Next Article in Journal
Assessment of Characteristic Flavor and Taste Quality of Sugarcane Wine Fermented with Different Cultivars of Sugarcane
Next Article in Special Issue
Retinal Production by Precision Fermentation of Saccharomyces cerevisiae
Previous Article in Journal
Cellulose Nanofibers as Rheological Modifiers to Improve Biomass Slurry Processing and Fermentation
Previous Article in Special Issue
Effects of Eurotium cristatum Fermentation on Tartary Buckwheat Leaf Tea: Sensory Analysis, Volatile Compounds, Non-Volatile Profile and Antioxidant Activity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Enhancement of the Degradation of Phytosterol Side Chains in Mycolicibacterium by Eliminating the Redox Sensitivity of Key Thiolase and Augmenting Cell Activity

1
School of Pharmaceutical Sciences and Food Engineering, Liaocheng University, Liaocheng 252059, China
2
College of Agriculture and Biology, Liaocheng University, Liaocheng 252059, China
*
Author to whom correspondence should be addressed.
Fermentation 2024, 10(12), 627; https://doi.org/10.3390/fermentation10120627
Submission received: 30 October 2024 / Revised: 2 December 2024 / Accepted: 6 December 2024 / Published: 8 December 2024

Abstract

Androstenedione (AD) is a vital intermediate in the synthesis of steroid drugs, making its efficient production critical in the steroid drug industry. Acetyl-CoA acetyltransferase (FadA5), a thiolase enzyme, plays an important role in the metabolic process of degrading phytosterol side chains in Mycolicibacterium to produce AD. This work is the first systematic analysis of the role of FadA5 in the transformation of phytosterols by Mycolicibacterium to produce AD. The relationship between redox potential and AD production was examined using resting cells, and it was confirmed that FadA5 is a key enzyme for AD production. Mutating the 87th cysteine of FadA5 to alanine reduced its redox effect, enhancing the substrate tolerance and biotransformation capacity of the strain. Co-expressing Vitreoscilla hemoglobin (VHb) and propionyl-CoA metabolized the transcription activator (PrpR), decreased intracellular reactive oxygen species levels, and improved cell viability. The AD yield of MSP-fA5C87A-VP/ΔfA5 was 2.541 g/L, an increase of 16.83% over the control strain. Using a repeated batch fermentation process, the production efficiency of the MSP-fA5C87A-VP/ΔfA5 strain was 0.658 g/L/d, which was 1.82 times higher than that of the control strain. These findings provide a theoretical basis for understanding and regulating steroid side-chain catabolism in Mycolicibacterium and offer support for the rational modification of industrial strains for steroidal drug precursor production.

1. Introduction

Steroids are terpenoid lipids widely distributed in plants, animals, and microorganisms [1]. In the pharmaceutical field, steroids have evolved into the second largest class of drugs after antibiotics and offer a range of therapeutic applications, including inhibition of inflammatory responses and viral replication, alleviation of allergies and asthma, treatment of rheumatoid arthritis and some forms of cancer, and regulation of hormone levels and blood pressure [2,3]. Steroid drugs have become clinically necessary, and the preparation of steroid drug precursors is the key to restricting their production [4]. The preparation method for steroid drug precursors has changed from chemical synthesis to microbial transformation with phytosterol as a substrate, which effectively solves the problems of raw material shortage and environmental pollution [5]. Androstenedione (4-androstene-3,17-dione, AD) is an important intermediate for the preparation of steroidal drugs, and its low cost and efficient production are of great significance to the development of the steroidal drug industry. Mycolicibacterium (previously known as Mycobacterium) is one of the few strains that can be used to produce AD on an industrial scale [6,7]. Mycolicibacterium is a Gram-positive bacterium with high G+C. Unlike Mycobacterium tuberculosis, which is highly virulent and highly harmful, Mycolicibacterium is a typical non-pathogenic, fast-growing strain and does not have the ability to produce spores [8,9]. Although the metabolic process of PS side-chain degradation by Mycolicibacterium has not been fully analyzed, the hypothetical metabolic process shown in Figure 1 has been obtained through the results of many studies [1,10,11,12].
The process of converting phytosterols (PSs) into AD by Mycolicibacterium is mainly the metabolic process of PS side-chain degradation, similar to fatty acid β oxidation (Figure 1). After Mycolicibacterium transports phytosterols into cells via the mycobacterial cell entry transport system 4 (Mce4) [11], the enzyme 3beta-hydroxysteroid dehydrogenase (3beta-HSD) or cholesterol oxidase (ChOx) converts cholesterol to cholest-4-en-3-one [13,14]. The steroid C-26 monooxygenase (CYP125, CYP124, CYP142) oxidizes cholestenone to 3-oxo-cholest-4-en-26-acid [15]. It enters beta oxidation after esterification to 3-oxo-chol-4-ene-26-acyl-CoA (3-OCS-CoA) via acyl-CoA ligase (FadD19) [16]. Three rounds of beta oxidation are mainly completed using five types of enzymes. Acyl-CoA dehydrogenases (FadE26- FadE27) catalyze the dehydrogenation reaction to form a double bond between Cα and Cβ. Alkenoyl-CoA hydratases (EchA19) catalyze the hydration reaction of unsaturated alkenoyl-CoA. Further oxidation is facilitated by β-hydroxyacyl-CoA dehydrogenase (Hsd4A) [1]. The 3-ketoacyl-CoA thiolase (FadA5) and steroid side-chain cleavage aldolase (Ltp) are responsible for the C-C bond cleavage reaction. After three rounds of class β oxidation, the side-chain degradation of PSs is completed, producing AD and releasing one molecule of acetyl-CoA and three molecules of propionyl-CoA [17]. Most endotoxic propionyl-CoA is converted into succinyl-CoA through the methyl citrate metabolism pathway (MCC) and methylmalonyl pathway (MMC), and succinate enters the tricarboxylic acid cycle for productive metabolism [18].
The key thiolase associated with cholesterol side-chain degradation in M. tuberculosis H37Rv is identified as FadA5 [11,19,20,21]. In the first round of beta oxidation, FadA5 catalyzes the thiocleavage of 3,24-dioxocholest-4-en-26-oyl-CoA to produce 3-oxochol-4-en-24-oyl-CoA and propionyl-CoA. In the second round of beta oxidation, FadA5 catalyzes the thiolysis of 3,22-dioxochol-4-en-24-oyl-CoA to 3-oxo-23,24-bis norchol-4-en-22-oyl-CoA and one acetyl-CoA. The deletion of FadA5 in Mycolicibacterium not only significantly reduces the production of AD but also alters the degradation pathway of phytosterol side chains and brings about complex product changes [12,22,23]. Therefore, FadA5 plays an important role in the pathway of degrading PS side chains to accumulate AD. The crystal structure analysis of FadA5 of M. tuberculosis shows that amino acid residues C93, Q177, R221, T224, A242, G243, S246, H347, C377, etc., constitute the active center of FadA5 [11]. C93 is a thiolytic nucleophile, and C377 is a universal acid catalyst for cleavage of β-ketoacyl-CoA substrates. The catalysis of β-ketoacyl-CoA by FadA5 follows a ping-pong mechanism. When FadA5 undergoes catalytic reaction, C93 at the active center undergoes nucleophilic addition reaction to the β-keto group of β-ketoacyl-CoA, forming acyl-cysteine intermediates after elimination of acetyl-CoA. The intermediates are in turn attacked by the newly bound CoA, regenerating free cysteine and forming acyl-CoA shortened by two carbon atoms. If β-ketoacyl-CoA carries a methyl group on the α-carbon, propionyl-CoA is produced instead of acetyl-CoA. Therefore, C93 and C377 are key amino acid residues for the catalytic function of FadA5 [11,24]. The study by Lu et al. showed that FadA5 activity is regulated by the redox state within macrophages. The midpoint potential of FadA5 is −223 mV. In a reducing environment (below −240 mV), the activity of FadA5 is enhanced, which promotes the oxidation of cholesterol side chains. In an oxidative environment (above −223 mV), the activity of FadA5 decreases significantly, and the activity of FadA5 is completely lost above −223 mV. Therefore, FadA5 regulates cholesterol side-chain degradation via a change in enzyme activity in response to environmental changes [25]. This redox control of catalytic activity is achieved through the formation of reversible disulfide bonds between C59-C91 and C93-C377 in FadA5. Using the C91A mutant to block the formation of C59-C91 disulfide bonds, the activity of the C91A mutant does not change when the reduction potential is raised from −320 mV to −225. When it rises to −202 mV, the catalytic activity decreases by about 30%. Even at −180 mV, the C91A mutant remains catalytically active. The mutation of C91 to Ala not only eliminates the formation of C91-C59 disulfide bonds but also prevents the oxidation of important active site residues C93 and C377 [11]. Alignment analysis of FadA5 amino acid sequences of various mycobacteria showed that the amino acid residues of key active sites of FadA5 such as Cys93, Cys377, and His347 of different strains are conserved, and their roles in sterol side-chain degradation are speculated to also be conserved [26].
In this work, we systematically studied the role of FadA5 in the transformation of phytosterols by Mycolicibacterium to synthesize AD for the first time. On this basis, we attempted to weaken the effect of redox on FadA5 activity through enzyme modification and overexpression. We used Vitreoscilla hemoglobin (VHb) and the transcription factor PrpR to improve the intracellular environment and enhance cell viability. Finally, AD was efficiently produced via repeated batch fermentation. The findings contribute to the understanding of the complexity and diversity associated with the regulation of steroid side-chain catabolism of Mycolicibacterium, providing a theoretical basis for the rational engineering of strains for the industrial production of steroid drug precursors.

