Constructing a New Pathway for Ethylene Glycol Biosynthesis and Its Coenzyme Reuse Mechanism
Abstract
1. Introduction
Strain or Enzymes | Production Process | Substrate | Ethylene Glycol Yield (g/g) | Reference |
---|---|---|---|---|
E. coli WL3110 (pTacxylBC-P1-anti-xylB) | Microbial fermentation | D-Xylose | 108.2 | [12] |
E. coli BL21(DE3) ΔarcAΔaldA/pETDuet1-yjhH-xdh-xylC/pACYCDuet1-fucO-yjhG | Microbial fermentation | D-Xylose | 72 | [13] |
E. coli MG1655 ΔxylB ΔaldA dte fucA fucK fucO | Microbial fermentation | D-Xylose | 40 | [20] |
E. coli MG1655 ΔxylB ΔaldA khk-C aldoB fucO | Microbial fermentation | D-Xylose | 20 | [17] |
E. coli W3110(DE3) ΔxylA xdh yqhD | Microbial fermentation | D-Xylose | 11.7 | [14] |
E. coli MG1655 ΔaraB ΔaldA ΔxylB dte rhaB rhaD fucA fucK fucO | Microbial fermentation | L-Arabinose + D-Xylose | 10.5 | [20] |
E. coli W3110 ΔxylABΔaldAΔyjgBpKMX and pTrcHis2A_yjgB | Microbial fermentation | D-Xylose | 7.72 | [15] |
E. coli MG1655(DE3) ΔaldA serA:317 serB serC fucO sdcV.carteri aao | Microbial fermentation | D-Glucose | 4.1 | [28] |
C. glutamicum Mdlc yqhD Sdc ASAO yqhD yqhD | Microbial fermentation | D-Glucose | 3.5 | [29] |
S. cerevisiae xks1Δ BsXI RnKHK FBA1 CD | Microbial fermentation | D-Xylose | 0.5 | [18] |
S. cerevisiae H4099 (MATα, ura3–52 HIS3, leu2–3/112, TRP1, MAL2–8 c, SUC2, gre3::xylB, fra2::HygR, xylD) | Microbial fermentation | D-Xylose + D-Glucose | 0.014 | [16] |
S. cerevisiae (PeXYLA)47 RPE1 RKI1 TKL1 PsTAL1 PFK1 PFK2 | Microbial fermentation | D-Xylose + D-Glucose | 4.05 | [19] |
D-Xylose dehydrogenase, xylonolactonase, xylonate dehydratase, 2-keto-3-deoxy-D-xylonate aldolase, lactaldehyde reductase, a-acetolactate synthase, and α-acetolactate decarboxylase | Cell-free biosynthesis | D-Xylose | 0.341 | [30] |
AldOmt, catalase, GRHPR, PDC, and FucO | Cell-free biosynthesis | Glycerol | 0.47 | [23] |
2. Materials and Methods
2.1. Strains and Plasmids
2.2. Expression and Purification of the Enzymes
2.3. Construction of In Vitro Cascade Reaction System
2.4. Medium and Culture
2.5. Synthesis of Ethylene Glycol by Two-Stage Bioconversion Strategy
2.6. Analytical Methods
3. Results and Discussion
3.1. Designing a New Multienzyme Cascade Pathway for Methanol to Ethylene Glycol
3.2. Verification of Enzyme Cascade Reaction Pathway
3.3. Enhancing the Expression and Activity of the Enzyme In Vivo
3.4. Increasing the Production of Ethylene Glycol Through a Two-Stage Biotransformation Strategy
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Whipple, D.T.; Kenis, P.J. Prospects of CO2 utilization via direct heterogeneous electrochemical reduction. J. Phys. Chem. Lett. 2010, 1, 3451–3458. [Google Scholar] [CrossRef]
- Weng, C.; Peng, X.; Han, Y. From methane to value-added bioproducts: Microbial metabolism, enzymes, and metabolic engineering. In Advances in Applied Microbiology; Elsevier: Amsterdam, The Netherlands, 2023; Volume 124, pp. 119–146. [Google Scholar]
- Liu, K.; Qiao, Y.; Zhang, S.; Guo, F.; Ma, J.; Xin, F.; Zhang, W.; Jiang, M. Advances in biotransformation of methanol into chemicals. Sheng Wu Gong Cheng Xue Bao Chin. J. Biotechnol. 2023, 39, 2430–2448. [Google Scholar]
- Guo, M.; Song, W.; Buhain, J. Bioenergy and biofuels: History, status, and perspective. Renew. Sustain. Energy Rev. 2015, 42, 712–725. [Google Scholar] [CrossRef]
- Zhou, J.; Tian, X.; Yang, Q.; Zhang, Z.; Chen, C.; Cui, Z.; Ji, Y.; Schwaneberg, U.; Chen, B.; Tan, T. Three multi-enzyme cascade pathways for conversion of C1 to C2/C4 compounds. Chem. Catal. 2022, 2, 2675–2690. [Google Scholar] [CrossRef]
- Cai, T.; Sun, H.; Qiao, J.; Zhu, L.; Zhang, F.; Zhang, J.; Tang, Z.; Wei, X.; Yang, J.; Yuan, Q. Cell-free chemoenzymatic starch synthesis from carbon dioxide. Science 2021, 373, 1523–1527. [Google Scholar] [CrossRef]
- Navarro-Jaén, S.; Virginie, M.; Bonin, J.; Robert, M.; Wojcieszak, R.; Khodakov, A.Y. Highlights and challenges in the selective reduction of carbon dioxide to methanol. Nat. Rev. Chem. 2021, 5, 564–579. [Google Scholar] [CrossRef] [PubMed]
- Tan, T.; Chen, B.; Zhang, H.; Cui, Z. Accelerate promotion of green bio-manufacturing to help achieve “carbon neutrality”. Chem. Ind. Eng. Prog. 2021, 40, 1137–1141. [Google Scholar]
- Wagner, N.; Wen, L.; Frazão, C.J.; Walther, T. Next-generation feedstocks methanol and ethylene glycol and their potential in industrial biotechnology. Biotechnol. Adv. 2023, 69, 108276. [Google Scholar] [CrossRef]
- Yue, H.; Zhao, Y.; Ma, X.; Gong, J. Ethylene glycol: Properties, synthesis, and applications. Chem. Soc. Rev. 2012, 41, 4218–4244. [Google Scholar] [CrossRef]
- Salusjärvi, L.; Havukainen, S.; Koivistoinen, O.; Toivari, M. Biotechnological production of glycolic acid and ethylene glycol: Current state and perspectives. Appl. Microbiol. Biotechnol. 2019, 103, 2525–2535. [Google Scholar] [CrossRef]
- Chae, T.U.; Choi, S.Y.; Ryu, J.Y.; Lee, S.Y. Production of ethylene glycol from xylose by metabolically engineered Escherichia coli. AIChE J. 2018, 64, 4193–4200. [Google Scholar] [CrossRef]
- Wang, Y.; Xian, M.; Feng, X.; Liu, M.; Zhao, G. Biosynthesis of ethylene glycol from d-xylose in recombinant Escherichia coli. Bioengineered 2018, 9, 233–241. [Google Scholar] [CrossRef]
- Liu, H.; Ramos, K.R.M.; Valdehuesa, K.N.G.; Nisola, G.M.; Lee, W.-K.; Chung, W.-J. Biosynthesis of ethylene glycol in Escherichia coli. Appl. Microbiol. Biotechnol. 2013, 97, 3409–3417. [Google Scholar] [CrossRef] [PubMed]
- Cabulong, R.B.; Valdehuesa, K.N.G.; Ramos, K.R.M.; Nisola, G.M.; Lee, W.-K.; Lee, C.R.; Chung, W.-J. Enhanced yield of ethylene glycol production from d-xylose by pathway optimization in Escherichia coli. Enzym. Microb. Technol. 2017, 97, 11–20. [Google Scholar] [CrossRef] [PubMed]
- Salusjärvi, L.; Toivari, M.; Vehkomäki, M.-L.; Koivistoinen, O.; Mojzita, D.; Niemelä, K.; Penttilä, M.; Ruohonen, L. Production of ethylene glycol or glycolic acid from D-xylose in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 2017, 101, 8151–8163. [Google Scholar] [CrossRef]
- Alkim, C.; Cam, Y.; Trichez, D.; Auriol, C.; Spina, L.; Vax, A.; Bartolo, F.; Besse, P.; François, J.M.; Walther, T. Optimization of ethylene glycol production from (D)-xylose via a synthetic pathway implemented in Escherichia coli. Microb. Cell Factories 2015, 14, 127. [Google Scholar] [CrossRef]
- Chomvong, K.; Bauer, S.; Benjamin, D.I.; Li, X.; Nomura, D.K.; Cate, J.H. Bypassing the pentose phosphate pathway: Towards modular utilization of xylose. PLoS ONE 2016, 11, e0158111. [Google Scholar] [CrossRef]
- Uranukul, B.; Woolston, B.M.; Fink, G.R.; Stephanopoulos, G. Biosynthesis of monoethylene glycol in Saccharomyces cerevisiae utilizing native glycolytic enzymes. Metab. Eng. 2019, 51, 20–31. [Google Scholar] [CrossRef]
- Pereira, B.; Li, Z.-J.; De Mey, M.; Lim, C.G.; Zhang, H.; Hoeltgen, C.; Stephanopoulos, G. Efficient utilization of pentoses for bioproduction of the renewable two-carbon compounds ethylene glycol and glycolate. Metab. Eng. 2016, 34, 80–87. [Google Scholar] [CrossRef] [PubMed]
- Jarboe, L.R. YqhD: A broad-substrate range aldehyde reductase with various applications in production of biorenewable fuels and chemicals. Appl. Microbiol. Biotechnol. 2011, 89, 249–257. [Google Scholar] [CrossRef]
- Zhang, Z.; Yang, Y.; Wang, Y.; Gu, J.; Lu, X.; Liao, X.; Shi, J.; Kim, C.H.; Lye, G.; Baganz, F. Ethylene glycol and glycolic acid production from xylonic acid by Enterobacter cloacae. Microb. Cell Factories 2020, 19, 89. [Google Scholar] [CrossRef]
- Li, K.; Sun, W.; Meng, W.; Yan, J.; Zhang, Y.; Guo, S.; Lü, C.; Ma, C.; Gao, C. Production of ethylene glycol from glycerol using an in vitro enzymatic cascade. Catalysts 2021, 11, 214. [Google Scholar] [CrossRef]
- Jo, H.-J.; Kim, J.-H.; Kim, Y.-N.; Seo, P.-W.; Kim, C.-Y.; Kim, J.-W.; Yu, H.-n.; Cheon, H.; Lee, E.Y.; Kim, J.-S. Glyoxylate carboligase-based whole-cell biotransformation of formaldehyde into ethylene glycol via glycolaldehyde. Green Chem. 2022, 24, 218–226. [Google Scholar] [CrossRef]
- Kong, S.; Lv, X.; Wang, X.; Liu, Z.; Li, Z.; Jia, B.; Sun, D.; Yang, C.; Liu, L.; Guan, A. Delocalization state-induced selective bond breaking for efficient methanol electrosynthesis from CO2. Nat. Catal. 2023, 6, 6–15. [Google Scholar] [CrossRef]
- Qu, T.; Wei, S.; Xiong, Z.; Zhang, J.; Zhao, Y. Progress and prospect of CO2 photocatalytic reduction to methanol. Fuel Process. Technol. 2023, 251, 107933. [Google Scholar] [CrossRef]
- Lu, X.; Liu, Y.; Yang, Y.; Wang, S.; Wang, Q.; Wang, X.; Yan, Z.; Cheng, J.; Liu, C.; Yang, X. Constructing a synthetic pathway for acetyl-coenzyme A from one-carbon through enzyme design. Nat. Commun. 2019, 10, 1378. [Google Scholar] [CrossRef]
- Pereira, B.; Zhang, H.; De Mey, M.; Lim, C.G.; Li, Z.J.; Stephanopoulos, G. Engineering a novel biosynthetic pathway in Escherichia coli for production of renewable ethylene glycol. Biotechnol. Bioeng. 2016, 113, 376–383. [Google Scholar] [CrossRef]
- Chen, Z.; Huang, J.; Wu, Y.; Liu, D. Metabolic engineering of Corynebacterium glutamicum for the de novo production of ethylene glycol from glucose. Metab. Eng. 2016, 33, 12–18. [Google Scholar] [CrossRef]
- Jia, X.; Kelly, R.M.; Han, Y. Simultaneous biosynthesis of (R)-acetoin and ethylene glycol from D-xylose through in vitro metabolic engineering. Metab. Eng. Commun. 2018, 7, e00074. [Google Scholar] [CrossRef]
- Cheng, J.; Hu, G.; Xu, Y.; Torrens-Spence, M.P.; Zhou, X.; Wang, D.; Weng, J.-K.; Wang, Q. Production of nonnatural straight-chain amino acid 6-aminocaproate via an artificial iterative carbon-chain-extension cycle. Metab. Eng. 2019, 55, 23–32. [Google Scholar] [CrossRef]
- Kruger, N.J. The Bradford method for protein quantitation. In The Protein Protocols Handbook; Humana Press: Totowa, NJ, USA, 2009; pp. 17–24. [Google Scholar]
- Wu, T.-Y.; Chen, C.-T.; Liu, J.T.-J.; Bogorad, I.W.; Damoiseaux, R.; Liao, J.C. Characterization and evolution of an activator-independent methanol dehydrogenase from Cupriavidus necator N-1. Appl. Microbiol. Biotechnol. 2016, 100, 4969–4983. [Google Scholar] [CrossRef]
- Wang, X.; Saba, T.; Yiu, H.H.; Howe, R.F.; Anderson, J.A.; Shi, J. Cofactor NAD (P) H regeneration inspired by heterogeneous pathways. Chem 2017, 2, 621–654. [Google Scholar] [CrossRef]
- Price, J.V.; Chen, L.; Whitaker, W.B.; Papoutsakis, E.; Chen, W. Scaffoldless engineered enzyme assembly for enhanced methanol utilization. Proc. Natl. Acad. Sci. USA 2016, 113, 12691–12696. [Google Scholar] [CrossRef] [PubMed]
- Whitaker, W.B.; Jones, J.A.; Bennett, R.K.; Gonzalez, J.E.; Vernacchio, V.R.; Collins, S.M.; Palmer, M.A.; Schmidt, S.; Antoniewicz, M.R.; Koffas, M.A. Engineering the biological conversion of methanol to specialty chemicals in Escherichia coli. Metab. Eng. 2017, 39, 49–59. [Google Scholar] [CrossRef]
- Zavarise, A.; Sridhar, S.; Kiema, T.R.; Wierenga, R.K.; Widersten, M. Structures of lactaldehyde reductase, FucO, link enzyme activity to hydrogen bond networks and conformational dynamics. FEBS J. 2023, 290, 465–481. [Google Scholar] [CrossRef]
- Wu, H.; Tian, C.; Song, X.; Liu, C.; Yang, D.; Jiang, Z. Methods for the regeneration of nicotinamide coenzymes. Green Chem. 2013, 15, 1773–1789. [Google Scholar] [CrossRef]
- Wang, X.; Yiu, H.H. Heterogeneous catalysis mediated cofactor NADH regeneration for enzymatic reduction. ACS Catal. 2016, 6, 1880–1886. [Google Scholar] [CrossRef]
- Whitaker, W.B.; Sandoval, N.R.; Bennett, R.K.; Fast, A.G.; Papoutsakis, E.T. Synthetic methylotrophy: Engineering the production of biofuels and chemicals based on the biology of aerobic methanol utilization. Curr. Opin. Biotechnol. 2015, 33, 165–175. [Google Scholar] [CrossRef]
- Li, M.; Chen, H.; Liu, C.; Guo, J.; Xu, X.; Zhang, H.; Nian, R.; Xian, M. Improvement of isoprene production in Escherichia coli by rational optimization of RBSs and key enzymes screening. Microb. Cell Factories 2019, 18, 4. [Google Scholar] [CrossRef]
- Dvorak, P.; Chrast, L.; Nikel, P.I.; Fedr, R.; Soucek, K.; Sedlackova, M.; Chaloupkova, R.; de Lorenzo, V.; Prokop, Z.; Damborsky, J. Exacerbation of substrate toxicity by IPTG in Escherichia coli BL21 (DE3) carrying a synthetic metabolic pathway. Microb. Cell Factories 2015, 14, 201. [Google Scholar] [CrossRef]
- Simas, R.G.; Pessoa Junior, A.; Long, P.F. Mechanistic aspects of IPTG (isopropylthio-β-galactoside) transport across the cytoplasmic membrane of Escherichia coli—A rate limiting step in the induction of recombinant protein expression. J. Ind. Microbiol. Biotechnol. 2023, 50, kuad034. [Google Scholar] [CrossRef] [PubMed]
Strain or Plasmid | Description | Source |
---|---|---|
Strains | ||
E. coli DH5α | Plasmid extraction | Our laboratory |
E. coli BL21(DE3) | F-ompT hsdSB (rB-mB-) gal (λ c I 857 ind1 Sam7 nin5 lacUV5 T7gene1) dcm (DE3) | Our laboratory |
E.coli BL21(DE3)/MDH | E. coli BL21(DE3) expressing MDH from Cupriavidus necator N-1 | This study |
E. coli BL21(DE3)/GALS | E. coli BL21(DE3) expressing GALS from Pseudomonas putida | This study |
E. coli BL21(DE3)/FucO | E. coli BL21(DE3) expressing FucO from Escherichia coli MG1655 | This study |
E. coli BL21(DE3)/MGF | Co-expressing strains of MDH, GALS, and FucO | This study |
Plasmids | ||
pET28a | Vector carries N-terminal His Tag, Kanr, 5369 bp | Our laboratory |
pET28a-MDH | pET28a harboring the MDH gene | This study |
pET28a-GALS | pET28a harboring the GALS gene | This study |
pET28a-FucO | pET28a harboring the FucO gene | This study |
pET28a-MGF | pET28a harboring the MDH, GALS, and FucO gene | This study |
Primers | Sequences (5′-3′) |
---|---|
F1-ZT | GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAG |
R1-ZT | CACCACCACCACCACCAC |
F1-MDH | CTTTAAGAAGGAGATATACCatgacccacctgaac |
R1-MDH | GTGGTGGTGGTGGTGGTGcatcgccgcagcgaagattg |
F1-GALS | CTTTAAGAAGGAGATATACCatggcttctgttcacggtac |
R1-GALS | GTGGTGGTGGTGGTGGTGtttaaccggagaaac |
F1-FucO | GTTTAACTTTAAGAAGGAGATATACCatggctaacagaatgattct |
R1-FucO | GTGGTGGTGGTGGTGGTGccaggcggtatg |
F1-M/G | CTGAAAGAAGATTAAatggcttctgttcacg |
R1-M/G | GTGAACAGAAGCCATttaatcttctttcagtttc |
F2-G/F | CGTTTCTCCGGTTAAATAAatggctaacagaatg |
R2-G/F | CATTCTGTTAGCCATttatttaaccggag |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, Z.; Li, W.; Wang, D.; Fang, X.; Li, J.; Li, X. Constructing a New Pathway for Ethylene Glycol Biosynthesis and Its Coenzyme Reuse Mechanism. Fermentation 2024, 10, 558. https://doi.org/10.3390/fermentation10110558
Zhu Z, Li W, Wang D, Fang X, Li J, Li X. Constructing a New Pathway for Ethylene Glycol Biosynthesis and Its Coenzyme Reuse Mechanism. Fermentation. 2024; 10(11):558. https://doi.org/10.3390/fermentation10110558
Chicago/Turabian StyleZhu, Zeyang, Wenwei Li, Dan Wang, Xia Fang, Jianing Li, and Xuyang Li. 2024. "Constructing a New Pathway for Ethylene Glycol Biosynthesis and Its Coenzyme Reuse Mechanism" Fermentation 10, no. 11: 558. https://doi.org/10.3390/fermentation10110558
APA StyleZhu, Z., Li, W., Wang, D., Fang, X., Li, J., & Li, X. (2024). Constructing a New Pathway for Ethylene Glycol Biosynthesis and Its Coenzyme Reuse Mechanism. Fermentation, 10(11), 558. https://doi.org/10.3390/fermentation10110558