Innovative Ink-Based 3D Hydrogel Bioprinted Formulations for Tissue Engineering Applications
Abstract
1. Introduction
2. Results and Discussion
2.1. Rheological Characterization
2.2. Mechanical Analysis
2.3. Hydrogel Swelling Behavior
2.4. Bioprinting of Cell-Laden Hydrogels
2.5. Live/Dead Staining
2.6. Cell Viability Assay
2.7. Gene Expression
3. Conclusions
4. Materials and Methods
4.1. Materials
4.2. Preparation of Alginate-Based Solutions
4.3. Cell Culture and Maintenance
4.4. Oscillatory Rheological Measurements
4.5. Hydrogel Swelling Behavior
4.6. Mechanical Analysis
4.7. Bioprinting of Cell-Laden Hydrogels
4.8. Live/Dead Staining
4.9. Cell Viability Assay
4.10. Gene Expression
4.11. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
List of Abbreviations
3D | three-dimensional |
ALPL | alkaline phosphatase |
CaCl2 | calcium chloride |
Col | collagen |
COL1A2 | collagen type 1 alpha 2 chain |
DPBS | Dulbecco’s phosphate-buffered saline |
ECM | extracellular matrix |
FBS | fetal bovine serum |
G′ | storage modulus |
G″ | loss modulus |
IBSP | integrin-binding sialoprotein |
hBMSC | human bone marrow stem/stromal cell |
HA | hydroxyapatite |
LVR | linear viscoelastic region |
MSC | mesenchymal stem/stromal cell |
nHA | nano-hydroxyapatite |
qPCR | quantitative real-time polymerase chain reaction |
RUNX2 | runt-related transcription factor 2 |
SPP1 | secreted phosphoprotein-1 |
SE | standard error of the mean |
References
- Wu, A.-M.; Bisignano, C.; James, S.L.; Abady, G.G.; Abedi, A.; Abu-Gharbieh, E.; Alhassan, R.K.; Alipour, V.; Arabloo, J.; Asaad, M.; et al. Global, regional, and national burden of bone fractures in 204 countries and territories, 1990–2019: A systematic analysis from the Global Burden of Disease Study 2019. Lancet Healthy Longev. 2021, 2, e580–e592. [Google Scholar] [CrossRef] [PubMed]
- Polinder, S.; Haagsma, J.; Panneman, M.; Scholten, A.; Brugmans, M.; Van Beeck, E. The economic burden of injury: Health care and productivity costs of injuries in the Netherlands. Accid. Anal. Prev. 2016, 93, 92–100. [Google Scholar] [CrossRef]
- Borgström, F.; Karlsson, L.; Ortsäter, G.; Norton, N.; Halbout, P.; Cooper, C.; Lorentzon, M.; McCloskey, E.V.; Harvey, N.C.; Javaid, M.K.; et al. Fragility fractures in Europe: Burden, management and opportunities. Arch. Osteoporos. 2020, 15, 59. [Google Scholar] [CrossRef] [PubMed]
- Caddeo, S.; Boffito, M.; Sartori, S. Tissue Engineering Approaches in the Design of Healthy and Pathological In Vitro Tissue Models. Front. Bioeng. Biotechnol. 2017, 5, 40. [Google Scholar] [CrossRef]
- Owen, R.; Reilly, G.C. In vitro Models of Bone Remodelling and Associated Disorders. Front. Bioeng. Biotechnol. 2018, 6, 134. [Google Scholar] [CrossRef] [PubMed]
- Kwakwa, K.A.; Vanderburgh, J.P.; Guelcher, S.A.; Sterling, J.A. Engineering 3D Models of Tumors and Bone to Understand Tumor-Induced Bone Disease and Improve Treatments. Curr. Osteoporos. Rep. 2017, 15, 247–254. [Google Scholar] [CrossRef]
- Tripathi, S.; Mandal, S.S.; Bauri, S.; Maiti, P. 3D bioprinting and its innovative approach for biomedical applications. MedComm 2023, 4, e194. [Google Scholar] [CrossRef]
- Im, S.; Choe, G.; Seok, J.M.; Yeo, S.J.; Lee, J.H.; Kim, W.D.; Lee, J.Y.; Park, S.A. An osteogenic bioink composed of alginate, cellulose nanofibrils, and polydopamine nanoparticles for 3D bioprinting and bone tissue engineering. Int. J. Biol. Macromol. 2022, 205, 520–529. [Google Scholar] [CrossRef]
- Vanderburgh, J.P.; Guelcher, S.A.; Sterling, J.A. 3D bone models to study the complex physical and cellular interactions between tumor and the bone microenvironment. J. Cell. Biochem. 2018, 119, 5053–5059. [Google Scholar] [CrossRef]
- Gonzalez-Fernandez, T.; Sikorski, P.; Leach, J.K. Bio-instructive materials for musculoskeletal regeneration. Acta Biomater. 2019, 96, 20–34. [Google Scholar] [CrossRef]
- Gonzalez-Fernandez, T.; Tenorio, A.J.; Campbell, K.T.; Silva, E.A.; Leach, J.K. Alginate-Based Bioinks for 3D Bioprinting and Fabrication of Anatomically Accurate Bone Grafts. Tissue Eng. Part A 2021, 27, 1168–1181. [Google Scholar] [CrossRef] [PubMed]
- Datta, S. Advantage of Alginate Bioinks in Biofabrication for Various Tissue Engineering Applications. Int. J. Polym. Sci. 2023, 2023, 6661452. [Google Scholar] [CrossRef]
- Mahmud, R.U.; Rahman, M.Z. 13.13—Synthesis and characterization of nanocomposites for tissue engineering. In Comprehensive Materials Processing, 2nd ed.; Hashmi, S., Ed.; Elsevier: Oxford, UK, 2024; pp. 241–269. [Google Scholar]
- Hariyadi, D.M.; Islam, N. Current Status of Alginate in Drug Delivery. Adv. Pharmacol. Pharm. Sci. 2020, 2020, 8886095. [Google Scholar] [CrossRef] [PubMed]
- Shams, E.; Barzad, M.S.; Mohamadnia, S.; Tavakoli, O.; Mehrdadfar, A. A review on alginate-based bioinks, combination with other natural biomaterials and characteristics. J. Biomater. Appl. 2022, 37, 355–372. [Google Scholar] [CrossRef]
- Sudipto, D.; Ranjit, B.; Jonali, D. Importance of Alginate Bioink for 3D Bioprinting in Tissue Engineering and Regenerative Medicine. In Alginates; Leonel, P., Ed.; IntechOpen: Rijeka, Croatia, 2019; Chapter 7; Available online: https://www.intechopen.com/chapters/70389 (accessed on 1 October 2024).
- Ma, C.; Du, T.; Niu, X.; Fan, Y. Biomechanics and mechanobiology of the bone matrix. Bone Res. 2022, 10, 59. [Google Scholar] [CrossRef]
- Bielajew, B.J.; Hu, J.C.; Athanasiou, K.A. Collagen: Quantification, biomechanics and role of minor subtypes in cartilage. Nat. Rev. Mater. 2020, 5, 730–747. [Google Scholar] [CrossRef]
- Li, Z.; Ruan, C.; Niu, X. Collagen-based bioinks for regenerative medicine: Fabrication, application and prospective. Med. Nov. Technol. Devices 2023, 17, 100211. [Google Scholar] [CrossRef]
- Li, Y.; Liu, Y.; Li, R.; Bai, H.; Zhu, Z.; Zhu, L.; Zhu, C.; Che, Z.; Liu, H.; Wang, J.; et al. Collagen-based biomaterials for bone tissue engineering. Mater. Des. 2021, 210, 110049. [Google Scholar] [CrossRef]
- Sousa, A.C.; Biscaia, S.; Alvites, R.; Branquinho, M.; Lopes, B.; Sousa, P.; Valente, J.; Franco, M.; Santos, J.D.; Mendonça, C.; et al. Assessment of 3D-Printed Polycaprolactone, Hydroxyapatite Nanoparticles and Diacrylate Poly(ethylene glycol) Scaffolds for Bone Regeneration. Pharmaceutics 2022, 14, 2643. [Google Scholar] [CrossRef]
- Sancilio, S.; Gallorini, M.; Di Nisio, C.; Marsich, E.; Di Pietro, R.; Schweikl, H.; Cataldi, A. Alginate/Hydroxyapatite-Based Nanocomposite Scaffolds for Bone Tissue Engineering Improve Dental Pulp Biomineralization and Differentiation. Stem Cells Int. 2018, 2018, 9643721. [Google Scholar] [CrossRef]
- Quinlan, E.; López-Noriega, A.; Thompson, E.; Kelly, H.M.; Cryan, S.A.; O’Brien, F.J. Development of collagen-hydroxyapatite scaffolds incorporating PLGA and alginate microparticles for the controlled delivery of rhBMP-2 for bone tissue engineering. J. Control. Release 2015, 198, 71–79. [Google Scholar] [CrossRef] [PubMed]
- Soleymani, S.; Naghib, S.M. 3D and 4D printing hydroxyapatite-based scaffolds for bone tissue engineering and regeneration. Heliyon 2023, 9, e19363. [Google Scholar] [CrossRef] [PubMed]
- Melo, P.; Montalbano, G.; Fiorilli, S.; Vitale-Brovarone, C. 3D Printing in Alginic Acid Bath of In-Situ Crosslinked Collagen Composite Scaffolds. Materials 2021, 14, 6720. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhou, Y.; Wang, C. Investigation of Collagen-Incorporated Sodium Alginate Bioprinting Hydrogel for Tissue Engineering. J. Compos. Sci. 2022, 6, 227. [Google Scholar] [CrossRef]
- Hassani, A.; Khoshfetrat, A.B.; Rahbarghazi, R.; Sakai, S. Collagen and nano-hydroxyapatite interactions in alginate-based microcapsule provide an appropriate osteogenic microenvironment for modular bone tissue formation. Carbohydr. Polym. 2022, 277, 118807. [Google Scholar] [CrossRef]
- Campos, J.M.; Sousa, A.C.; Caseiro, A.R.; Pedrosa, S.S.; Pinto, P.O.; Branquinho, M.V.; Amorim, I.; Santos, J.D.; Pereira, T.; Mendonça, C.M.; et al. Dental pulp stem cells and Bonelike(®) for bone regeneration in ovine model. Regen. Biomater. 2019, 6, 49–59. [Google Scholar] [CrossRef]
- Merimi, M.; El Majzoub, R.; Lagneaux, L.; Agha, D.; Fatima, B.; Meuleman, N.; Fahmi, H.; Lewalle, P.; Mohammad, F.-K.; Najar, M. The Therapeutic Potential of Mesenchymal Stromal Cells for Regenerative Medicine: Current Knowledge and Future Understandings. Front. Cell Dev. Biol. 2021, 9, 661532. [Google Scholar] [CrossRef]
- Aleynik, D.; Charykova, I.; Rubtsova, Y.; Linkova, D.; Farafontova, E.; Egorikhina, M. Specific Features of the Functional Activity of Human Adipose Stromal Cells in the Structure of a Partial Skin-Equivalent. Int. J. Mol. Sci. 2024, 25, 6290. [Google Scholar] [CrossRef]
- Sai, B.; Dai, Y.; Fan, S.; Wang, F.; Wang, L.; Li, Z.; Tang, J.; Wang, L.; Zhang, X.; Zheng, L.; et al. Cancer-educated mesenchymal stem cells promote the survival of cancer cells at primary and distant metastatic sites via the expansion of bone marrow-derived-PMN-MDSCs. Cell Death Dis. 2019, 10, 941. [Google Scholar] [CrossRef]
- Kemp, K.C.; Hows, J.; Donaldson, C. Bone marrow-derived mesenchymal stem cells. Leuk. Lymphoma 2005, 46, 1531–1544. [Google Scholar] [CrossRef]
- Foresti, R.; Rossi, S.; Pinelli, S.; Alinovi, R.; Sciancalepore, C.; Delmonte, N.; Selleri, S.; Caffarra, C.; Raposio, E.; Macaluso, G.; et al. In-vivo vascular application via ultra-fast bioprinting for future 5D personalised nanomedicine. Sci. Rep. 2020, 10, 3205. [Google Scholar] [CrossRef]
- Lai, J.; Wang, M. Developments of additive manufacturing and 5D printing in tissue engineering. J. Mater. Res. 2023, 38, 4692–4725. [Google Scholar] [CrossRef]
- Hassani, A.; Avci, Ç.B.; Kerdar, S.N.; Amini, H.; Amini, M.; Ahmadi, M.; Sakai, S.; Bagca, B.G.; Ozates, N.P.; Rahbarghazi, R.; et al. Interaction of alginate with nano-hydroxyapatite-collagen using strontium provides suitable osteogenic platform. J. Nanobiotechnol. 2022, 20, 310. [Google Scholar] [CrossRef] [PubMed]
- Ojeda, E.; García-Barrientos, Á.; Martínez de Cestafe, N.; Alonso, J.M.; Pérez-González, R.; Sáez-Martínez, V. Nanometric Hydroxyapatite Particles as Active Ingredient for Bioinks: A Review. Macromol 2022, 2, 20–29. [Google Scholar] [CrossRef]
- Li, N.; Guo, R.; Zhang, Z.J. Bioink Formulations for Bone Tissue Regeneration. Front. Bioeng. Biotechnol. 2021, 9, 630488. [Google Scholar] [CrossRef]
- Ferreira, M.J.S.L.M. Integrating 3D Bioprinting and Pluripotent Stem Cell Technologies for Articular Cartilage Tissue Engineering. Ph.D. Thesis, The University of Manchester, Manchester, UK, 2022. [Google Scholar]
- Chen, Z.-Y.; Gao, S.; Zhou, R.-B.; Wang, R.-D.; Zhou, F. Dual-crosslinked networks of superior stretchability and toughness polyacrylamide-carboxymethylcellulose hydrogel for delivery of alendronate. Mater. Des. 2022, 217, 110627. [Google Scholar] [CrossRef]
- Kajave, N.S.; Schmitt, T.; Nguyen, T.U.; Kishore, V. Dual crosslinking strategy to generate mechanically viable cell-laden printable constructs using methacrylated collagen bioinks. Mater. Sci. Eng. C Mater. Biol. Appl. 2020, 107, 110290. [Google Scholar] [CrossRef]
- Shehzad, A.; Mukasheva, F.; Moazzam, M.; Sultanova, D.; Abdikhan, B.; Trifonov, A.; Akilbekova, D. Dual-Crosslinking of Gelatin-Based Hydrogels: Promising Compositions for a 3D Printed Organotypic Bone Model. Bioengineering 2023, 10, 704. [Google Scholar] [CrossRef]
- Naranjo-Alcazar, R.; Bendix, S.; Groth, T.; Gallego Ferrer, G. Research Progress in Enzymatically Cross-Linked Hydrogels as Injectable Systems for Bioprinting and Tissue Engineering. Gels 2023, 9, 230. [Google Scholar] [CrossRef]
- Bercea, M. Rheology as a Tool for Fine-Tuning the Properties of Printable Bioinspired Gels. Molecules 2023, 28, 2766. [Google Scholar] [CrossRef]
- Kostenko, A.; Connon, C.J.; Swioklo, S. Storable Cell-Laden Alginate Based Bioinks for 3D Biofabrication. Bioengineering 2022, 10, 23. [Google Scholar] [CrossRef] [PubMed]
- Paar, A. Amplitude Sweeps. Available online: https://wiki.anton-paar.com/uk-en/amplitude-sweeps/#:~:text=The%20limit%20of%20the%20linear,with%20the%20lowest%20strain%20values (accessed on 1 December 2024).
- Kocen, R.; Gasik, M.; Gantar, A.; Novak, S. Viscoelastic behaviour of hydrogel-based composites for tissue engineering under mechanical load. Biomed. Mater. 2017, 12, 025004. [Google Scholar] [CrossRef] [PubMed]
- Shaabani, A.; Sedghi, R.; Motasadizadeh, H.; Dinarvand, R. Self-healable conductive polyurethane with the body temperature-responsive shape memory for bone tissue engineering. Chem. Eng. J. 2021, 411, 128449. [Google Scholar] [CrossRef]
- Martinez, A.W.; Caves, J.M.; Ravi, S.; Li, W.; Chaikof, E.L. Effects of crosslinking on the mechanical properties, drug release and cytocompatibility of protein polymers. Acta Biomater. 2014, 10, 26–33. [Google Scholar] [CrossRef]
- Yi, B.; Xu, Q.; Liu, W. An overview of substrate stiffness guided cellular response and its applications in tissue regeneration. Bioact. Mater. 2022, 15, 82–102. [Google Scholar] [CrossRef]
- Sharma, R.; Kirsch, R.; Valente, K.P.; Perez, M.R.; Willerth, S.M. Physical and Mechanical Characterization of Fibrin-Based Bioprinted Constructs Containing Drug-Releasing Microspheres for Neural Tissue Engineering Applications. Processes 2021, 9, 1205. [Google Scholar] [CrossRef]
- Moeinzadeh, S.; Jabbari, E. Gelation characteristics, physico-mechanical properties and degradation kinetics of micellar hydrogels. Eur. Polym. J. 2015, 72, 566–576. [Google Scholar] [CrossRef]
- Rizwan, M.; Chan, S.W.; Comeau, P.A.; Willett, T.L.; Yim, E.K.F. Effect of sterilization treatment on mechanical properties, biodegradation, bioactivity and printability of GelMA hydrogels. Biomed. Mater. 2020, 15, 065017. [Google Scholar] [CrossRef]
- Wu, Z.; Su, X.; Xu, Y.; Kong, B.; Sun, W.; Mi, S. Bioprinting three-dimensional cell-laden tissue constructs with controllable degradation. Sci. Rep. 2016, 6, 24474. [Google Scholar] [CrossRef]
- Wei, L.; Li, Z.; Li, J.; Zhang, Y.; Yao, B.; Liu, Y.; Song, W.; Fu, X.; Wu, X.; Huang, S. An approach for mechanical property optimization of cell-laden alginate-gelatin composite bioink with bioactive glass nanoparticles. J. Mater. Sci. Mater. Med. 2020, 31, 103. [Google Scholar] [CrossRef]
- Mao, Q.; Wang, Y.; Li, Y.; Juengpanich, S.; Li, W.; Chen, M.; Yin, J.; Fu, J.; Cai, X. Fabrication of liver microtissue with liver decellularized extracellular matrix (dECM) bioink by digital light processing (DLP) bioprinting. Mater. Sci. Eng. C 2020, 109, 110625. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Borrell, M.A.; Venerus, D.C.; Mieler, W.F.; Kang-Mieler, J.J. Characterization of biodegradable microsphere-hydrogel ocular drug delivery system for controlled and extended release of ranibizumab. Transl. Vis. Sci. Technol. 2019, 8, 12. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Huang, S.; Liu, Y.; Yao, B.; Hu, T.; Shi, H.; Xie, J.; Fu, X. Tuning Alginate-Gelatin Bioink Properties by Varying Solvent and Their Impact on Stem Cell Behavior. Sci. Rep. 2018, 8, 8020. [Google Scholar] [CrossRef] [PubMed]
- Noh, I.; Kim, N.; Tran, H.N.; Lee, J.; Lee, C. 3D printable hyaluronic acid-based hydrogel for its potential application as a bioink in tissue engineering. Biomater. Res. 2019, 23, 3. [Google Scholar] [CrossRef]
- Malektaj, H.; Drozdov, A.D.; deClaville Christiansen, J. Swelling of Homogeneous Alginate Gels with Multi-Stimuli Sensitivity. Int. J. Mol. Sci. 2023, 24, 5064. [Google Scholar] [CrossRef]
- Naomi, R.; Ridzuan, P.M.; Bahari, H. Current Insights into Collagen Type I. Polymers 2021, 13, 2642. [Google Scholar] [CrossRef]
- Iviglia, G.; Cassinelli, C.; Torre, E.; Baino, F.; Morra, M.; Vitale-Brovarone, C. Novel bioceramic-reinforced hydrogel for alveolar bone regeneration. Acta Biomater. 2016, 44, 97–109. [Google Scholar] [CrossRef]
- Fischer, L.; Nosratlo, M.; Hast, K.; Karakaya, E.; Ströhlein, N.; Esser, T.U.; Gerum, R.; Richter, S.; Engel, F.B.; Detsch, R.; et al. Calcium supplementation of bioinks reduces shear stress-induced cell damage during bioprinting. Biofabrication 2022, 14, 045005. [Google Scholar] [CrossRef]
- Du, L.; Qin, C.; Zhang, H.; Han, F.; Xue, J.; Wang, Y.; Wu, J.; Xiao, Y.; Huan, Z.; Wu, C. Multicellular Bioprinting of Biomimetic Inks for Tendon-to-Bone Regeneration. Adv. Sci. 2023, 10, 2301309. [Google Scholar] [CrossRef]
- Fideles, S.O.M.; Ortiz, A.C.; Assis, A.F.; Duarte, M.J.; Oliveira, F.S.; Passos, G.A.; Beloti, M.M.; Rosa, A.L. Effect of cell source and osteoblast differentiation on gene expression profiles of mesenchymal stem cells derived from bone marrow or adipose tissue. J. Cell. Biochem. 2019, 120, 11842–11852. [Google Scholar] [CrossRef]
- Kriegel, A.; Schlosser, C.; Habeck, T.; Dahmen, C.; Götz, H.; Clauder, F.; Armbruster, F.P.; Baranowski, A.; Drees, P.; Rommens, P.M.; et al. Bone Sialoprotein Immobilized in Collagen Type I Enhances Bone Regeneration In Vitro and In Vivo. Int. J. Bioprint. 2022, 8, 591. [Google Scholar] [CrossRef] [PubMed]
- Kriegel, A.; Langendorf, E.; Kottmann, V.; Kämmerer, P.W.; Armbruster, F.P.; Wiesmann-Imilowski, N.; Baranowski, A.; Gercek, E.; Drees, P.; Rommens, P.M.; et al. Bone Sialoprotein Immobilized in Collagen Type I Enhances Angiogenesis In Vitro and In Ovo. Polymers 2023, 15, 1007. [Google Scholar] [CrossRef] [PubMed]
- Ogata, Y. Bone sialoprotein and its transcriptional regulatory mechanism. J. Periodontal Res. 2008, 43, 127–135. [Google Scholar] [CrossRef] [PubMed]
- Van der Heide, D.; Hatt, L.P.; Della Bella, E.; Hangartner, A.; Lackington, W.A.; Yuan, H.; De Groot-Barrère, F.; Stoddart, M.J.; D’Este, M. Characterization and biological evaluation of 3D printed composite ink consisting of collagen, hyaluronic acid and calcium phosphate for bone regeneration. Carbohydr. Polym. Technol. Appl. 2024, 7, 100518. [Google Scholar] [CrossRef]
- Singh, A.; Gill, G.; Kaur, H.; Amhmed, M.; Jakhu, H. Role of osteopontin in bone remodeling and orthodontic tooth movement: A review. Prog. Orthod. 2018, 19, 18. [Google Scholar] [CrossRef]
- Liu, B.; Li, J.; Lei, X.; Cheng, P.; Song, Y.; Gao, Y.; Hu, J.; Wang, C.; Zhang, S.; Li, D.; et al. 3D-bioprinted functional and biomimetic hydrogel scaffolds incorporated with nanosilicates to promote bone healing in rat calvarial defect model. Mater. Sci. Eng. C 2020, 112, 110905. [Google Scholar] [CrossRef]
- Viguet-Carrin, S.; Garnero, P.; Delmas, P.D. The role of collagen in bone strength. Osteoporos. Int. 2006, 17, 319–336. [Google Scholar] [CrossRef]
- Gromolak, S.; Krawczenko, A.; Antończyk, A.; Buczak, K.; Kiełbowicz, Z.; Klimczak, A. Biological Characteristics and Osteogenic Differentiation of Ovine Bone Marrow Derived Mesenchymal Stem Cells Stimulated with FGF-2 and BMP-2. Int. J. Mol. Sci. 2020, 21, 9726. [Google Scholar] [CrossRef]
- Strassburg, S.; Richardson, S.M.; Freemont, A.J.; Hoyland, J.A. Co-culture induces mesenchymal stem cell differentiation and modulation of the degenerate human nucleus pulposus cell phenotype. Regen. Med. 2010, 5, 701–711. [Google Scholar] [CrossRef]
- Senior, J.J.; Cooke, M.E.; Grover, L.M.; Smith, A.M. Fabrication of Complex Hydrogel Structures Using Suspended Layer Additive Manufacturing (SLAM). Adv. Funct. Mater. 2019, 29, 1904845. [Google Scholar] [CrossRef]
- Moxon, S.R.; Cooke, M.E.; Cox, S.C.; Snow, M.; Jeys, L.; Jones, S.W.; Smith, A.M.; Grover, L.M. Suspended Manufacture of Biological Structures. Adv. Mater. 2017, 29, 1605594. [Google Scholar] [CrossRef] [PubMed]
- Minogue, B.M.; Richardson, S.M.; Zeef, L.A.; Freemont, A.J.; Hoyland, J.A. Characterization of the human nucleus pulposus cell phenotype and evaluation of novel marker gene expression to define adult stem cell differentiation. Arthritis Rheum. 2010, 62, 3695–3705. [Google Scholar] [CrossRef] [PubMed]
- Minogue, B.M.; Richardson, S.M.; Zeef, L.A.; Freemont, A.J.; Hoyland, J.A. Transcriptional profiling of bovine intervertebral disc cells: Implications for identification of normal and degenerate human intervertebral disc cell phenotypes. Arthritis Res. Ther. 2010, 12, R22. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Parameter (MPa) | Alginate | Alginate-nHA-Col (w/v) | p Value |
---|---|---|---|
Young’s Modulus | 7.33 ± 1.21 | 6.80 ± 0.835 | 0.567 |
Parameters | Values (Unit) |
---|---|
Needle Diameter | 600 µm |
Pressure | 0.02 MPa |
Feed Rate | 10 mm/s |
Filament Distance | 500 mm |
Thickness | 500 mm |
Solutions | Sodium Alginate (w/v) | nHA (w/v) | Col (w/v) |
---|---|---|---|
Alginate | 2 | - | - |
Alginate-nHA-Col | 2 | 0.5 | 0.5 |
Primer | Accession Number | Forward Primer Sequence 5′-3′ | Reverse Primer Sequence 5′-3′ | Concentration (nM) |
---|---|---|---|---|
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | NM_001256799 | CTCCTCTGACTTCAACAG | CGTTGTCATACCAGGAAA | 600 |
runt-related transcription factor 2 (RUNX2) | NM_001024630 | CGCTGCAACAAGACC | CGCCATGACAGTAACC | 900 |
alkaline phosphatase (ALPL) | NM_000478 | ACGTCTTCACATTTGGTG | GGTAGTTGTTGTGAGCATA | 450 |
integrin-binding sialoprotein (IBSP) | NM_004967 | GACTGCTTTAATTTTGCTCAG | GTCACTACTGCCCTGAAC | 600 |
secreted phosphoprotein-1 (SPP1) | NM_001040058 | CTGACATCCAGTACCCTG | CAGCTGACTCGTTTCATA | 600 |
collagen type 1 alpha 2 chain (COL1A2) | NM_000089 | TGAAGCTGGTCCCCAAGGA | AATACCAGGAGCGCGCCGTTG | 300 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sousa, A.C.; Mcdermott, G.; Shields, F.; Alvites, R.; Lopes, B.; Sousa, P.; Moreira, A.; Coelho, A.; Santos, J.D.; Atayde, L.; et al. Innovative Ink-Based 3D Hydrogel Bioprinted Formulations for Tissue Engineering Applications. Gels 2024, 10, 831. https://doi.org/10.3390/gels10120831
Sousa AC, Mcdermott G, Shields F, Alvites R, Lopes B, Sousa P, Moreira A, Coelho A, Santos JD, Atayde L, et al. Innovative Ink-Based 3D Hydrogel Bioprinted Formulations for Tissue Engineering Applications. Gels. 2024; 10(12):831. https://doi.org/10.3390/gels10120831
Chicago/Turabian StyleSousa, Ana Catarina, Grace Mcdermott, Fraser Shields, Rui Alvites, Bruna Lopes, Patrícia Sousa, Alícia Moreira, André Coelho, José Domingos Santos, Luís Atayde, and et al. 2024. "Innovative Ink-Based 3D Hydrogel Bioprinted Formulations for Tissue Engineering Applications" Gels 10, no. 12: 831. https://doi.org/10.3390/gels10120831
APA StyleSousa, A. C., Mcdermott, G., Shields, F., Alvites, R., Lopes, B., Sousa, P., Moreira, A., Coelho, A., Santos, J. D., Atayde, L., Alves, N., Richardson, S. M., Domingos, M., & Maurício, A. C. (2024). Innovative Ink-Based 3D Hydrogel Bioprinted Formulations for Tissue Engineering Applications. Gels, 10(12), 831. https://doi.org/10.3390/gels10120831