2. Materials and Methods

2.1. Strains, Plasmids, and Cultivation Conditions

The strains, plasmids, and primers used in the present study are listed in Table 1. M. sp. LZ2 (MSP) was used as the wild-type strain. E. coli DH5α was used to construct the plasmid and cultured in LB medium at 37 °C with antibiotics added as required for plasmid resistance. The FadA5 and PrpR genes were amplified from the MSP genome. The codon-optimized VHb gene was artificially synthesized as in previous studies [27]. The pMV261 plasmid was used to overexpress the target genes. The suitable concentration of kanamycin was 50 µg/mL. The p2NIL and pGOAL19 plasmids were used for knockout of the FadA5 gene. Seed preparation, batch fermentation, and repeat batch fermentation experiments were performed as previously described [27,28]. For resting cell transformation, the seeds were inoculated into 50 mL of fermentation medium containing 2 g/L phytosterol, and after 72 h of culture, the cells were collected at 4 °C and 8000 rpm and washed three times with 0.1 M, pH 7.0 phosphate buffer to obtain wet cells. Resting cell transformation was carried out in 250 mL flasks containing 3 g/L phytosterol, 50 g/L cells, and 80 g/L hydroxypropyl-β-cyclodextrin. To obtain the fixed initial redox potential, K3Fe(CN)6 and Na2S7·H2O were used as an oxidant and a reducing agent, respectively, to adjust the redox potential of the fermentation broth to the required level.

2.2. Construction of Mutant Strains

Gene overexpression, deletion, and mutation gene replacement methods were performed as described in previous studies [29,30]. The recombinant plasmid pMV261-fA5 was obtained by inserting fadA5 amplified from the MSP genome into pMV261 using the In-Fusion HD Cloning method. The recombinant strain MSP-fA5 was constructed by transferring pMV261-fA5 into MSP via electroporation. The pMV261 plasmid was introduced into MSP to construct the control recombinant bacterium MSP-26. The FadA5 knockout strain was constructed with allelic homologous recombination [30,31]. Using the MSP genome as the template, the upstream (1188 bp) and downstream (1044 bp) homology arm fragments of the FadA5 gene were amplified and ligated to plasmid p2NIL. The p2NIL and pGOAL19 plasmids containing homology arms were digested separately with the PacI enzyme. A recombinant plasmid p2G19-fA5 was constructed by ligating a p2NIL containing a homology arm with a pGOAL19 fragment with a selectable marker cassette. Then, NaOH-injured p2G19-fA5 was transferred into competent MSP cells through electroporation, and single exchange clones (SCOs) were screened using plates containing 50 μg/mL Hyg, 50 μg/mL Kan, and 50 μg/mL X-gal. After SCOs were passaged 2–3 times in LB medium, positive clones were screened using plates containing 2% sucrose and 50 μg/mL Kan and 50 μg/mL X-gal, and the FadA5 knockout strain MSPΔfA5 was finally obtained. The fadA5 supplementary strain MSPΔfA5::fA5 was constructed by electroporating the plasmid pMV261-fA5 into MSPΔfA5. The whole-plasmid PCR method was used to obtain the plasmid pMV261-fA5C87A for the C87A point mutation of FadA5 using pMV261-fA5 as a template and point mutation primers. The construction method for the allelic replacement strain of the FadA5 mutant gene was similar to that of MSPΔfA5, with the main difference being that the plasmid used was the knockout plasmid p2G19-fA5C87A containing the FadA5 mutant gene fA5C87A. The recombinant strains MSP-fA5C87A and MSP-fA5C87A/ΔfA5 were constructed via electroporation into MSP and MSPΔfA5, and pMV261-fA5C87A and p2G19-fA5C87A were transformed into MSP and MSPΔfA5, respectively, to construct the recombinant strains MSP-fA5C87A and MSP-fA5C87A/ΔfA5. The vgb and prpR fragments were amplified from the pMV261-vgb plasmid and MSP genome, respectively, and ligated into pMV261 using In-Fusion HD Cloning to construct the co-expression plasmid pMV261-VP of vgb and prpR. The recombinant strain MSP-fA5C87A-VP/ΔfA5 was obtained with electroporation of pMV261-VP into MSP-fA5C87A/ΔfA5.

2.3. Determination and Analytical Methods

2.3.1. Biomass and AD Yield Determination

Cell dry weight (DCW) was determined indirectly by detecting the total cell protein with reference to a previous assay method [32]. Total cell protein was released from the bacterial samples obtained at different time points using sodium hydroxide. After adjusting the pH to neutral, the absorbance values of the samples at 230 and 260 nm were measured to determine the protein concentration, and the corresponding DCW values were calculated using the calibration curves of DCW and protein. AD in the fermentation broth sample was extracted with ethyl acetate, and the AD yield was detected via HPLC using a reversed-phase C18 column (4.6 mm × 250 mm, 5 μm) at 30 °C with 80% methanol aqueous solution as the mobile phase at a flow rate of 1 mL/min. The detection wavelength was 254 nm. The yield of AD was calculated as follows: conversion ratio% of AD = (CAD/MAD)/(CP/MP) × 100%, where CAD and CP are the concentrations (g/L) of the products AD and PS, and MAD and MP are the molar masses of AD and PSs, respectively.

2.3.2. Intracellular Reactive Oxygen Species (ROS) and Cell Viability Assay

The generation of intracellular ROS was determined using the fluorescent probe 2′,7′-dichlorofluorescein diacetate (DCFH-DA) detection method [33]. The sampled cells were diluted with PBS buffer to an OD600 of 0.6, and the final concentration of the DCFH-DA stock solution was 10 μM. The mixture was incubated at 30 °C for 30 min, washed twice with phosphate-buffered saline (PBS), and resuspended. The fluorescence intensity was measured with an excitation wavelength of 502 nm and an emission wavelength of 525 nm. The fold-change values for the other samples were calculated based on the fluorescence intensity of MSP-fA5C87A/ΔfA5 at 24 h.
Cell viability assays were performed using a previously reported modified CCK-8 method [29]. The specific steps were as follows: After adjusting the OD600 value of the sample to 1 using Tris-HCl buffer pH 7.2, the bacterial solution and WST-8 solution were mixed at a ratio of 19:1 and incubated at 30 °C for 1 h, and absorbance was determined at 450 nm. Using an equal volume of cell-free culture medium and the WST-8 mixture as a blank control, the corrected OD450 value was used as the cell viability value.

3. Results and Discussion

3.1. FadA5 Is a Key Enzyme in AD Synthesis

Previous studies have confirmed that FadA5 (Rv3546: fadA5) is a key factor for the survival of M. tuberculosis in vivo [21]. Through sequence alignment, a putative FadA5 was found in MSP, and a phylogenetic tree of FadA5 was constructed (Figure 2a). The topology of the evolutionary tree showed that MSP formed a close branch with M. neoaurum ATCC 25795, M. neoaurum VKM Ac-1815D, and M. smegmatis, reflecting their close affinity. M. tuberculosis H37Rv, M. orygis, and M. marinum form another independent branch. The fast-growing strain represented by M. smegmatis and the slow-growing strain represented by M. tuberculosis H37Rv formed distinct branches, reflecting the functional adaptation of FadA5 protein in strains with different growth rates.
Sequence alignment analysis of MSPFadA5 with other thiolases showed that the catalytic residues were conserved in Mycolicibacterium (Figure 2b). Referring to the structure of FadA5 from M. tuberculosis H37Rv, C89, which is located at the catalytic center in MSPFadA5, is a nucleophile, and C373 and H343 act as general acid/base residues. When the redox potential is lower than the threshold value, reversible disulfide bonds are formed between C55-C87 and C89-C373 to reduce enzyme activity [25].
To determine the role of putative FadA5 in the degradation of phytosterol side chains in MSP, we deleted an 804 bp fragment of the FadA5-encoding gene from the genome of MSP to obtain the FadA5 gene knockout strain MSPΔfA5. The FadA5-overexpressing strains MSP-fA5 and MSPΔfA5 and the makeup strain MSPΔfA5::fA5 were subjected to phytosterol transformation experiments and compared with the control strain MSP-261 containing empty plasmids. The four strains had similar growth trends at 0–48 h. At this stage, the strains mainly used glucose as a substrate and had weak functional requirements for FadA5 [27]. After 48 h, the growth of MSPΔfA5 was significantly lower than that of other strains and showed a decreasing trend after 120 h. The growth of supplement bacteria MSP ΔfA5::fA5 recovered but did not reach the growth level of MSP-261. The MSP-fA5 strain had the highest amount of biomass (Figure 3a). The results showed that the deletion of the fadA5 gene affected the growth of the strain.
The AD yield of all strains increased with the culture time. However, we observed significant differences among strains with different genotypes. The MSP-fA5 strain exhibited the highest AD yield throughout the cultivation process, which was consistent with its higher biomass. By contrast, the MSPΔfA5 strain had no significant yield before 72 h, and the highest yield at 144 h was 0.361 g/L, which was only 17% of that of MSP-261. The AD yield of the complementary strain MSPΔfA5::fA5 was close to that of the control strain MSP-261, indicating that FadA5 plays an important role in AD production. However, judging from the amount of AD produced by the MSPΔfA5 strain, FadA5 knockdown did not completely block the AD pathway, which is consistent with previous studies. Lu et al. reviewed M. fortuitum and found that the knockdown of the Hsd4A and FadA5 genes can significantly reduce the accumulation of AD, but a small amount of AD is still generated [34]. Deletion of neither the 17β-hydroxysteroid dehydrogenase (Hsd4A) gene nor the FadA5 gene alone or in combination in M. neoaurum DSM 44074 abrogated the production of AD [7]. A study on Rhodococcus rhodochrous DSM 43269 found that the deletion of the FadA5 gene has no significant effect on the sterol side-chain degradation of the strain [35]. In their study of a short-chain dehydrogenase (Hsd4A) of M. neoaurum ATCC 25795, Xu et al. found that deletion of the Hsd4A gene resulted in the production of 23,24-bischolesterol (HBC). It is proposed that there are two competitive pathways for the degradation of phytosterol side chains: the AD pathway and the HBC pathway. The branching point of the two pathways is 22-hydroxy-3-oxo-25,26-bisnorchol-4-en-24-oyl CoA (22OHBNC-CoA), which may be produced by aldol-lyase (Ltp) and acyl-CoA synthetases to form 3-oxo-22,23-bisnorchol-4-ene-22-oyl-CoA (OBNC22-CoA). Re-entering the AD pathway generates AD [23]. A recent study by Song et al. showed the existence of circulating pathways in M. neoaurum HGMS2 capable of regulating the accumulation of C19 and C22 sterol intermediates [22]. In this mode, 22OHBNC-CoA can generate AD without the action of FadA5. 22OHBNC-CoA can be hydrolyzed in one step by aldolase (Sal) to (20S)-3-oxopregn-4-ene-20-carboxaldehyde (3-OPA) or in two steps by aldol-lyase (Ltp1) and aldolase (DmpG) to 3-OPA. 3-OPA is converted to 3-OPC-CoA by aldehyde dehydrogenase (HsaG) or aldolase (DmpF) enzymes and returned to the AD pathway.
In addition, an increased yield of 22-hydroxy-23,24-bisnorchol-4-ene-3-one (BA or 4-HP or 4-HBC) was found in the product of MSPΔfA5, which was consistent with previous reports [12,23]. The deletion of FadA5 in Mycolicibacterium results in complex product changes. After knockout of the fadA5 gene in Mycobacterium neoaurum NwIB-XII, 22-hydroxy-23,24-bisnorchol-4-ene-3-one (4-HBC) and 22-hydroxy-23,24-bisnorchol-1,4-dien-3-one (1,4-HBC) appeared in the metabolites [23]. In M. fortuitum, after knocking out the FadA5 gene, the yield and proportion of 9-OHBA peaked [26]. Knockout of the fadA5 gene in M. neoaurum HGMS2 promotes the accumulation of 4-HBC in the strain, which is accompanied by the emergence of new metabolites [22]. When both hsd4A and fadA5 genes are knocked out in M. neoaurum DSM 44074, the proportion of product 9-hydroxy-androst-4ene-3,17-dione (9-OH-AD) decreases from 4.07% to 0.90%, whereas the proportion of target product 9,21-dihydroxy-20-methyl-pregna-4-en-3-one (9-OH-4-HP) increases from 81.47% to 95.13% [12]. Therefore, FadA5 plays an important role in the pathway of degrading PS side chains to accumulate AD. The possible generation mechanism of 4-HBC is the knockdown of fadA5 leading to the accumulation of 22OBNC-CoA, which Hsd4A reduces to 22-hydroxy-3-oxo-25,26-bisnorchol-4-en-24-oyl CoA (22HOBNC-CoA) via a reverse reaction; when 22HOBNC-CoA is accumulated, Ltp3-4 or other aldolase enzymes may be activated, performing an aldol reaction to promote the formation of 4-HBC (Figure 1) [1,23]. Simultaneously, excessive intracellular reducing power can prevent further oxidation of 4-BNC. Moreover, 4-BNC is not a suitable substrate for dehydrogenases such as FadE28-29 [36]. The metabolism of phytosterols after knockout of the FadA5 gene was dominated by the HBC pathway.

3.2. MSP Phytosterol Metabolism Is Affected by Redox Potential

FadA5 is a key enzyme for Mycolicibacterium in the conversion of phytosterols to produce AD. Although its overexpression can enhance the strain’s AD production performance, its improvement range is limited compared with those of other key enzymes (such as cholesterol oxidases [14], cytochrome p450 125 [37], and dual role reductase) [26]. Similar results were also reported by Xiong et al. [38]. A similar redox mechanism is believed to exist in MSP, and FadA5 forms reversible disulfide bonds in an oxidizing environment to reduce enzyme activity [25,26]. We studied the transformation of phytosterols by resting cells at different redox potentials (ORPs) to examine whether MSP is affected by the redox state in the process of transforming phytosterols. As shown in Figure 4a, the AD yield showed an upward trend under all conditions with the extension of transformation time. However, we noted differences in yield growth rates and final yields under different ORP conditions. The AD yield gradually increased as the ORP decreased. At the ORP of −300 mV, the AD yield was the highest, reaching 2.023 g/L. However, the yield was the lowest (only 1.649 g/L) at the ORP of −150 mV. Thus, a high ORP has a significant effect on the AD production of MSP strains.

3.3. FadA5 Modification Can Improve the Adaptability of Strains to Oxidation and Reduction

The redox homeostasis of microbial cells is closely related to their growth and metabolism, and it is also an important factor in triggering cellular stress responses [39,40]. To weaken the effect of the redox state on MSPFadA5, we used the point mutation technique to mutate cysteine at position 87 of MSPFadA5 to alanine to prevent MSPFadA5 from forming disulfide bonds in the oxidation state. Overexpressing strains MSP-fA5C87A and MSP-fA5C87A/ΔfA5 containing the mutant FadA5 were constructed in MSP and MSPΔfA5, respectively. The AD production of MSP-fA5, MSP-fA5C87A, and MSP-fA5C87A/ΔfA5 resting cells was examined at two ORPs of −150 and −300. As shown in Figure 4b, the AD yield of MSP-fA5C87A/ΔfA5 was higher than that of MSP-fA5 and MSP-fA5C87A at −150 mV at all time points. The highest yield of MSP-fA5C87A/ΔfA5 was 1.828 g/L, which was 1.435 and 1.158 times higher than that of MSP-fA5 and MSP-fA5C87A, respectively. AD production was generally elevated for the three strains at −300 mV. The highest yield of MSP-fA5C87A/ΔfA5 was further increased to 2.018 g/L, and the highest yields of MSP-fA5 and MSP-fA5C87A were 1.845 and 1.910 g/L, respectively. Thus, the MSP-fA5C87A/ΔfA5 strain showed good AD production performance under both redox potential conditions. MSP-fA5C87A/ΔfA5 had better adaptability than MSP-fA5 and MSP-fA5C87A in a high-redox environment.
In addition, the changes in cell dry weight of MSP-fA5, MSP-fA5C87A, and MSP-fA5C87A/ΔfA5 were detected at different redox potentials. As shown in Figure 4c, during the transformation process, the cell dry weight of the three strains showed an overall downward trend, and the decrease in MSP-fA5 was the most significant at −150 mV. The remaining amount of biomass was only 83.62% after 20 h of transformation. The decrease trend of biomass in the three strains was more obvious at −150 mV compared with −300 mV. MSP-fA5C87A/ΔfA5 exhibited the highest biomass residual rates at both −150 mV and −300 mV. The bacterial cells are in a non-growing state during resting transformation, and the energy to maintain the activity of the strain is mainly derived from the energy produced by the degradation of the PS side chain. The inhibition of FadA5 activity at −150 mV leads to a decrease in PS side-chain degradation efficiency. Therefore, with the prolongation of transformation time, the phenomenon of MSP-fA5 cell decline was more obvious at −150 mV.

3.4. Evaluation of Production Performance of MSP-fA5C87A/ΔfA5

To evaluate the potential of MSP-fA5C87A/ΔfA5 to convert phytosterols to AD, we fermentatively cultured the strain MSP-fA5C87A/ΔfA5 in fermentation medium containing different concentrations of phytosterols, with MSP-261 as a control. As shown in Figure 5a, MSP-fA5C87A/ΔfA5 exhibited high AD yields at each substrate concentration. The yields of MSP-fA5C87A/ΔfA5 and MSP-261 were not significantly different at a low substrate concentration (5 g/L). However, when the concentration of phytosterol exceeded 10 g/L, the AD conversion rate of the two strains decreased significantly, which may be due to the strong inhibitory effect of a high substrate concentration on the bacteria [7,26,34]. The yield of MSP-fA5C87A/ΔfA5 at a high concentration of 20 g/L was 6.655 g/L, which was about 23.49% higher than that of the MSP-261 strain. The AD conversion rates of the two strains were 48.181% and 39.015%, respectively. The results showed that the MSP-fA5C87A/ΔfA5 strain had strong substrate tolerance and transformation ability at a high substrate concentration. Figure 5b shows the changes in cell viability of the Msp-261 and MSP-fΔ5C87A/ΔfA5 strains at different substrate concentrations. The cell viability of both strains showed a decreasing trend with the increase in substrate concentration. The slope (k) of the linear fit to the cell viability values could reflect the increasing trend of ROS. The k values for MSP-261 and MSP-fΔ5C87A/ΔfA5 were −0.053 and −0.067, respectively. These results suggested that the cell viability of MSP-fΔ5C87A/ΔfA5 was impaired to a greater extent with the increase in substrate concentration. The mutation and enhancement of MSPFadA5 in MSP-fA5C87A/ΔfA5 enhanced the degradation of phytosterol side chains, thereby producing excessive reactive oxygen species (ROS) and propionyl-CoA and resulting in a decrease in cell viability [29,33].

3.5. Co-Expression of VHb and PrpR Enhances AD Production Performance of MSP-fA5C87A/ΔfA5

FAD is the coenzyme involved in the degradation of plant sterol side chains, and the reoxidation of FAD reduces oxygen to H2O2 [33,41]. Furthermore, enhancement of side-chain degradation produces large amounts of propionyl-CoA. Excessive accumulation of propionyl-CoA has toxic effects, and its further metabolism leads to ROS production [4,33]. Previous studies have confirmed that excessive accumulation of intracellular ROS and propionyl-CoA can produce toxic effects on strains, affecting transformation performance [29]. Controlling intracellular ROS levels and enhancing propionyl-CoA metabolism are feasible strategies to improve the transformation ability of Mycolicibacterium [27,28,33]. To further enhance the production capacity of MSP-fA5C87A/ΔfA5, we co-expressed hemoglobin VHb from Vitreoscilla and the transcriptional activator PrpR of propionyl-CoA metabolism in the MSP-fA5C87A/ΔfA5 strain. The ROS content and strain viability of MSP-fA5C87A-VP/ΔfA5 during AD production were tested. As shown in Figure 6a, the ROS levels of the three strains increased with the prolongation of fermentation time. At the end of fermentation, the ROS levels of MSP-261, MSP-fA5C87A/ΔfA5, and MSP-fA5C87A-VP/ΔfA5 increased by 4.123, 5.344, and 6.126 times, respectively. The ROS level of MSP-fA5C87A-VP/ΔfA5 was only 66% of that of MSP-261. The slope (k) obtained via linear fitting of the ROS values reflected the increasing trend of ROS. The order of k values was k2 > k1 > k3, indicating that the ROS increase trend of MSP-fA5C87A-VP/ΔfA5 was the smallest. VHb has been shown to have catalase activity [27]. The low intracellular ROS levels and increasing tendency of MSP-fA5C87A-VP/ΔfA5 may be related to the catalase activity of VHb. Cell viability of MSP-fA5C87A/ΔfA5 and MSP-fA5C87A-VP/ΔfA5 was monitored using MSP-261 as a control, and the effect of the co-expression of VHb and PrpR on cell viability was studied. As shown in Figure 6b, MSP-fA5C87A-VP/ΔfA5 consistently had the highest cell viability throughout the fermentation process. In the first 96 h, the cell viability of the three strains continued to increase, and the cell viability of MSP-fA5C87A-VP/ΔfA5 reached a maximum value of 1.589 at 96 h, which was 1.13 times that of MSP-fA5C87A/ΔfA5 (1.394). After 96 h, the cell viability of the three strains showed a downward trend. At the end of fermentation, the cell viability of MSP-fA5C87A-VP/ΔfA5 was 1.029, which was 1.352 and 1.245 times higher than that of MSP-261 and MSP-fA5C87A/ΔfA5, respectively.

3.6. Conversion of Phytosterols Through Repeated Batch Fermentation

The AD production performance of MSP-fA5C87A/ΔfA5 and MSP-fA5C87A-VP/ΔfA5 was evaluated, with MSP-621 as a control. As shown in Figure 6c, the yield of MSP-fA5C87A-VP/ΔfA5 was consistently higher than that of the two other bacteria and reached the highest value of 2.541 g/L at 144 h, which was 16.83% and 7.81% higher than that of MSP-261 (2.175 g/L) and MSP-fA5C87A/ΔfA5 (2.357 g/L), respectively. The co-expression of VHb and PrpR could therefore effectively improve the production performance of the strain. Previous studies have shown that enhancing the cell viability of mycobacteria is a prerequisite for achieving repeated batch fermentation [27]. Repeated batch fermentation studies were carried out in view of the high cell viability and AD production performance of MSP-fA5C87A-VP/ΔfA5. In repeat batch fermentation, eight batches of fermentation were performed. As shown in Figure 6d, the AD yield showed an upward trend in the first five batches and gradually decreased after the sixth batch. In the first batch, the AD yield was 1.855 g/L, whereas the fifth batch reached the highest value of 2.236 g/L. The AD yield subsequently decreased to 2.187 g/L in the sixth batch and decreased to 1.905 g/L in the eighth batch. Similar to the change trend of AD yield, cell viability gradually increased in the first five batches and began to decrease in the sixth batch. Specifically, cell viability increased from 1.565 in the first batch to 1.702 in the fourth batch and decreased to 1.422 in the eighth batch. The average yield of repeated fermentation of MSP-fA5C87A-VP/ΔfA5 was 2.058 g/L, and the total production efficiency was 0.658 g/(L·day), which was 81.27% higher than that of single batch fermentation of MSP-621 (0.363 g/(L·day)).
Previous studies showed that M. neoaurum TCCC 11978 (MNR) was able to run only three batches of repeated batch fermentation at a substrate level of 5 g/L, and high levels of ROS were the main reason that affected cell viability and led to reduced AD productivity [28]. The overexpression of PrpR in MNR can improve the metabolic ability of the strain to propionyl-CoA, thus reducing the toxic effect of propionyl-CoA and improving cell viability [29]. The co-expression of VHb and sterol transporter ATPase (MceG) in MNR can improve the growth and adaptation of bacteria to dissolved oxygen. The Catalase activity possessed by VHb slowed down the production of intracellular ROS and the decline of cell viability, which enabled the recombinant bacteria to perform repeat batch fermentation [27]. MSP-fA5C87A-VP/ΔfA5 also exhibited low rates of ROS production, cell viability decline, and excellent transformation performance at high substrate concentrations. Therefore, MSP-fA5C87A-VP/ΔfA5 showed good production potential for phytosterol transformation.

4. Conclusions

In this study, we systematically explored the role of FadA5 in the transformation of phytosterols by Mycolicibacterium to synthesize AD for the first time. The effect of redox on MSPFadA5 was attenuated by site-directed mutagenesis, and the intracellular environment was optimized with VHb and the transcription factor PrpR to improve cell viability. Efficient production of AD was finally achieved through repeated batch fermentation. The results contribute to an in-depth understanding of the complexity and diversity related to the regulation of steroid side-chain catabolism of Mycolicibacterium as well as provide a theoretical basis for the rational engineering of industrial production strains of steroid drug precursors.

Author Contributions

Conceptualization, X.Z., H.X. and Y.Z.; formal analysis, F.L. and Y.Z.; funding acquisition, X.Z.; investigation, X.Z., F.L., Y.L., Y.H. and Y.Z.; methodology, F.L. and Y.Z.; project administration, Yang Zhang; resources, X.Z. and Y.Z.; software, X.Z. and Y.Z.; supervision, Y.Z.; validation, F.L.; visualization, X.Z. and Y.Z.; writing—original draft, X.Z., F.L., Y.L., Y.H. and Y.Z.; writing—review and editing, X.Z., Y.L., H.X. and YZ. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32100065 and 32300031), the Natural Science Foundation of Shandong Province of China (ZR2023MB095), the Shandong Province Youth Entrepreneurship Technology Support Program for Higher Education Institutions (2023KJ207), and the Taishan Scholar Foundation of Shandong Province (NO. tsqn202211172).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zhao, A.; Zhang, X.; Li, Y.; Wang, Z.; Lv, Y.; Liu, J.; Alam, M.A.; Xiong, W.; Xu, J. Mycolicibacterium Cell Factory for the Production of Steroid-Based Drug Intermediates. Biotechnol. Adv. 2021, 53, 107860. [Google Scholar] [CrossRef] [PubMed]
  2. Song, L.; Ke, J.; Luo, Z.-K.; Xiong, L.-B.; Dong, Y.-G.; Wei, D.-Z.; Wang, F.-Q. Driving the Conversion of Phytosterol to 9α-Hydroxy-4-Androstene-3,17-Dione in Mycolicibacterium Neoaurum by Engineering the Supply and Regeneration of Flavin Adenine Dinucleotide. Biotechnol. Biofuels 2023, 16, 98. [Google Scholar] [CrossRef] [PubMed]
  3. Ke, X.; Cui, J.-H.; Ren, Q.-J.; Zheng, T.; Wang, X.-X.; Liu, Z.-Q.; Zheng, Y.-G. Rerouting Phytosterol Degradation Pathway for Directed Androst-1,4-Diene-3,17-Dione Microbial Bioconversion. Appl. Microbiol. Biotechnol. 2024, 108, 186. [Google Scholar] [CrossRef] [PubMed]
  4. Zhang, Y.; Xiao, P.; Pan, D.; Zhou, X. New Insights into the Modification of the Non-Core Metabolic Pathway of Steroids in Mycolicibacterium and the Application of Fermentation Biotechnology in C-19 Steroid Production. Int. J. Mol. Sci. 2023, 24, 5236. [Google Scholar] [CrossRef] [PubMed]
  5. Su, Z.; Zhang, Z.; Yu, J.; Yuan, C.; Shen, Y.; Wang, J.; Su, L.; Wang, M. Combined Enhancement of the Propionyl-CoA Metabolic Pathway for Efficient Androstenedione Production in Mycolicibacterium neoaurum. Microb. Cell Factories 2022, 21, 218. [Google Scholar] [CrossRef]
  6. Fernández-Cabezón, L.; Galán, B.; García, J.L. New Insights on Steroid Biotechnology. Front. Microbiol. 2018, 9, 958. [Google Scholar] [CrossRef]
  7. Yuan, C.; Ma, Z.; Li, Y.; Zhang, J.; Liu, X.; Han, S.; Du, G.; Shi, J.; Sun, J.; Zhang, B. Production of 21-Hydroxy-20-Methyl-Pregna-1,4-Dien-3-One by Modifying Multiple Genes in Mycolicibacterium. Appl. Microbiol. Biotechnol. 2023, 107, 1563–1574. [Google Scholar] [CrossRef]
  8. Hansen, J.; Kolbe, K.; König, I.R.; Scherließ, R.; Hellfritzsch, M.; Malm, S.; Müller-Loennies, S.; Zallet, J.; Hillemann, D.; Wiesmüller, K.-H.; et al. Lipobiotin-Capture Magnetic Bead Assay for Isolation, Enrichment and Detection of Mycobacterium Tuberculosis from Saliva. PLoS ONE. 2022, 17, e0265554. [Google Scholar] [CrossRef]
  9. Traag, B.A.; Driks, A.; Stragier, P.; Bitter, W.; Broussard, G.; Hatfull, G.; Chu, F.; Adams, K.N.; Ramakrishnan, L.; Losick, R. Do Mycobacteria Produce Endospores? Proc. Natl. Acad. Sci. USA 2009, 107, 878–881. [Google Scholar] [CrossRef]
  10. Anbazhagan, P.; Harijan, R.K.; Kiema, T.R.; Janardan, N.; Murthy, M.R.N.; Michels, P.A.M.; Juffer, A.H.; Wierenga, R.K. Phylogenetic Relationships and Classification of Thiolases and Thiolase-like Proteins of Mycobacterium Tuberculosis and Mycobacterium Smegmatis. Tuberculosis 2014, 94, 405–412. [Google Scholar] [CrossRef]
  11. Schaefer, C.M.; Lu, R.; Nesbitt, N.M.; Schiebel, J.; Sampson, N.S.; Kisker, C. FadA5 a Thiolase from Mycobacterium Tuberculosis: A Steroid-Binding Pocket Reveals the Potential for Drug Development against Tuberculosis. Structure 2015, 23, 21–33. [Google Scholar] [CrossRef] [PubMed]
  12. Yuan, C.-Y.; Ma, Z.-G.; Zhang, J.-X.; Liu, X.-C.; Du, G.-L.; Sun, J.-S.; Shi, J.-P.; Zhang, B.-G. Production of 9,21-Dihydroxy-20-Methyl-Pregna-4-En-3-One from Phytosterols in Mycobacterium Neoaurum by Modifying Multiple Genes and Improving the Intracellular Environment. Microb. Cell Factories 2021, 20, 229. [Google Scholar] [CrossRef] [PubMed]
  13. Thomas, S.T.; Yang, X.; Sampson, N.S. Inhibition of the M. Tuberculosis 3β-Hydroxysteroid Dehydrogenase by Azasteroids. Bioorg. Med. Chem. Lett. 2011, 21, 2216–2219. [Google Scholar] [CrossRef] [PubMed]
  14. Yao, K.; Wang, F.Q.; Zhang, H.C.; Wei, D.Z. Identification and Engineering of Cholesterol Oxidases Involved in the Initial Step of Sterols Catabolism in Mycobacterium Neoaurum. Metab. Eng. 2013, 15, 75–87. [Google Scholar] [CrossRef]
  15. Child, S.A.; Ghith, A.; Bruning, J.B.; Bell, S.G. A Comparison of Steroid and Lipid Binding Cytochrome P450s from Mycobacterium Marinum and Mycobacterium Tuberculosis. J. Inorg. Biochem. 2020, 209, 111116. [Google Scholar] [CrossRef]
  16. Niu, Y.; Ge, F.; Yang, Y.; Ren, Y.; Li, W.; Chen, G.; Wen, D.; Liu, F.; Xiong, L. Biochemical Characterization of Acyl-Coenzyme A Synthetases Involved in Mycobacterial Steroid Side-Chain Catabolism and Molecular Design: Synthesis of an Anti-Mycobacterial Agent. 3 Biotech 2019, 9, 169. [Google Scholar] [CrossRef]
  17. Wipperman, M.F.; Sampson, N.S.; Thomas, S.T. Pathogen Roid Rage: Cholesterol Utilization by Mycobacterium tuberculosis. Crit. Rev. Biochem. Mol. Biol. 2014, 49, 269–293. [Google Scholar] [CrossRef]
  18. Xiao, P.; Pan, D.; Li, F.; Liu, Y.; Huang, Y.; Zhou, X.; Zhang, Y. Effect of TetR Family Transcriptional Regulator PccD on Phytosterol Metabolism of Mycolicibacterium. Microorganisms 2024, 12, 2349. [Google Scholar] [CrossRef]
  19. Van der Geize, R.; Yam, K.; Heuser, T.; Wilbrink, M.H.; Hara, H.; Anderton, M.C.; Sim, E.; Dijkhuizen, L.; Davies, J.E.; Mohn, W.W.; et al. A Gene Cluster Encoding Cholesterol Catabolism in a Soil Actinomycete Provides Insight into Mycobacterium tuberculosis Survival in Macrophages. Proc. Natl. Acad. Sci. USA 2007, 104, 1947–1952. [Google Scholar] [CrossRef]
  20. Jaiswal, A.K.; Husaini, S.H.A.; Kumar, A.; Subbarao, N. Designing Novel Inhibitors against Mycobacterium Tuberculosis FadA5 (Acetyl-CoA Acetyltransferase) by Virtual Screening of Known Anti-Tuberculosis (Bioactive) Compounds. Bioinformation 2018, 14, 327–336. [Google Scholar] [CrossRef]
  21. Nesbitt, N.M.; Yang, X.; Fontán, P.; Kolesnikova, I.; Smith, I.; Sampson, N.S.; Dubnau, E. A Thiolase of Mycobacterium tuberculosis Is Required for Virulence and Production of Androstenedione and Androstadienedione from Cholesterol. Infect. Immun. 2010, 78, 275–282. [Google Scholar] [CrossRef] [PubMed]
  22. Song, S.; He, J.; Gao, M.; Huang, Y.; Cheng, X.; Su, Z. Loop Pathways Are Responsible for Tuning the Accumulation of C19- and C22-Sterol Intermediates in the Mycobacterial Phytosterol Degradation Pathway. Microb. Cell Factories 2023, 22, 19. [Google Scholar] [CrossRef] [PubMed]
  23. Xu, L.Q.; Liu, Y.J.; Yao, K.; Liu, H.H.; Tao, X.Y.; Wang, F.Q.; Wei, D.Z. Unraveling and Engineering the Production of 23,24-Bisnorcholenic Steroids in Sterol Metabolism. Sci. Rep. 2016, 6, 21928. [Google Scholar] [CrossRef] [PubMed]
  24. Gilbert, H.F.; Lennox, B.J.; Mossman, C.D.; Carle, W.C. The Relation of Acyl Transfer to the Overall Reaction of Thiolase I from Porcine Heart. J. Biol. Chem. 1981, 256, 7371–7377. [Google Scholar] [CrossRef] [PubMed]
  25. Lu, R.; Schaefer, C.M.; Nesbitt, N.M.; Kuper, J.; Kisker, C.; Sampson, N.S. Catabolism of the Cholesterol Side Chain in Mycobacterium tuberculosis Is Controlled by a Redox-Sensitive Thiol Switch. ACS Infect. Dis. 2017, 3, 666–675. [Google Scholar] [CrossRef]
  26. Han, S.; Liu, X.; He, B.; Zhai, X.; Yuan, C.; Li, Y.; Lin, W.; Wang, H.; Zhang, B. Efficient Production of 9,22-Dihydroxy-23,24-Bisnorchol-4-Ene-3-One from Phytosterols by Modifying Multiple Genes in Mycobacterium Fortuitum. Int. J. Mol. Sci. 2024, 25, 3579. [Google Scholar] [CrossRef]
  27. Zhang, Y.; Zhou, X.; Yao, Y.; Xu, Q.; Shi, H.; Wang, K.; Feng, W.; Shen, Y. Coexpression of VHb and MceG Genes in Mycobacterium Sp. Strain LZ2 Enhances Androstenone Production via Immobilized Repeated Batch Fermentation. Bioresour. Technol. 2021, 342, 125965. [Google Scholar] [CrossRef]
  28. Zhou, X.; Zhang, Y.; Shen, Y.; Zhang, X.; Xu, S.; Shang, Z.; Xia, M.; Wang, M. Efficient Production of Androstenedione by Repeated Batch Fermentation in Waste Cooking Oil Media through Regulating NAD+/NADH Ratio and Strengthening Cell Vitality of Mycobacterium Neoaurum. Bioresour. Technol. 2019, 279, 209–217. [Google Scholar] [CrossRef]
  29. Zhang, Y.; Zhou, X.; Wang, X.; Wang, L.; Xia, M.; Luo, J.; Shen, Y.; Wang, M. Improving Phytosterol Biotransformation at Low Nitrogen Levels by Enhancing the Methylcitrate Cycle with Transcriptional Regulators PrpR and GlnR of Mycobacterium Neoaurum. Microb. Cell Factories 2020, 19, 13. [Google Scholar] [CrossRef]
  30. Xie, R.; Shen, Y.; Qin, N.; Wang, Y.; Su, L.; Wang, M. Genetic Differences in ksdD Influence on the ADD/AD Ratio of Mycobacterium neoaurum. J. Ind. Microbiol. Biotechnol. 2015, 42, 507–513. [Google Scholar] [CrossRef]
  31. Liu, X.; Zhang, J.; Yuan, C.; Du, G.; Han, S.; Shi, J.; Sun, J.; Zhang, B. Improving the Production of 9α-Hydroxy-4-Androstene-3,17-Dione from Phytosterols by 3-Ketosteroid-Δ1-Dehydrogenase Deletions and Multiple Genetic Modifications in Mycobacterium Fortuitum. Microb. Cell Factories 2023, 22, 53. [Google Scholar] [CrossRef] [PubMed]
  32. Claudino, M.J.C.; Soares, D.; Van Keulen, F.; Marques, M.P.C.; Cabral, J.M.S.; Fernandes, P. Immobilization of Mycobacterial Cells onto Silicone—Assessing the Feasibility of the Immobilized Biocatalyst in the Production of Androstenedione from Sitosterol. Bioresour. Technol. 2007, 99, 2304–2311. [Google Scholar] [CrossRef] [PubMed]
  33. Sun, W.-J.; Wang, L.; Liu, H.-H.; Liu, Y.-J.; Ren, Y.-H.; Wang, F.-Q.; Wei, D.-Z. Characterization and Engineering Control of the Effects of Reactive Oxygen Species on the Conversion of Sterols to Steroid Synthons in Mycobacterium Neoaurum. Metab. Eng. 2019, 56, 97–110. [Google Scholar] [CrossRef] [PubMed]
  34. Liu, X.; He, B.; Zhang, J.; Yuan, C.; Han, S.; Du, G.; Shi, J.; Sun, J.; Zhang, B. Phytosterol Conversion into C9 Non-Hydroxylated Derivatives through Gene Regulation in Mycobacterium Fortuitum. Appl. Microbiol. Biotechnol. 2023, 107, 7635–7646. [Google Scholar] [CrossRef]
  35. Olivera, E.R.; Luengo, J.M. Steroids as Environmental Compounds Recalcitrant to Degradation: Genetic Mechanisms of Bacterial Biodegradation Pathways. Genes 2019, 10, 512. [Google Scholar] [CrossRef]
  36. Thomas, S.T.; Sampson, N.S. Mycobacterium tuberculosisUtilizes a Unique Heterotetrameric Structure for Dehydrogenation of the Cholesterol Side Chain. Biochemistry 2013, 52, 2895–2904. [Google Scholar] [CrossRef]
  37. Su, L.; Shen, Y.; Xia, M.; Shang, Z.; Xu, S.; An, X.; Wang, M. Overexpression of Cytochrome P450 125 in Mycobacterium: A Rational Strategy in the Promotion of Phytosterol Biotransformation. J. Ind. Microbiol. Biotechnol. 2018, 45, 857–867. [Google Scholar] [CrossRef]
  38. Xiong, L.-B.; Liu, H.-H.; Xu, L.-Q.; Sun, W.-J.; Wang, F.-Q.; Wei, D.-Z. Improving the Production of 22-Hydroxy-23,24-Bisnorchol-4-Ene-3-One from Sterols in Mycobacterium Neoaurum by Increasing Cell Permeability and Modifying Multiple Genes. Microb. Cell Factories 2017, 16, 89. [Google Scholar] [CrossRef]
  39. Grimalt-Alemany, A.; Etler, C.; Asimakopoulos, K.; Skiadas, I.V.; Gavala, H.N. ORP Control for Boosting Ethanol Productivity in Gas Fermentation Systems and Dynamics of Redox Cofactor NADH/NAD+ under Oxidative Stress. J. CO2 Util. 2021, 50, 101589. [Google Scholar] [CrossRef]
  40. Dai, J.-J.; Cheng, J.-S.; Liang, Y.-Q.; Jiang, T.; Yuan, Y.-J. Regulation of Extracellular Oxidoreduction Potential Enhanced (R,R)-2,3-Butanediol Production by Paenibacillus Polymyxa CJX518. Bioresour. Technol. 2014, 167, 433–440. [Google Scholar] [CrossRef]
  41. Szentirmai, A. Microbial Physiology of Sidechain Degradation of Sterols. J. Ind. Microbiol. 1990, 6, 101–115. [Google Scholar] [CrossRef]
Figure 1. The putative metabolic pathway of Mycolicibacterium metabolizing sitosterol to generate AD. The dashed arrows indicate multiple-step reactions.
Figure 1. The putative metabolic pathway of Mycolicibacterium metabolizing sitosterol to generate AD. The dashed arrows indicate multiple-step reactions.
Fermentation 10 00627 g001
Figure 2. Phylogenetic trees and sequence homology analysis of FadA5. (a) Phylogenetic trees of FadA5. (b) Sequence alignments of FadA5 from different species. The names of the comparative strains are expressed as Org codes in the KEGG database. myv: M. sp. VKM Ac-1817D; msm: M. smegmatis MC2 155; rha: Rhodococcus jostii RHA1; mne: M. neoaurum VKM Ac-1815D. The dashed green and blue lines originally indicate the formation of a reversible disulfide bond between C55-C87 and C89-C373. The yellow five-pointed star indicates that H343 acts as an acid/base residue.
Figure 2. Phylogenetic trees and sequence homology analysis of FadA5. (a) Phylogenetic trees of FadA5. (b) Sequence alignments of FadA5 from different species. The names of the comparative strains are expressed as Org codes in the KEGG database. myv: M. sp. VKM Ac-1817D; msm: M. smegmatis MC2 155; rha: Rhodococcus jostii RHA1; mne: M. neoaurum VKM Ac-1815D. The dashed green and blue lines originally indicate the formation of a reversible disulfide bond between C55-C87 and C89-C373. The yellow five-pointed star indicates that H343 acts as an acid/base residue.
Fermentation 10 00627 g002
Figure 3. Effect of FadA5 overexpression and knockdown on MSP production. (a) Effects of FadA5 overexpression and knockout on strain growth. (b) Effect of FadA5 overexpression and knockout on AD production yield. The error bars represent mean ± SD (n = 3).
Figure 3. Effect of FadA5 overexpression and knockdown on MSP production. (a) Effects of FadA5 overexpression and knockout on strain growth. (b) Effect of FadA5 overexpression and knockout on AD production yield. The error bars represent mean ± SD (n = 3).
Fermentation 10 00627 g003
Figure 4. Effect of redox potential on AD production. (a) Time course of resting cells transforming phytosterols to produce AD at different ORPs. (b) Comparison of AD production by resting cells of FadA5-engineered strains at different ORPs. (c) Changes in resting cell biomass at different redox potentials. The error bars represent mean ± SD (n = 3).
Figure 4. Effect of redox potential on AD production. (a) Time course of resting cells transforming phytosterols to produce AD at different ORPs. (b) Comparison of AD production by resting cells of FadA5-engineered strains at different ORPs. (c) Changes in resting cell biomass at different redox potentials. The error bars represent mean ± SD (n = 3).
Fermentation 10 00627 g004
Figure 5. Production performance evaluation of MSP-fA5C87A/ΔfA5. (a) Effect of different substrate concentrations on AD production and (b) MSP-fA5C87A/ΔfA5 cell viability at different substrate concentrations. The error bars represent mean ± SD (n = 3).
Figure 5. Production performance evaluation of MSP-fA5C87A/ΔfA5. (a) Effect of different substrate concentrations on AD production and (b) MSP-fA5C87A/ΔfA5 cell viability at different substrate concentrations. The error bars represent mean ± SD (n = 3).
Fermentation 10 00627 g005
Figure 6. Repeated batch fermentation of MSP-fA5C87A-VP/ΔfA5 to produce AD. (a) Intracellular ROS level of MSP-fA5C87A-VP/ΔfA5 during fermentation; (b) cell viability of MSP-fA5C87A-VP/ΔfA5 during fermentation; (c) process curve of AD production; and (d) cell viability and maximum AD conversion of each batch during repeated batch fermentation. The error bars represent mean ± SD (n = 3).
Figure 6. Repeated batch fermentation of MSP-fA5C87A-VP/ΔfA5 to produce AD. (a) Intracellular ROS level of MSP-fA5C87A-VP/ΔfA5 during fermentation; (b) cell viability of MSP-fA5C87A-VP/ΔfA5 during fermentation; (c) process curve of AD production; and (d) cell viability and maximum AD conversion of each batch during repeated batch fermentation. The error bars represent mean ± SD (n = 3).
Fermentation 10 00627 g006
Table 1. Strains, plasmids, and primers used in this study.
Table 1. Strains, plasmids, and primers used in this study.
Strain, Plasmid,
or Primer
Significant PropertiesSource or Purpose
Strain
Mycolicibacterium sp. LZ2Wild type[27]
Escherichia coli DH5αGeneral cloning hostTransgen Biotech
MSP-261MSP carrying vector pMV261This work
MSP-fA5FadA5 overexpression in MSPThis work
MSPΔfA5FadA5 deletion mutant of MSPThis work
MSPΔfA5::fA5FadA5 overexpression in MSPΔfA5This work
MSP-fA5C87AFadA5 mutant overexpression in MSPThis work
MSP-fA5C87A/ΔfA5FadA5 mutant overexpression in MSPΔfA5This work
MSP-fA5C87A-VP/ΔfA5VHb and PrpR co-expression in MSP-fA5C87A/ΔfA5This work
Plasmid
pMV261-fA5pMV261 carrying fadA5This work
pMV261-fA5C87ApMV261 carrying fadA5C87AThis work
pMV261-vgbpMV261 carrying vgb[27]
pMV261-prpRpMV261 carrying prpR[29]
p2G19-fA5p2NIL carrying the homologous arms of fadA5 and the selection markers from pGOAL19This work
pMV261-vgb-prpRpMV261 carrying vgb and prpRThis work
Primer
2-fa5FGGATCCAGCTGCAGAATTCATGGGTAATCCTGTCATCGTfadA5 amplification
2-fa5RCGCTAGTTAACTACGTCGACTCAGATCCTTTCGATGATGGfadA5 amplification
F5UP-FATAAACTACCGCATTAAAGCTTCGTTCCTTCTTGTAGAGCTCfadA5 deletion
F5UP-RGTCCATGTCGTACTGGGTGACGCAGCCGCfadA5 deletion
F5DO-FCCCAGTACGACATGGACAAGGTCAACGTfadA5 deletion
F5DO-RATTTAGGTGACACTATAGAATACATAGGTCGCAGATCAGGATCGGGAfadA5 deletion
MF5-FCACCATCGACgcCCAGTGCGGCAGCfadA5 mutation
MF5-RGTGGCACCCACGTGCTCGfadA5 mutation
2-vpFCAAGCCGTCGAGTGAGAGAGGTGACCACAACGACGCprpR amplification
2-vpRGTCGATCGTACGCTAGTTTGATGCCTGGCAGTCGATCGprpR amplification
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhou, X.; Liu, Y.; Li, F.; Huang, Y.; Xuan, H.; Zhang, Y. Enhancement of the Degradation of Phytosterol Side Chains in Mycolicibacterium by Eliminating the Redox Sensitivity of Key Thiolase and Augmenting Cell Activity. Fermentation 2024, 10, 627. https://doi.org/10.3390/fermentation10120627

AMA Style

Zhou X, Liu Y, Li F, Huang Y, Xuan H, Zhang Y. Enhancement of the Degradation of Phytosterol Side Chains in Mycolicibacterium by Eliminating the Redox Sensitivity of Key Thiolase and Augmenting Cell Activity. Fermentation. 2024; 10(12):627. https://doi.org/10.3390/fermentation10120627

Chicago/Turabian Style

Zhou, Xiuling, Yuying Liu, Fuyi Li, Yang Huang, Hongzhuan Xuan, and Yang Zhang. 2024. "Enhancement of the Degradation of Phytosterol Side Chains in Mycolicibacterium by Eliminating the Redox Sensitivity of Key Thiolase and Augmenting Cell Activity" Fermentation 10, no. 12: 627. https://doi.org/10.3390/fermentation10120627

APA Style

Zhou, X., Liu, Y., Li, F., Huang, Y., Xuan, H., & Zhang, Y. (2024). Enhancement of the Degradation of Phytosterol Side Chains in Mycolicibacterium by Eliminating the Redox Sensitivity of Key Thiolase and Augmenting Cell Activity. Fermentation, 10(12), 627. https://doi.org/10.3390/fermentation10120627

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop