Seasonal Variations in Characteristics of Municipal Sludge and Their Impact on Anaerobic Digestion

Abstract

Anaerobic digestion is crucial for safe treatment and energy recovery from municipal sludge. However, seasonal variations in sludge physicochemical properties challenge the continuous, stable operation of anaerobic digestion systems. To investigate the seasonal variations in characteristics of municipal sludge and their impact, this study collected sludge samples from a Beijing plant over a year, analyzed their properties and microbial communities, and evaluated their biogas potential through four-week batch anaerobic digestion tests. The results demonstrated that spring sludge exhibited the highest organic matter (68.7% of total solids, TS), including soluble proteins, sugars, and lipids, while the lignocellulose content peaked in autumn (17% TS). These fluctuations were primarily driven by variations in rainfall, temperature, and human activities. The microbial community shifted significantly: Proteiniclasticum and other hydrolytic bacteria were dominant in spring, whereas Candidatus_Microthrix was notably enriched in winter. Consequently, the biochemical methane potential (BMP) was highest in spring (342.5 mL/g volatile solids) and lowest in autumn (255.8 mL/g volatile solids). Spearman’s correlation analysis indicated a significant positive correlation between BMP and soluble protein content, and a weak negative correlation with cellulose content. These findings provide essential data support for seasonal regulation of sludge anaerobic digestion systems, facilitating strategies to achieve stable biogas production.

1. Introduction

China’s rapid economic development has led to a continuous increase in the production of urban sewage and sludge. According to statistics compiled by the Ministry of Housing and Urban-Rural Development of the People’s Republic of China (2024), the municipal wastewater discharge volume reached 6.68 × 10¹⁰ m³ in 2023, with 14.94 million metric tons of dewatered sludge disposed of from treatment plants [1]. Sludge contains various substances with negative environmental impacts, such as pathogens [2] and polycyclic aromatic hydrocarbons [3]. Improper disposal of sludge can lead to significant environmental pollution and potential risks. Meanwhile, sludge also contains much organic content and valuable nutrients including nitrogen, phosphorus, and sulfur. Against the backdrop of current resource shortages, the recovery of these resources from sludge has become an important measure for sustainable development [4].

Practical experience and extensive research in sludge treatment plants have demonstrated that the technology combining anaerobic digestion with land application can effectively achieve the recycling of nutrients and energy contained in sludge, and has the potential to reach a state of negative carbon emissions [5]. This is highly significant for safe treatment, disposal, and energy recovery from sludge. However, during the actual operation of sludge anaerobic digestion systems, the sludge properties, yield, and microbial communities are often influenced by seasonal variations, which subsequently affect the anaerobic digestion performance [6,7]. For instance, sludge yield and organic matter content are typically lower in summer and higher in spring. This seasonal fluctuation challenges the stable, continuous operation of anaerobic digestion systems [8], as evidenced by the significant variation in sludge yield (ranging from 1.5 to 2.7 kg dry solids·kg⁻¹ biochemical oxygen demand) reported by Jin et al. [9]. To mitigate annual fluctuations in biogas production, measures such as appropriately increasing the feed rate of sludge and enhancing its organic matter content input to the anaerobic digestion system can be implemented, taking into account the characteristic seasonal differences in sludge properties [10,11,12].

However, research on seasonal variations in sludge characteristics and their influence on anaerobic digestion performance remains limited. This knowledge gap hampers the development of practical guidelines for adjusting treatment processes in response to fluctuations in feedstock properties. Therefore, a systematic investigation into the seasonal dynamics of sludge is essential to ensure efficient and stable year-round operation of anaerobic digestion systems, enable more precise optimization of pretreatment methods, inform targeted co-digestion strategies, and support the design of enhanced microbial consortia.

This study utilized sludge from a municipal wastewater treatment plant in Beijing that has maintained long-term stable operation. It analyzed the seasonal variations in the sludge’s organic matter content and composition, and employed high-throughput sequencing technology to characterize the microbial community structure and evaluate the biochemical methane potential (BMP). Correlation analysis was conducted to elucidate the relationship between the characteristics of the raw sludge and anaerobic digestion performance. The findings aim to provide data support for achieving year-round stable operation of sludge anaerobic digestion systems.

2. Materials and Methods

2.1. Raw Materials

The sludge used in this experiment was obtained from a wastewater treatment plant in Beijing. It consisted of pre-dewatered sludge, formed from a mixture of primary and surplus sludge, generated by treating 100% domestic sewage using an anaerobic–anoxic–oxic process. As the capital of China, and due to having a large urban population, Beijing’s sludge is representative of typical cities in northern China.

During the experimental period, which ran from October to the following September, sludge samples were collected no less than twice a month. After collection, samples were immediately transported to the laboratory and stored in a cold room at 4 °C for subsequent analysis, which was initiated as soon as possible.

The seasons for the experiment were defined according to traditional Chinese solar terms to better align with the actual local climate and living habits: Spring (February, March, and April), Summer (May, June, and July), Autumn (August, September, and October), and Winter (November, December, and January).

2.2. Analysis of Raw Material Characteristics

This study characterized the raw sludge by analyzing key properties including organic matter, soluble sugar, soluble protein, lipids, volatile organic acids, lignocellulose, and microorganisms. The detailed assay protocols are described in the Supplementary Testing Methods. Briefly, the total solids (TS) and volatile solids (VS) contents were determined following standard methods [13]. Soluble sugar content was measured using the phenol–sulfuric acid method [14], while soluble protein content was quantified by the Folin phenol reagent method [15]. Lipid content was determined via Soxhlet extraction [16]. The lignocellulose content was analyzed according to the Van Soest method [17]. Volatile fatty acids (VFAs), including acetic, propionic, isobutyric, butyric, isovaleric, valeric, and caproic acid, were analyzed using a gas chromatography system (GC-2010 Plus, Shimadzu, Kyoto, Japan) equipped with a flame ionization detector and an Rtx-wax capillary column, following the procedure described by Jiao et al. [18]. All measurements were performed in triplicate, and the results are reported as mean values.

The microbial community in raw materials was analyzed by Illumina Miseq high-throughput sequencing. Briefly, microbial DNA was extracted using an E.Z.N.A.^® Soil DNA Kit (Omega Bio-tek, Inc., Norcross, GA, USA) according to the manufacturer’s protocol. After DNA quality check, the extracted DNA was amplified using 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) primers [19]. Purified amplicons were pooled in equimolar amounts and paired-end-sequenced on an Illumina MiSeq platform (Illumina, San Diego, CA, USA), according to standard protocols (Shanghai Majorbio Bio-Pharm Technology Co., Ltd., Shanghai, China). The results were analyzed and obtained using the Silva (SSU123) 16S rRNA database.

2.3. Biochemical Methane Potential Tests

To investigate the seasonal variation in the biochemical methane potential (BMP) of sludge, samples collected in March, June, September, and December were selected to represent spring, summer, autumn, and winter conditions, respectively, constituting four experimental groups. Clean 120 mL serum bottles were used, and effluent collected from the stable operational phase of a continuous anaerobic digestion reactor at the same sludge treatment plant was added as inoculum sludge. The inoculum-to-substrate ratio (based on VS) was maintained at 2:1. Distilled water was added to adjust the TS content in each bottle to a uniform level, minimizing experimental deviations. A blank control—containing only inoculum sludge without any test substrate—was also included to account for background biogas production from the inoculum. All experimental setups were performed in triplicate. After adding the inoculum, experimental sludge, and distilled water as required, the headspace of each serum bottle was purged with nitrogen gas for two minutes to establish anaerobic conditions. The bottles were immediately sealed with rubber stoppers and secured with aluminum caps. The sealed bottles were then incubated in a constant-temperature water bath maintained at 37 °C. Each bottle was shaken several times daily to ensure thorough mixing and optimal contact between the substrate and inoculum.

During the BMP test, biogas production and composition from each serum bottle set were monitored daily over a four-week period. Biogas volume was measured using a syringe, while its composition was analyzed with a gas chromatograph (GC-8A, Shimadzu, Japan). The recorded data on biogas volume, compositional percentages, and methane concentration were utilized to calculate the methanogenic rate and cumulative methane production. These kinetic parameters were subsequently fitted using the Modified Gompertz model as expressed in Equation (1) [20]:

$$P=P_0\mathit{exp}\left\{-\mathit{exp}\left[{\displaystyle \frac{R_{max}\cdot \mathrm{e}}{p_0}}\left(\lambda -t\right)+1\right]\right\}$$

(1)

where P (mL/g VS) is the cumulative methane production, corrected for the blank control; P₀ (mL/g VS) represents the maximum methane production potential; R_max (mL/g VS/d) denotes the maximum methane production rate; λ (d) is the lag phase time; e is the natural constant (approximately 2.7183); and t (d) is the digestion time.

2.4. Data Analysis

Data organization and visualization were performed using Origin 2021. Differences were assessed for significance using the Duncan test in SPSS 17.0. The relationships between raw sludge properties and anaerobic digestion performance were examined using Spearman’s correlation analysis in SPSS 17.0.

3. Results and Discussion

3.1. Seasonal Variation in Organic Matter in Sludge

The volatile solids-to-total solids ratio (VS/TS), which serves as an indicator of organic matter content, is a critical parameter influencing sludge anaerobic digestion performance [21]. During the experimental period, the TS of the sludge ranged from 15.0% to 17.8%, while the VS content varied between 10.3% and 11.0%. As illustrated in Figure 1, the VS/TS ratio exhibited distinct seasonal variations, with values of approximately 68.7% in spring, 59.9% in summer, 61.8% in autumn, and 64.2% in winter. This pattern indicates a general trend of higher ratios in winter and spring, and lower ratios in summer and autumn.

The observed seasonal fluctuations in sludge characteristics can be largely attributed to weather conditions, particularly seasonal changes in rainfall and temperature that influence wastewater treatment plant operations [22,23]. Figure 2 presents the air temperature and weather data recorded during the sampling period [24]. Beijing experiences a typical continental monsoon climate, characterized by hot, rainy summers and cold, dry winters. Intensive summer rainfall can dilute the organic load entering the treatment plant, while higher temperatures enhance microbial activity, collectively contributing to the relative reduction in VS content during summer. Conversely, the opposite conditions in winter lead to higher VS levels. This finding is consistent with observations reported in previous studies [25].

A lower VS/TS ratio typically implies reduced biogas production potential. To mitigate seasonal fluctuations and ensure a stable annual biogas yield, operational strategies can be adjusted during summer and autumn. Such measures may include increasing the feed volume of digested sludge (on a dry basis) or supplementing with sludge characterized by a higher organic matter content [9,10].

3.2. Seasonal Variation in Soluble Sugars, Soluble Proteins, and Lipids in Sludge

Soluble sugars, proteins, and lipids are the primary organic components of sludge, serving as the basis for assessing anaerobic digestion performance and as key parameters for predicting and optimizing the process. Their seasonal variations are shown in Figure 3a, Figure 3b, and Figure 3c, respectively.

In spring, the contents of soluble sugars, soluble proteins, and lipids reached their significantly highest levels among the four seasons (p < 0.05), with average values of 0.98% TS (range: 0.73–1.12% TS), 1.58% TS (1.33–1.83% TS), and 15.27% TS (12.59–17.00% TS), respectively. In summer, the average soluble sugar content (0.55% TS) and protein content (1.01% TS) were higher than those in autumn (0.27% TS and 0.87% TS) and winter (0.33% TS and 0.83% TS). In contrast, the lipid content was higher in autumn (11.91% TS) than in summer (9.50% TS) and winter (9.20% TS).

Overall, spring exhibited the highest organic content, which is consistent with findings reported by Wang [26] and Wang et al. [11], and aligns with the higher VS/TS ratio observed in spring (Figure 1). The higher levels in spring can be attributed to two factors: elevated temperatures and human activity alongside lower rainfall, which increase the organic concentration in wastewater, as well as dietary shifts toward fresh produce that contribute to the organic load [11,27]. In contrast, the lower levels observed in winter can be linked to cold temperatures and scant precipitation, which reduced the input of organic matter, especially sugars and proteins.

Among the three organic components, lipids constituted the largest proportion. The lipid content observed in this study was generally higher than that reported by Lv et al. (5–15% TS) [28]. In another study, Lv and Liu [29] found that lipid and protein levels were higher in Beijing than in Guangzhou, while sugar content was lower. This discrepancy may reflect dietary differences between northern and southern China, with northern regions consuming more meat and protein-rich foods, and southern regions preferring fruits and sweeter foods. Additionally, longer hydraulic retention time in Beijing’s treatment plants may also influence compositional characteristics. These regional variations suggest that sludge treatment strategies should be tailored to local conditions. For instance, to enhance the anaerobic digestion efficiency of lipid-rich sludge, methods such as prolonging the sludge retention time, raising the anaerobic fermentation temperature, and increasing microbial activity and growth rate can be adopted [30].

3.3. Seasonal Variation in Volatile Fatty Acids in Sludge

Volatile fatty acids (VFAs), crucial intermediate products in anaerobic digestion, serve as a key indicator for optimizing and controlling sludge treatment processes, as their concentration directly impacts subsequent digestion performance. As shown in Figure 4, the total VFA content (calculated as acetic acid) exhibited distinct seasonal variation, with the highest level in spring (843.64 mg/L), followed by comparable levels in summer (778.85 mg/L) and autumn (817.03 mg/L), and a significantly lower concentration in winter (678.19 mg/L) (p < 0.05). This trend generally aligns with the seasonal variations observed in soluble sugars, proteins, and lipids within the sludge. Acetic acid was the predominant component across all seasons, accounting for 51% to 68% of the total VFAs. Propionic acid represented a significant proportion (approximately 18%) in spring and summer, whereas butyric acid was notably higher (also around 18%) in autumn and winter.

The increase in VFAs is primarily driven by the hydrolysis of organic matter. The seasonal variation in VFA levels generally aligns with changes in sludge organic content (i.e., Figure 1), except in winter. Although winter exhibits the lowest VFA concentration, its volatile solids (VS) content is the second highest after spring. This deviation in winter may be explained by seasonal shifts in the microbial community structure. Specifically, although the organic matter content is higher in winter, the hydrolysis efficiency of microorganisms is likely reduced due to lower temperatures, consequently affecting VFA production [31]. Furthermore, the highest VFA and acetic acid concentrations in spring indicate a high potential for anaerobic fermentation during this season.

3.4. Seasonal Variation in Lignocellulose in Sludge

Lignocellulose, which is generally recalcitrant to biodegradation, is a key factor limiting the methane production efficiency of sludge during anaerobic digestion. The seasonal content and composition of lignocellulose in the sludge are shown in Figure 5. The total lignocellulose content (sum of cellulose, hemicellulose, and lignin) was 13% TS in spring, 15% TS in summer, 17% TS in autumn, and 15% TS in winter. Across all seasons, the content of the three components consistently followed the following order: hemicellulose > lignin > cellulose. Spring exhibited the lowest content of hemicellulose (7.5% TS) and cellulose (1.9% TS). In contrast, summer and autumn showed significantly higher hemicellulose contents, at 9.2% TS and 10.9% TS, respectively (p < 0.05). In winter, hemicellulose accounted for the lowest proportion (51%) of the total lignocellulose, while cellulose (20%) and lignin (29%) reached their highest proportions.

Autumn had the highest lignocellulose content, particularly hemicellulose, which constituted up to 65% of the total, followed by summer. The peak of summer and autumn may be due to the lush growth of plants during these two seasons; then, the increased inflow of suspended solids like fallen leaves and weeds into urban wastewater may be the primary sources of lignocellulose in sludge. The elevated lignocellulose content, being difficult to degrade, can significantly impact biogas fermentation efficiency. To enhance anaerobic digestion performance, pretreatment processes such as thermal hydrolysis and mechanical or chemical methods can be employed [32]. Alternatively, bioaugmentation by inoculating or enriching specific microbial communities can be adopted to improve the degradation of these recalcitrant components [33].

3.5. Seasonal Variation in Microbial Community in Sludge

High-throughput sequencing has been widely adopted to analyze raw materials’ microbial community as an important biochemical characteristic. Figure 6 shows the microbial community at the genus level in raw sludge across the four seasons, and the microbial community in phylum is shown in Figure S1. Seven microbial genera—Mycobacterium, norank_f_Saprospiraceae, Ferruginibacter, Candidatus_Competibacter, Peptostreptococcus, Enterococcus, and Macellibacteroides—were consistently present throughout all seasons. The combined relative abundance of these seven genera was approximately 15% in autumn and winter, but less than 10% in spring and summer. In winter, Candidatus_Microthrix exhibited the highest relative abundance at about 8.2%, whereas it was nearly undetectable in other seasons. The top three microorganisms in spring were Proteiniclasticum, norank_f_Caldilineaceae, and norank_o_Saccharimonadales, each with a relative abundance exceeding 6%. These three genera were also present in other seasons, with norank_o_Saccharimonadales being the most abundant in autumn at 8.7%. In summer, the most prevalent microorganism was Acinetobacter, with a relative abundance reaching 9.6%, followed by norank_f_Rhodanobacteraceaeat 4.7%. Both of these microorganisms were also detected in spring and autumn, but were absent in winter sludge.

The seven microbial genera consistently present across all seasons are commonly involved in complex molecular degradation, nitrogen and phosphorus removal, and are typical inhabitants of sludge ecosystems [34,35,36]. However, the dominant type varied significantly by season. The winter-dominant Candidatus_Microthrix is often associated with sludge bulking [37]. In spring, the key genera include Proteiniclasticum [38], which is involved in protein digestion, and norank_f_Caldilineaceae [39], known for its role in phosphorus uptake under aerobic conditions. Furthermore, norank_o_Saccharimonadales, which exhibited a high relative abundance in both spring and autumn, is generally recognized for its functions in the glycolysis of glucose and phosphorus removal [40]. The summer-dominant Acinetobacter is considered capable of denitrifying phosphorus removal [41]. While the inherent microbial community structure of the raw sludge can, to some extent, reflect its biochemical characteristics, the ultimate dominant microbiota after the material is fed into the anaerobic digester is primarily shaped by a combination of the feedstock properties and the specific inoculant microbial communities within the fermenter. Therefore, the microbial community patterns described above highlight, from a microbiological perspective, the distinct characteristics of the raw feedstock across different seasons. At the same time, future studies could employ metagenomic or metatranscriptomic approaches to precisely identify the functional genes and active pathways responsible for the observed seasonal changes in sludge.

3.6. Seasonal Variation in Sludge Biochemical Methane Potential

The cumulative methane production curves for sludge from different seasons were effectively fitted using the Modified Gompertz model, with all R² values exceeding 0.99, indicating an excellent fit (

Table 1. Methane production by anaerobic digestion of sludge.

Season	Maximum Methane Production (mL/g-VS)	Maximum Methane Production Rate (mL/g-VS/d)	Methane Production Delay Time (d)	R2
Spring	342.5	60.7	0.83	0.994
Summer	279.2	46.7	0.26	0.993
Autumn	255.8	58.3	0.78	0.992
Winter	277.8	55.7	1.08	0.993

). In terms of maximum methane potential, the values for spring, summer, autumn, and winter were 342.5, 279.2, 255.8, and 277.8 mL/g-VS, respectively. The maximum methane production rates were 60.7, 46.7, 58.3, and 55.7 mL/g-VS/d for the respective seasons. Overall, spring sludge demonstrated the highest methane potential and production rate, while autumn showed the lowest potential. Interestingly, summer had the lowest production rate despite an intermediate potential. The lag phase was shortest in summer and longest in winter, suggesting faster microbial initiation in warmer weather but potentially slower adaptation in cold conditions. These findings on seasonal variability align with observations reported in previous studies [42].

To further elucidate the relationship between the characteristics of raw sludge and its anaerobic digestion performance, a Pearson correlation analysis was conducted, with the results presented in Figure 7. The BMP showed positive correlations with the organic matter (VS/TS), soluble sugars, soluble proteins, and lipid content. Among these, soluble sugars and lipids exhibited weak positive correlations with BMP, whereas soluble protein demonstrated a significant positive correlation. Conversely, cellulose content was weakly negatively correlated with BMP.

These results indicate that a higher soluble protein content significantly enhances the methane production potential. This finding aligns with the study by Li et al. [43], which reported that protein, with its higher energy density compared to carbohydrates, contributes substantially to biogas production. Furthermore, the negative correlation with cellulose suggests that a higher lignocellulosic content impedes anaerobic digestion performance, as these components are recalcitrant and more difficult to degrade compared to readily biodegradable substances like proteins and fats.

To further enhance the anaerobic fermentation performance of sludge from wastewater treatment plants, the Advanced Wet Oxidation & Steam Explosion (AWOSE) process has been proposed as a pretreatment technology [44]. While this method has demonstrated promising results at the laboratory scale and has been further validated in small-scale trials, its effectiveness under real seasonal variations remains to be fully assessed. According to the present study, sludge composition exhibits significant seasonal fluctuations—for instance, it has a higher protein content in spring—which may lead to variability in the efficiency of pretreatment technologies. Therefore, it is recommended that validation experiments include sludge samples from at least two distinct seasons when refining municipal sewage treatment technologies, in order to ensure the reliability and generalizability of the findings.

It should be noted that the anaerobic digestion performance observed in batch tests is also influenced in practical applications through factors such as hydraulic retention time, temperature, and reactor type. Therefore, studies conducted at larger scales and over longer durations are needed to better understand the characteristics and seasonal variations in sludge. The findings of this study are based solely on data from a single year and are limited to Beijing, a representative city in northern China. Further research involving multi-year monitoring across different geographical regions is recommended to establish a more accurate and generalizable profile of sludge properties. Such expanded and more comprehensive datasets would provide stronger support for optimizing sludge treatment technologies and developing robust anaerobic digestion processes.

4. Conclusions

This study investigated the seasonal variations in the characteristics of municipal sludge from a wastewater treatment plant in Beijing and assessed their impact on anaerobic digestion. The results indicated that spring sludge exhibited the highest content of organic matter, including soluble proteins, sugars, and lipids, whereas the lignocellulose content peaked in autumn. These seasonal fluctuations were primarily driven by variations in rainfall, temperature, and human activities. Significant shifts in the microbial community structure were observed: Proteiniclasticum and other hydrolytic bacteria were dominant in spring, while Candidatus_Microthrix was notably enriched in winter. Accordingly, the BMP was highest in spring (342.5 mL/g-VS) and lowest in autumn. A significant positive correlation was identified between BMP and soluble protein content, whereas a weak negative correlation was found with cellulose content. These findings provide crucial data support for the seasonal regulation of sludge anaerobic digestion systems. To achieve stable biogas production year-round, it is recommended to adjust operational strategies during summer and autumn, such as increasing the sludge feeding rate, supplementing with high-organic-content sludge, or optimizing pretreatment processes.