alga, the intercellular CO2 concentration (Ci) increased significantly by 21.5%, while the net photosynthetic rate (Pn), transpiration rate (Tr), and stomatal conductance (Gs) all significantly decreased by 72.8%, 30.4%, and 24.9%, respectively. More specifically, the green alga that covers the leaves of Oil-tea Camellia was identified as Desmodesmus armatus of Chlorophyta. Notably, the green alga had a long growth cycle, did not undergo a decline phase within one month, had an optimal growth pH of 11.0, and could flourish in excessively alkaline conditions. In conclusion, this study not only reported for the first time the phenomena of D. armatus infesting Oil-tea Camellia leave, but also showed its unique physiological and ecological properties, providing a foundation for future research on relevant prevention and control approaches.

1. Introduction

Oil-tea Camellia is a collective name for plants in the genus Camellia of the family Theaceae with high oil content in their seeds and a specific cultivation location. It is one of the world’s four initial woody edible oil crops [1]. Camellia seed oil, also known as “Oriental olive oil”, is a high-quality edible oil rich in unsaturated fatty acids, and tea seed cake meal is high in tea saponins, which are widely used in everyday chemicals, pharmaceuticals, biopesticides, and other industries [2,3,4]. Furthermore, the United Nations Food and Agriculture Organization (FAO) recommended tea oil as a high-quality and healthful vegetable oil due to its nutritional content and great preservation properties [5]. From 2011 to 2021, the area of Oil-tea Camellia forest in China increased from 3.456 million hectares to 4.592 million hectares, with a growth rate of 51%; the production of Oil-tea Camellia seeds increased from 1.48 million tons to 3.94 million tons, with a growth rate of 166%; and the output value of the Oil-tea Camellia industry increased from USD 3.4 billion to USD 26.8 billion, with a nearly 7-fold increase in value, indicating the high value of Oil-tea Camellia [6].
The problem of Oil-tea Camellia pests and diseases has become more significant as the industry has grown and the planting area has expanded. In recent years, we discovered a variety of green alga (named Z2) that creates a rough gray-green mossy covering on the leaves and branches of Oil-tea Camellia during in-depth research conducted in the Oil-tea Camellia planting region in the eastern portion of Hainan Island. The green alga commonly infested Oil-tea Camellia in various new and old production areas, with a tendency to become increasingly severe. In severely affected areas, the incidence rate exceeds 80%. This phenomenon drastically interfered with the normal photosynthetic process of leaves, posing a threat to the growth and development of Oil-tea Camellia plants, resulting in yield and economic losses for growers.
The symptoms generated by green alga in this study on Oil-tea Camellia were quite distinct from the widely described historical symptoms of algal spots on woody plants caused by green algae of the genus Cephaleuros virescens [7,8,9,10,11,12,13,14]; rather, they are more similar to cases of newly discovered green alga infections on T. grandis cv. ‘Merrillii’ and Citrus sinensis Osbeck. The pathogen may be a member of the Chlorella sp. family, according to Wu’s (2005) [15] investigation of T. grandis cv. ‘Merrillii’ algal spots; nevertheless, the pathogenic alga’s precise morphological traits and methods of identification remain unclear. Following this, Ye (2019) [16] used cytomorphology and molecular identification (based on 18S rDNA and ITS sequence analysis) to identify the pathogenic alga on T. grandis cv. ‘Merrillii’ as Asterarcys quadricellulare of the family Scenedesmaceae. However, a recent study by Liu (2024) [17] revealed the complexity of algal spots of T. grandis cv. ‘Merrillii’, indicating that the disease is caused by a mixture of three algae, Desmodesmus armatus, Klebsormidium flaccidum, and Tritostichococcus corticulus, and that the morphology differs from that previously reported, primarily affecting the leaves and shoots of T. grandis cv. ‘Merrillii’, resulting in severe photosynthetic inhibition and decreased economic yields. Wang’s (2005) [18] study on Valencia Orange Green Spot, on the other hand, discovered that the disease was caused by Apatococcus lobatus of Chlorophyta and investigated its diverse range of growth adaptations and relationship with environmental conditions. It is evident that newly emerging green algae, like the aforementioned genera of Desmodesmus and Apatococcus, have been commonly infesting plants, including T. grandis cv. ‘Merrillii’ and Citrus sinensis Osbeck, resulting in significant financial losses. However, no systematic reports have been published on particular cases of Oil-tea Camellia infestation by D. armatus, and much less is known about the pathogen species and the mechanism of harm.
Furthermore, photosynthesis determines plant productivity, and efficient photosynthesis ensures that plants acquire enough photosynthetic products to support their growth [19]. In Oil-tea Camellia, the strength of photosynthesis is directly related to its yield and quality [20]. At present, studies on the factors affecting photosynthesis in Oil-tea Camellia have extensively covered internal factors such as cultivar characteristics, leaf age, chlorophyll content, leaf area index, etc., as well as external conditions such as light, moisture, temperature, CO2 concentration, etc. [21]. However, the precise effect of green algal cover on Oil-tea Camellia photosynthesis remains unexplored in studies around the world. On the other hand, plant leaves have the plasticity to adjust to changes in the external environment, and their anatomical configurations exhibit adaptive mechanisms to environmental changes [22]. Among these, lignification is a conserved mechanism of plant resistance to invasion by pathogenic bacteria. For example, plant recognition of Ralstonia solanacearum induces lignification of vascular cell walls through signaling, which forms the plant’s main barrier against the spread of Ralstonia solanacearum [23]; cotton’s defense response to Verticillium dahliae is through lignin accumulation [24]. Nevertheless, studies on green algae-induced lignification of plant leaves have not been reported so far.
In addition, the Oil-tea Camellia plantation area of Hainan Island, a typical tropical region, has distinct biological features of green alga, and the presence of this green alga may be connected to the tropical climate. In summary, the current study aimed to conduct an analysis of photosynthetic characteristics and anatomical structural changes in healthy and green algal-covered Oil-tea Camellia leaves using the plant photosynthesis measurement system and paraffin sectioning techniques and thoroughly apply morphological observation and molecular biology techniques to cultivate and analyze the sequence of the SSU-ITS gene of this green alga first found on the leaves of Oil-tea Camellia on Hainan Island, as well as to tentatively investigate its biological properties, to establish a solid scientific foundation for the healthy development of the Oil-tea Camellia industry.

2. Materials and Methods

2.1. Oil-Tea Camellia, Green Alga, and Main Reagents

Fresh, healthy leaves of Oil-tea Camellia and leaves covered with green alga were collected several times from July to December 2023 at the Oil-tea Camellia experimental base of Coconut Research Institute of Chinese Academy of Tropical Agricultural Sciences (CATAS) in Wenchang City, Hainan Province, China (19°32′4.92″ N, 110°45′47.29″ E), and were sealed and brought back to the laboratory for section observation and algal isolation, with the oil tea cultivar Camellia hainanica ‘Reyan No. 2’, which is a six-year-old oil tea tree.
Tiangen Biochemical Technology Co., Ltd., Beijing, China, supplied the algal DNA extraction kit TIANamp Genomic DNA Kit, while Haibo Biotechnology Co., Ltd., Qingdao, China, supplied the blue-green alga medium BG-11. All the other reagents were analytically pure.

2.2. Measurement of Photosynthetic Properties

The photosynthetic parameters of both healthy and green algal-covered Oil-tea Camellia leaves were measured on 4 September 2024, a sunny day, between 9:00 and 11:30 a.m. Twenty mature, old, completely expanded Camellia leaves were randomly chosen for each treatment. Oil-tea Camellia leaves were measured using a portable plant photosynthesis measurement device (GFS-3000, WALZ, Effeltrich, Germany). The experiments were conducted with a 6800-01F Fluorometer (round, 2 cm2, LI-COR, Lincoln, NE, USA). The CO2 concentration was set with a CO2 cylinder to 400 μmol·mol−1, the air flow rate was set to 500 µmol·s−1, and the light intensity was set to 1500 μmol·m−2·s−1. The leaves were photoinduced for 30 min and then measured. Net photosynthetic rate (Pn), transpiration rate (Tr), intercellular CO2 concentration (Ci), and stomatal conductance (Gs) were the primary metrics examined.

2.3. Observation of the Anatomical Structure of Oil-Tea Camellia Leaves

The paraffin slice method was employed to observe the leaf structure. Fresh tissues measuring 10 mm × 10 mm were extracted from healthy Oil-tea Camellia leaves and leaves covered in green alga near the middle veins. These samples were then immersed in the FAA fixing solution for over 24 h, dried using an ethanol gradient, dipped in wax, embedded, sectioned, and, following dewaxing, stained with safranin O-fast green before being sealed with neutral gum. Safranin O-fast green staining and paraffin slices were made by Xavier Biological Co., Ltd., Wuhan, China. Ten replications were carried out for each index, and it was examined and photographed using a Nikon ECLIPSE Ci orthogonal fluorescence microscope (Nikon Corporation, Tokyo, Japan) and its imaging system. The thickness of the upper epidermis (UE), palisade tissue (PT), spongy tissue (ST), lower epidermis (LE), leaf, and stratum corneum (SC) were measured using Case Viewer 2.4 software.

2.4. Green Algal Cultivation

To create a BG-11 liquid medium, 1.70 g of BG-11 solid powder was weighed, dissolved in 1000 mL of sterile water, combined, and sterilized according to the instructions. Using a sterile knife, a suitable quantity of green alga was removed from the leaf surface of fresh Oil-tea Camellia covered in green alga. The alga was then added to a triangular flask that held 100 mL of BG-11 liquid medium. The flask was set up for static incubation for two weeks at 26 °C, 60% humidity, and 6000 lx (120 μmol·m−2·s−1) light intensity, with a 12:12 light-to-dark ratio.

2.5. Green Alga Isolation and Purification

Alga strains were isolated using the plate scribing method, which involved inoculating cultured green alga on Oil-tea Camellia on BG-11 solid medium containing 1% (m/v) agar powder, using a combination of visual and microscopic observation, dipping a sterile inoculation loop into the edge of a single colony grown on the plate, and transferring it to a new plate for several isolation and purification steps until a single green algal strain was obtained. After one week of continuous cultivation, green alga was inoculated with inoculation needles dipped in BG-11 liquid medium for larger cultivation and further purification, and the algal fluid was monitored regularly, photographed, and recorded using a fluorescent microscope (Nikon ECLIPSE Ci-L plus, Nikon Corporation, Tokyo, Japan).

2.6. Plotting Green Alga Growth Curves on Oil-Tea Camellia

A total of 100 μL of logarithmic growth phase algal sap was extracted from the culture medium of green alga on Oil-tea Camellia and placed in a triangular flask with 100 mL of sterilized BG-11 liquid medium. The flask was then incubated in an incubator with a temperature of 26 °C, a humidity of 60%, an illumination intensity of 6000 lx (120 μmol·m−2·s−1), and a light-to-dark ratio of 12:12 for one month. The experiment was replicated three times. The culture flasks were shaken once a day in the morning and evening to inhibit algal cell development against the wall, and the absorbance value of the algal solution at 680 nm (OD680) was recorded every two days.

2.7. The Impact of pH on the Growth of Green Alga on Oil-Tea Camellia

From the culture broth of green alga on Oil-tea Camellia, 100 μL of logarithmic growth phase algal sap was extracted and added to BG-11 liquid medium, which had pH values of 6.0, 7.0, 8.0, 9.0, 10.0, and 11.0 (adjusted with 0.1 mol·L−1 hydrochloric acid and 0.1 mol·L−1 sodium hydroxide). The culture conditions included a temperature of 26 °C, 60% humidity, 6000 lx (120 μmol·m−2·s−1), and a photoperiod of 12 h of light and 12 h of darkness. The culture was incubated for three weeks with three replications using the original medium (natural pH) as the control group. The absorbance value of the algal solution at 680 nm (OD680) was recorded every two days.

2.8. Molecular Characterization of Algal Strains

After extracting 100 mL of algal sap during the logarithmic growth period and putting it into 50 mL centrifuge tubes, the algal bodies were ground with liquid nitrogen and used to extract genomic DNA using the TIANamp Genomic DNA Kit (Tiangen Biochemical Technology Co., Ltd., Beijing, China). The supernatant was discarded after centrifuging the mixture for 10 mL at 6000 r·min−1. The SSU-ITS fragment of green alga on Oil-tea Camellia was amplified using the algal universal primer pair EAF3/055R (EAF3: TCGACAATCTGGTTGATCCTGCCAG; 055R: CTCCTTGGTCCGTGTTTCAAGACGGG) [17], and PCR-amplified products were sent to Tsingke Biotech Co., Ltd., Beijing, China, for bidirectional sequencing. The sequences with high similarity were downloaded and used to analyze the sequencing results using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 18 May 2024) comparison in the NCBI. The SSU-ITS gene sequences were used to construct a phylogenetic tree using MAGA 7.0 software’s neighbour-joining method. The phylogenetic tree was then examined using Bootstrap to examine the phylogenetic tree with 1000 replications.

2.9. Statistical Analysis

Excel 2016 was utilized for data analysis and processing, while GraphPad Prism8 was used for two-way ANOVA analysis, t-tests, and charting.

3. Results

3.1. Characteristics of Symptoms

Yellowish-green specks initially developed on the adaxial surface of the leaves during the early stages of Oil-tea Camellia disease. These dots then progressively grew and fused and then developed into a rough, grayish-green, mossy covering that eventually covered the entire leaf (Figure 1). The photosynthesis of the leaves is impeded by this mulch, affecting the growth and development of the Oil-tea Camellia plant. Studies revealed that while the infestation on the newer leaves of the Oil-tea Camellia was rather modest, green alga mostly preferred to settle and multiply on the older leaves. It is also important to note that the frontal side of the blade had most of the green alga infection, with the abaxial side receiving very little damage. The Oil-tea Camellia’s mossy green alga coating may extend beyond its leaves to the tops of its branches and trunks, greatly enlarging the infestation’s range.

3.2. Effects of Green Alga on Photosynthetic Characteristics of Oil-Tea Camellia

The photosynthetic parameters of healthy and green algal-covered Oil-tea Camellia leaves were determined in this study (Table S1). The results showed that the covering of green alga to Oil-tea Camellia leaves significantly affected their net photosynthetic rate (Pn), transpiration rate (Tr), inter-cellular CO2 concentration (Ci), and stomatal conductance (Gs) (Figure 2). In comparison to the control, Pn, Tr, and Gs significantly decreased by 72.8%, 30.4%, and 24.9%, respectively, while Ci significantly increased by 21.5%.

3.3. Anatomical Structure of the Leaf Blade

Following the application of safranin O-fast green stain to plant leaves, the lignified portions of the leaves—such as lignified cell walls, ducts, fibers, etc.—showed red coloration as a result of the abundance of lignin, whereas the non-lignified portions—such as sieve tubes, thin-walled cells, and cytoplasm—showed green coloration [25]. According to staining results, lignified structures, including ducts and cuticles, looked red in control leaves, while non-lignified tissues like epidermal cells, chloroplasts, and sieve tubes appeared green (Figure 3A). On the other hand, red coloration was observed in the epidermal cell walls and conduits of leaves following green algal coverage (Figure 3B), suggesting that the process of cell wall lignification on the leaf surface was facilitated by green algal coverage. Additional statistical analyses (Figure 3C,D; Table S2) demonstrated that while the thickness of spongy tissue (ST) and stratum corneum (SC) did not significantly change, green algal mulching significantly increased the thickness of upper epidermis (UE), lower epidermis (LE), palisade tissue (PT), and leaf of Oil-tea Camellia leaves. The green algal cover was thought to improve the Oil-tea Camellia leaves’ ability to withstand mechanical stress and their defensive mechanism by lignifying the cell walls of the leaves and thickening certain tissue layers.

3.4. Isolation and Morphological Observation of Algal Strain

In this study, Oil-tea Camellia leaves covered in green alga were used to isolate and obtain solely cultivated, morphologically stable algal strains numerous times. These strains were then numbered and maintained at the Coconut Research Institute of the Chinese Academy of Tropical Agricultural Sciences (CAATAS). Based on morphological observations, the green alga on Oil-tea Camellia was found to be unicellular, typically consisting of two or more cells that were neatly arranged and aggregated in the same plane. The cells were light green, had smooth cell surfaces, and had an oval-shaped cytosol that measured 4.23–12.67 μm in length and 2.46–6.72 μm in width. Occasionally, the cytosol had spines at one end, and the bodies were pigmented (Figure 4). Based on the morphological characteristics of the spores, it was first recognized as Desmodesmus in the family of Chlorococcales, Chlorophyta [26].

3.5. Green Alga Growth Curves on Oil-Tea Camellia

The results of this study, which involved a thorough observation and analysis of the growth features of green alga on Oil-tea Camellia, revealed that these alga’s growth patterns resembled those of most other algae, exhibiting a regular growth cycle [27]. In particular, green alga on Oil-tea Camellia grew somewhat slowly in the early stages of culture (also known as the acclimation period). At this time, the alga progressively adapted to their new surroundings to get ready for their rapid growth later on. The growth rate then sharply increased as it entered the logarithmic growth cycle, and the algal liquid’s color quickly changed from the original light green to dark green, indicating a large increase in algal biomass. The growth of the alga ceased, and the stability phase began when they reached the saturation point of the environmental carrying capacity. When we looked more closely at the growth curves in Figure 5, we saw that the green alga on the Oil-tea Camellia had a relatively long acclimatization period. This was evident in the fact that the first four days were clearly in the acclimatization stage, the fifth day was the start of the logarithmic growth period, and the 27th day was the start of the stabilization period. Specific data are shown in Table S3. This result demonstrated that the green alga on Oil-tea Camellia had a lengthy growth cycle and that no overt signs of a decline period were seen within a month. This suggests that the green alga has a long lifespan on the leaf surface of Oil-tea Camellia and may still have an impact on the plant’s health. As a result, it can be concluded that the growth characteristics of green alga on Oil-tea Camellia demonstrated its capacity for long-term survival on oil tea trees. This is significant for comprehending its ecological role, assessing its influence on the growth of Oil-tea Camellia, and investigating practical preventive and control measures.

3.6. Effect of pH on the Growth of Green Alga on Oil-Tea Camellia

Figure 6 and Table S4 in this study shows the growth performance of green alga on Oil-tea Camellia in various pH media. Based on the rapid explosive development phase that followed the acclimation period (the first five days), the results demonstrated that the green alga on the Oil-tea Camellia exhibited optimal growth at pH 11.0. This growth was much better than that of the groups under other pH settings. Conversely, on days 9 and 11, respectively, green alga on Oil-tea Camellia in pH 10.0 versus pH 9.0 media started to grow more quickly. While this growth rate was higher, overall growth progressively approached rather than exceeded that of the pH 11.0 group. Interestingly, the growth of green alga on Oil-tea Camellia was significantly inhibited by environments with pH values of 6.0 and 7.0. When the growth rate was further examined, the results showed that the ideal growth pH for green alga on Oil-tea Camellia was 11.0, showing that this algal species favors an alkaline environment. The order was pH 11.0 > pH 10.0 > pH 9.0 > CK (control) > pH 8.0 > pH 7.0 > pH 6.0. This research not only demonstrates the ecological adaptations of green alga on Oil-tea Camellia, but it also offers a fresh viewpoint on the prevention and management of green alga in oil-tea planting.

3.7. Phylogenetic Analysis of Algal Strains

To better understand the phylogenetic status of the obtained green alga, the algal strain’s SSU-ITS interval sequence was analyzed. Following PCR amplification of the green alga, a 2921-bp sequence fragment was produced and named Z2 (Figure S1). Blast comparisons found that Z2 shared the highest homology with the Desmodesmus genus, with a resemblance of more than 97% to Desmodesmus armatus (GenBank accession number ON077058.1). The selection of algal strains with significant sequence similarity to construct a phylogenetic tree (Table S5) revealed that Z2 isolated in our investigation clustered tightly inside the same evolutionary branch as D. armatus (Figure 7). In this work, Z2 was classified as Desmodesmus armatus after combining morphological traits with the molecular phylogenetic analysis results.

4. Discussion

Few domestic and international reports exist on alga that damage woody plants; most of them concentrate on the infestation of crops by the parasitic cephalosporium Cephaleuros virescens, which causes algal spots. These crops include Oil-tea Camellia [7], camellia japonica [8], tea tree [9], Cinnamomum cassia [10], Manihot esculenta crantz [11], Hevea brasiliensis [12], Mangifera indica L. [13], Averrhoa carambola [14], and other crops. When this algal species infected the inside of the leaves, it led to necrosis of the plant tissues, forming subcircular, slightly raised, yellowish-brown, or reddish-brown patches with irregular margins on the diseased leaves [28]. The symptoms caused by green alga on Oil-tea Camellia that were seen in this study, however, were very different. They were characterized by the formation of gray-green, rough-surfaced, moss-like coverings on the leaves and branches of the plant. In extreme circumstances, the algal spots could cover the entire leaf, which would directly affect the leaves’ ability to photosynthesize. After being covered by green alga, the net photosynthetic rate (Pn), transpiration rate (Tr), and stomatal conductance (Gs) of Oil-tea Camellia leaves decreased significantly, and the intercellular CO2 concentration (Ci) increased significantly. This clinical pattern resembled the symptoms caused by Apatococcus lobatus on Citrus sinensis Osbeck and the aerial alga such as Desmodesmus armatus, Klebsormidium flaccidum, Tritostichococcus corticulus, and Chlorella spp. that were recently discovered on T. grandis cv. ‘Merrillii’ [17,18]. It has been proposed that these green algae may have a similar pathogenic mechanism; that is, being non-parasitic, they primarily adhere to the plant’s surface without entering its cells and obstruct the plant’s ability to carry out its regular physiological processes by interfering with the photosynthesis pathway. It is worth noting that while the current study first demonstrated the apparent effects of green alga on Oil-tea Camellia leaves, more thorough quantitative research is required to determine the potential effects on the plant’s real output and fruit quality.
The plant cell wall serves as the first line of defense against pathogenic microorganisms. It accomplishes this by employing several tactics, including lignification, cuticle thickening, embolization, and callose deposition, to effectively prevent pathogen attachment, invasion, germination, and proliferation [29]. Many plants have been shown to use this mechanism; for example, when faced with Podosphaera xanthii, wheat exhibits complex defense responses like cytoplasmic aggregation, papillae formation, halo effect, hypersensitive response, and lignification [30]; pumpkin, on the other hand, defends itself by changing its structural makeup, such as thickening its cell wall, to fend off pathogenic bacteria [31]; Furthermore, one of the main components of plants’ resistance to disease is cell wall lignification, which is seen in watermelon, cotton, and alfalfa [32,33]. In the current study, paraffin sectioning demonstrated considerable cell wall lignification of Oil-tea Camellia leaves after green alga cover, which was accompanied by a rise in leaf upper and lower epidermal thickness, palisade tissue thickness, and overall leaf thickness. This research highlights the function of cell wall lignification in plants’ adaptive responses to environmental stressors outside of their bodies. It increases the mechanical strength of leaves and fortifies them against pathogen attack and physical harm [34]. To withstand hardship, plants in the tropics typically employ tactics like wax secretion, leaf curling, downy growth, and leaf mutation. Oil-tea Camellia leaves’ epidermal cells have undergone lignification, which could be a special adaptation that helps the plant endure in tropical climates. Further research is warranted on this lignification feature, which may have major ecological and physiological implications for tropical woody plants.
This work combined molecular biology methods with conventional morphological observations to provide a thorough characterization of the green algal Z2 on Oil-tea Camellia leaves. The morphological features of Z2 were highly consistent with those of D. armatus, including the cell morphology, size, surface smoothness, and distribution of pigment bodies. These findings coincided with Liu’s (2024) [17] description of the pathogen of algal spots of T. grandis cv. ‘Merrillii’. Morphological analyses also revealed Z2 to be unicellular, which was arranged in a specific manner. However, we also used molecular biology techniques to improve the impartiality and precision of the identification results because algal morphology is sensitive to changes in the environment. Based on the findings of Pröschold (2020) [35], we chose SSU + ITS sequences as a method for phylogenetic analysis since they indicated greater confidence in algal identification. SSU-ITS sequencing and phylogenetic analysis validated the taxonomic status of the green alga (Z2) on Oil-tea Camellia as D. armatus. This discovery not only increased the diversity of Oil-tea Camellia disease pathogens but also highlighted the need for molecular biology tools in algal identification. The majority of current research on Desmodesmus spp. focuses on bioresources and environmental remediation; for example, it can be grown effectively in wastewater, has antioxidant potential, and has great potential for producing high-quality biodiesel and heavy metal remediation [36,37,38,39]. Reports on the species’ role as a phytopathogen are extremely limited to T. grandis cv. ‘Merrillii’ [17]. This study filled a knowledge gap regarding Oil-tea Camellia diseases by reporting, for the first time, the infestation of oil tea leaves by D. armatus. It also offered fresh insights and a solid scientific foundation for the pathogenetic investigation of Oil-tea Camellia phytophthora and the creation of preventative and remedial measures. Furthermore, this discovery expands our knowledge of the variety of phytoplasma pathogens and highlights the necessity of focusing more on algal pathogens in the future when monitoring and controlling plant diseases.
As a result of their long-term evolution and selection, algae have developed strong species specialization in their environmental adaptations. Among these, photosynthesis, respiration, elemental uptake, algal growth and metabolism, and metabolite utilization are all significantly impacted by the pH value of the culture medium, which is a crucial ecological factor [40,41]. Since different algae have varying pH requirements, it is now vital to know what range of pH an algal species is best suited for growth to assess its ecological adaptability [42,43]. The green alga of Oil-tea Camellia was the subject of this investigation, and it was discovered that this algal species has exceptional alkali resistance since it could develop optimally in an exceptionally alkaline pH 11.0 environment. This result is consistent with Scenedesmus obliquus’ preference for a high pH, indicating that the green alga on Oil-tea Camellia shares ecological habits with Scenedesmus obliquus [44]. It also confirms the findings of Liu (2024) [17] regarding the favorable growth of green alga on T. grandis cv. ‘Merrillii’ (such as D. armatus, etc.) in an alkaline environment. Further analysis revealed that the alkaline environment allowed the green algal cells on Oil-tea Camellia to continue dividing at a faster rate. These results were consistent with those of Yuan (2008) [45], who found that a low pH created an unfavorable environment for algal growth and that a moderate pH increase encouraged algal cell proliferation. Based on this, this study not only supported the preference of Oil-tea Camellia green alga for an alkaline environment, but it also suggested a novel method of preventing and controlling the growth of green alga on the plant by controlling the pH of the surrounding environment.

5. Conclusions

This study discovered that a variety of green alga settled on Oil-tea Camellia for the first time, creating a rough, gray-green moss coating that seriously interfered with the leaves’ regular ability to photosynthesize. The anatomical structure of the Oil-tea Camellia leaves revealed that the covering of the green alga promoted the lignification of the epidermal cell walls of the leaves. After being covered by the green alga, the intercellular CO2 concentration (Ci) increased significantly by 21.5%, while the net photosynthetic rate (Pn), transpiration rate (Tr), and stomatal conductance (Gs) all significantly decreased by 72.8%, 30.4%, and 24.9%, respectively. The identification of the green alga covering the Oil-tea Camellia leaves as Desmodesmus armatus of Chlorophyta was confirmed by the isolation and purification of the algal strain Z2 from the surface of the leaves, morphological observation, and phylogenetic analysis. According to the findings of its biological characterization, D. armatus had a long growth cycle, did not enter the decline period for one month, and had an ideal growth pH of 11.0. It was also capable of flourishing in extremely alkaline settings. In conclusion, this study establishes a scientific foundation for the industry’s healthy growth while also paving the way for future research on green algae in Oil-tea Camellia prevention and control technologies.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae10101047/s1, Figure S1: Sequencing results of SSU-ITS sequences of Desmodesmus armatus Z2 in this study; Table S1: Specific measurements of leaf photosynthetic characteristics in this study; Table S2: Specific measurements of leaf anatomy in this study; Table S3: Specific absorbance measurements used for green alga growth curve plotting in this study; Table S4: Specific absorbance values measured during the study of the effect of pH on the growth of green alga on Oil-tea Camellia; Table S5: Details of the species selected for the neighbour-joining phylogenetic tree.

Author Contributions

Conceptualization, X.J. and W.S.; methodology, Q.C. and K.W.; software, H.G.; validation, Q.C. and Y.L.; formal analysis, Y.Y.; investigation, Q.C. and Y.X.; resources, Z.Y.; data curation, H.G.; writing—original draft preparation, Q.C.; writing—review and editing, X.J.; visualization, Q.C.; supervision, Y.L. and K.W.; project administration, X.J. and Y.X.; funding acquisition, X.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R&D Program of China (No. 2023YFD2200700) and the Central Public-interest Scientific Institution Basal Research Fund (No. 1630152024006).

Data Availability Statement

All sequence data are available in the NCBI GenBank following the accession numbers in the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Deng, X.L.; Xie, G.S. Development of Refining Squeezing Tea Oil. Chem. Bioeng. 2008, 25, 46–48. [Google Scholar]
  2. Zhang, D.; Stack, L.; Zhang, R.; Yu, J.; Ruter, J.M. Teaoil Camellia-Eastern “Olive” for the World. Acta Hortic. 2006, 769, 43–48. [Google Scholar] [CrossRef]
  3. Lee, C.P.; Yen, G.C. Antioxidant Activity and Bioactive Compounds of Tea Seed (Camellia oleifera Abel.) Oil. J. Agric. Food Chem. 2006, 54, 779–784. [Google Scholar] [CrossRef] [PubMed]
  4. Shi, T.; Wu, G.; Jin, Q.; Wang, X. Camellia Oil Authentication: A Comparative Analysis and Recent Analytical Techniques Developed for Its Assessment. A Review. Trends Food Sci. Technol. 2020, 97, 88–99. [Google Scholar] [CrossRef]
  5. Chen, Y.; Deng, S.; Chen, L.; Ma, L.; He, H.; Wang, X.; Peng, S.; Liu, C.; Wang, R.; Xu, Y.; et al. A New View on the Development of Oil Tea Camellia Industry. J. Nanjing For. Univ. 2020, 44, 1–10. [Google Scholar] [CrossRef]
  6. Tan, X.; Yan, C.; Zhong, Q.; Wan, X.; Yuan, Y.; Guo, H.; Cao, L.; Wang, J.; Ge, X.; Wang, J.; et al. Breeding, Promotion and Application of Improved Oil-Tea Cultivar in China. World For. Res. 2023, 36, 108–113. [Google Scholar] [CrossRef]
  7. Li, Y. Studies on Cephaleuros Virescens Groun on Camilla oleifera. J. Wuhan Univ. Sci. Ed. 1983, 1, 61–65. [Google Scholar]
  8. He, M.; Yang, W.; Shen, T. Occurrence Regularity and Spatial Distribution of Camellia Algal Spot. J. Jinhua Polytech. 2017, 17, 69–72. [Google Scholar]
  9. Chen, L.; Chen, T.; Liu, Y.; Wang, Y. Identification of Pathogenic Form and DNA Sequence of Algal Spot of Tea Tree in Guizhou Province. Seed 2019, 38, 103–104. [Google Scholar] [CrossRef]
  10. Zheng, B. Algae-Spot Disease in Cinnamomum Cassia. For. Pest Dis. 2004, 2, 8–10. [Google Scholar]
  11. Chen, Y.; Shi, T.; Cai, J.; Li, C.; Li, B.; Huang, G. Survey and Pathogen Identification of a New Algae Spot Disease on Cassava in China. Chin. J. Trop. Crops 2016, 37, 1787–1792. [Google Scholar]
  12. Cai, Z.; Shi, Y.; Dai, L.; Liu, Y.; Li, L.; Jiang, G.; Yao, Y.; Mu, H. The Foliicolous Parasitic Alga Cephaleuros Virescens on Hevea Brasiliensis. J. Northwest For. Univ. 2020, 35, 183–188. [Google Scholar] [CrossRef]
  13. Vasconcelos, C.V.; Pereira, F.T.; Duarte, E.A.A.; De Oliveira, T.A.S.; Peixoto, N.; Carvalho, D.D.C. Physiological and Molecular Characterization of Cephaleuros Virescens Occurring in Mango Trees. Plant Pathol. J. 2018, 34, 157–162. [Google Scholar] [CrossRef] [PubMed]
  14. Reddy, D.; Srilatha, P.; Murthy, K.G.; Reddy, M.; Reddy, I.V.; Neelima, P.; Pavani, T.; Snehalatha, G.; Sravanthi, D. First Report of Cephaleuros Virescens Causing Algal Leaf Spot of Averrhoa Carambola in India. Plant Dis. 2023, 107, 3641. [Google Scholar] [CrossRef]
  15. Wu, Z.; Xu, Z.; Chen, X.; Jin, G.; Li, S.; Shen, Y.; Lang, X.; Hu, Z.; Chen, L. Species and Control of Insect Pests and Major Diseases of Torreya Grandis “Merrillii”. J. Zhejiang For. Coll. 2005, 22, 545–552. [Google Scholar] [CrossRef]
  16. Ye, X.; Qian, Y.; Ye, W.; Shen, H.; Zeng, Y.; Yu, W.; Dai, W. Biological Characteristics and Species Identification of Chlorella Sp. with Torreya Grandis “Merrillii”. J. Zhejiang AF Univ. 2019, 36, 629–637. [Google Scholar] [CrossRef]
  17. Liu, A.; Ye, B.; Chen, Y.; Song, Q.; Li, H.; Shen, J.; Zhang, X. Isolation and Identification of Pathogens of Algal Spots of Torreya Grandis Cv. ‘Merrillii’ and Screening of the Algicides. Sci. Silvae Sin. 2024, 60, 111–119. [Google Scholar]
  18. Wang, D.; Li, D. Studies on the Identification and Growth Characteristics of the Pathogen of Valencia Orange Green Spot. Chin. Agric. Ence Bull. 2005, 21, 288–291. [Google Scholar]
  19. Zhang, J.; Zhang, L.; Wang, Q.; Liu, J.; Sun, Y. Diurnal Regulation of Leaf Photosynthesis Is Related to Leaf-Age-Dependent Changes in Assimilate Accumulation in Camellia Oleifera. Plants 2023, 12, 2161. [Google Scholar] [CrossRef]
  20. Chen, L.; Chen, Y.; Peng, S. Research Progress on Photosynthetic Characteristics of Camellia oleifera and the Prospect of Its High Photosynthetic Efficiency Breeding. Hunan For. Sci. Technol. 2010, 37, 33–39. [Google Scholar]
  21. Wang, R.; Chen, Y.Z.; Yang, X.H.; He, G.F.; Li, J. Literature Review of Researches on Photosynthesis in Camellia oleifera L.and Its Affecting Factors. Nonwood For. Res. 2007, 25, 78–83. [Google Scholar] [CrossRef]
  22. Duan, W.J.; Shen, Y.F.; Cao, Z.H.; Shu, Q.L.; Hu, J.J.; Li, C.S. Effect of Foliar Fertilizer on Leaf Anatomy Structure and Photosynthetic Characteristics of Camellia Oleifera Container Seedlings. J. Northwest F Univ. Sci. Ed. 2015, 43, 92–97. [Google Scholar]
  23. Li, C.; Wang, R.; Liang, Y. Research Progress on the Regulation of Vascular Lignification on Defense against Bacterial Wilt of Plants. J. Zhejiang Univ. Agric. Life Sci. 2023, 49, 633–643. [Google Scholar] [CrossRef]
  24. Hu, Q.; Xiao, S.; Wang, X.; Ao, C.; Zhang, X.; Zhu, L. GhWRKY1-like Enhances Cotton Resistance to Verticillium Dahliae via an Increase in Defense-Induced Lignification and S Monolignol Content. Plant Sci. 2021, 305, 110833. [Google Scholar] [CrossRef]
  25. Bryan, J.H.D. Differential Staining with a Mixture of Safranin and Fast Green FCF. Stain Technol. 2009, 30, 153–157. [Google Scholar] [CrossRef]
  26. Hu, H.J.; Wei, Y.X. The Freshwater Algae of China-Systematics, Taxonomy and Ecology, 1st ed.; Science Press: Beijing, China, 2006; Volume 14. [Google Scholar]
  27. Qelbinur, E.; Ai, S.; Nurgul, R. Morphological and Molecular Identification of Four Groups Desert Green Algae. Food Mach. 2017, 33, 25–29. [Google Scholar]
  28. Sunpapao, A.; Thithuan, N.; Bunjongsiri, P.; Arikit, S. Cephaleuros Parasiticus, Associated with Algal Spot Disease on Psidium Guajava in Thailand. Australas. Plant Dis. Notes 2016, 11, 12. [Google Scholar] [CrossRef][Green Version]
  29. Miedes, E.; Vanholme, R.; Boerjan, W.; Molina, A. The Role of the Secondary Cell Wall in Plant Resistance to Pathogens. Front. Plant Sci. 2014, 5, 358. [Google Scholar] [CrossRef]
  30. Pazarlar, S.; Cetinkaya, N.; Bor, M.; Ozdemir, F. Ozone Triggers Different Defence Mechanisms against Powdery Mildew (Blumeria graminis DC. Speer f. Sp. tritici) in Susceptible and Resistant Wheat Genotypes. Funct. Plant Biol. FPB 2017, 44, 1016–1028. [Google Scholar] [CrossRef]
  31. Guo, W.; Bian, S.; Ye, J.; Zhao, J.; Yang, S.; Chen, B.; Li, Q. Observation on Cell Ultrastructure of Pumpkin Seedling Leaves Infected by Powdery Mildew Fungus. Plant Physiol. J. 2024, 60, 663–672. [Google Scholar] [CrossRef]
  32. Shi, H.; Liu, Z.; Zhu, L.; Zhang, C.; Chen, Y.; Zhou, Y.; Li, F.; Li, X. Overexpression of Cotton (Gossypium Hirsutum) Dirigent1 Gene Enhances Lignification That Blocks the Spread of Verticillium Dahliae. Acta Biochim. Biophys. Sin. 2012, 44, 555–564. [Google Scholar] [CrossRef]
  33. Gallego-Giraldo, L.; Jikumaru, Y.; Kamiya, Y.; Tang, Y.; Dixon, R.A. Selective Lignin Downregulation Leads to Constitutive Defense Response Expression in Alfalfa ( Medicago Sativa L.). New Phytol. 2011, 190, 627–639. [Google Scholar] [CrossRef] [PubMed]
  34. Guo, Y.; Xu, H.; Zhao, Y.; Wu, H.; Lin, J. Plant Lignification and Its Regulation. Sci. Sin. Vitae 2020, 50, 111–122. [Google Scholar] [CrossRef]
  35. Pröschold, T.; Darienko, T. The Green Puzzle Stichococcus (Trebouxiophyceae, Chlorophyta): New Generic and Species Concept among This Widely Distributed Genus. Phytotaxa 2020, 441, 113–142. [Google Scholar] [CrossRef]
  36. Safafar, H.; Van Wagenen, J.; Møller, P.; Jacobsen, C. Carotenoids, Phenolic Compounds and Tocopherols Contribute to the Antioxidative Properties of Some Microalgae Species Grown on Industrial Wastewater. Mar. Drugs 2015, 13, 7339–7356. [Google Scholar] [CrossRef] [PubMed]
  37. Li, G.; Zhang, J.; Li, H.; Hu, R.; Yao, X.; Liu, Y.; Zhou, Y.; Lyu, T. Towards High-Quality Biodiesel Production from Microalgae Using Original and Anaerobically-Digested Livestock Wastewater. Chemosphere 2021, 273, 128578. [Google Scholar] [CrossRef]
  38. Li, G.; Hu, R.; Wang, N.; Yang, T.; Xu, F.; Li, J.; Wu, J.; Huang, Z.; Pan, M.; Lyu, T. Cultivation of Microalgae in Adjusted Wastewater to Enhance Biofuel Production and Reduce Environmental Impact: Pyrolysis Performances and Life Cycle Assessment. J. Clean. Prod. 2022, 355, 131768. [Google Scholar] [CrossRef]
  39. Suresh Kumar, K.; Dahms, H.-U.; Won, E.-J.; Lee, J.-S.; Shin, K.-H. Microalgae–A Promising Tool for Heavy Metal Remediation. Ecotoxicol. Environ. Saf. 2015, 113, 329–352. [Google Scholar] [CrossRef] [PubMed]
  40. Wang, X.; Zhao, P.; Hu, P.; Peng, L.; Hao, L.; Cheng, C.; Liu, L.; Zhang, R. Optimization of Cultural Conditions of Isochrysis Galbana Parks 3011 and Its Mass-Cultural. Food Sci. 2006, 27, 253–257. [Google Scholar] [CrossRef]
  41. Ouyang, Z.; Wen, X.; Geng, Y.; Mei, H.; Hu, H.; Zhang, G.; Li, Y. The Effects of Light Intensities, Temperatures, pH and Salinities on Photosynthesis of Chlorella. Plant Sci. J. 2010, 28, 49–55. [Google Scholar] [CrossRef]
  42. Zhang, J.; Jiang, L.; Wu, D.; Yin, Y.; Guo, H. Effects of Environmental Factors on the Growth and Microcystin Production of Microcystis Aeruginosa under TiO2 Nanoparticles Stress. Sci. Total Environ. 2020, 734, 139443. [Google Scholar] [CrossRef] [PubMed]
  43. Zhang, H.; Zhang, G.; Wen, X.; Geng, Y.; Li, Y. Effects of Ph on the Photosynthesis, Growth and Lipid Production of Chlorella Sp.Xq-200419. Acta Hydrobiol. Sin. 2014, 38, 1084–1091. [Google Scholar] [CrossRef]
  44. Zhao, N.; Feng, M.; Zhu, L. Toxic Effects of Chromium(Cr~(6+)) on Chlorella Vulgaris and Scenedesmus Obliquus at Different pH. J. Southeast Univ. 2010, 29, 382–386. [Google Scholar]
  45. Yuan, L.; Song, W.; Xiao, L.; Jiang, L.; Yang, L. The Overall Orthogonal Design Study of Multifactor Interaction on the Growth of Microcystis Aeruginosa in the Presence of Adnascent Pseudomonas Sp. J. Nanjing Univ. Sci. 2008, 44, 77–83. [Google Scholar]
Figure 1. Symptoms of Oil-tea Camellia leaves covered with green alga. (A) Symptoms of leaves covered with green alga on Oil-tea Camellia trees; (B) Symptoms of a typical piece of Oil-tea Camellia leaf covered with green alga.
Figure 1. Symptoms of Oil-tea Camellia leaves covered with green alga. (A) Symptoms of leaves covered with green alga on Oil-tea Camellia trees; (B) Symptoms of a typical piece of Oil-tea Camellia leaf covered with green alga.
Horticulturae 10 01047 g001
Figure 2. Effect of green alga on photosynthesis of Oil-tea Camellia leaves. Each bar represents the mean measurement of various photosynthetic characteristics between the treatment group and the control group. Error bars indicate SEM. * p < 0.05, **** p < 0.0001, as determined by t-tests. CK indicate the control group with healthy leaves, and Z2 represent the treatment group with green algal-covered leaves. N = 20 independent experiments. (A) Effect of green alga on net photosynthetic rate (Pn) of Oil-tea Camellia leaves; (B) Effect of green alga on transpiration rate (Tr) of Oil-tea Camellia leaves; (C) Effect of green alga on inter-cellular CO2 concentration (Ci) of Oil-tea Camellia leaves; (D) Effect of green alga on stomatal conductance (Gs) of Oil-tea Camellia leaves.
Figure 2. Effect of green alga on photosynthesis of Oil-tea Camellia leaves. Each bar represents the mean measurement of various photosynthetic characteristics between the treatment group and the control group. Error bars indicate SEM. * p < 0.05, **** p < 0.0001, as determined by t-tests. CK indicate the control group with healthy leaves, and Z2 represent the treatment group with green algal-covered leaves. N = 20 independent experiments. (A) Effect of green alga on net photosynthetic rate (Pn) of Oil-tea Camellia leaves; (B) Effect of green alga on transpiration rate (Tr) of Oil-tea Camellia leaves; (C) Effect of green alga on inter-cellular CO2 concentration (Ci) of Oil-tea Camellia leaves; (D) Effect of green alga on stomatal conductance (Gs) of Oil-tea Camellia leaves.
Horticulturae 10 01047 g002
Figure 3. Leaf anatomical structure of Oil-tea Camellia. *** p < 0.001, **** p < 0.0001, ns = not significant, as determined by a two-way ANOVA with Sidak’s multiple comparisons test. CK indicate the control group with healthy leaves, and Z2 represent the treatment group with green algal-covered leaves. N = 10 independent experiments. (A) Anatomical structure of control leaves; (B) Anatomical structure of leaves after green alga coverage; (C) Statistical histograms of thickness of upper epidermis (UE), lower epidermis (LE), and stratum corneum (SC) of leaves with or without green alga coverage; (D) Statistical histograms of thickness of palisade tissue (PT), leaf, and spongy tissue (ST) of leaves with or without green alga coverage.
Figure 3. Leaf anatomical structure of Oil-tea Camellia. *** p < 0.001, **** p < 0.0001, ns = not significant, as determined by a two-way ANOVA with Sidak’s multiple comparisons test. CK indicate the control group with healthy leaves, and Z2 represent the treatment group with green algal-covered leaves. N = 10 independent experiments. (A) Anatomical structure of control leaves; (B) Anatomical structure of leaves after green alga coverage; (C) Statistical histograms of thickness of upper epidermis (UE), lower epidermis (LE), and stratum corneum (SC) of leaves with or without green alga coverage; (D) Statistical histograms of thickness of palisade tissue (PT), leaf, and spongy tissue (ST) of leaves with or without green alga coverage.
Horticulturae 10 01047 g003
Figure 4. Morphology of D. armatus.
Figure 4. Morphology of D. armatus.
Horticulturae 10 01047 g004
Figure 5. Growth curve of D. armatus.
Figure 5. Growth curve of D. armatus.
Horticulturae 10 01047 g005
Figure 6. Effects of pH on D. armatus.
Figure 6. Effects of pH on D. armatus.
Horticulturae 10 01047 g006
Figure 7. Phylogenetic tree of D. armatus based on SSU-ITS gene sequence. Z2 represents the algal strain obtained in this study after isolation and purification from green algal-covered Oil-Tea Camellia leaves.
Figure 7. Phylogenetic tree of D. armatus based on SSU-ITS gene sequence. Z2 represents the algal strain obtained in this study after isolation and purification from green algal-covered Oil-Tea Camellia leaves.
Horticulturae 10 01047 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cao, Q.; Liu, Y.; Xu, Y.; Yu, Z.; Wu, K.; Gong, H.; Yang, Y.; Song, W.; Jia, X. Identification and Biological Characterization of Green Alga on Oil-Tea Camellia Leaves. Horticulturae 2024, 10, 1047. https://doi.org/10.3390/horticulturae10101047

AMA Style

Cao Q, Liu Y, Xu Y, Yu Z, Wu K, Gong H, Yang Y, Song W, Jia X. Identification and Biological Characterization of Green Alga on Oil-Tea Camellia Leaves. Horticulturae. 2024; 10(10):1047. https://doi.org/10.3390/horticulturae10101047

Chicago/Turabian Style

Cao, Qiulin, Yanju Liu, Yufen Xu, Zhaoyan Yu, Kunlin Wu, Han Gong, Yaodong Yang, Weiwei Song, and Xiaocheng Jia. 2024. "Identification and Biological Characterization of Green Alga on Oil-Tea Camellia Leaves" Horticulturae 10, no. 10: 1047. https://doi.org/10.3390/horticulturae10101047

APA Style

Cao, Q., Liu, Y., Xu, Y., Yu, Z., Wu, K., Gong, H., Yang, Y., Song, W., & Jia, X. (2024). Identification and Biological Characterization of Green Alga on Oil-Tea Camellia Leaves. Horticulturae, 10(10), 1047. https://doi.org/10.3390/horticulturae10101047

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop