CRISPR/Cas9-Mediated Disruption of the pcz1 Gene and Its Impact on Growth, Development, and Penicillin Production in Penicillium rubens
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Strain and Culture Media
2.2. Selection of a Target Site for CRISPR/Cas9-Mediated Disruption of the pcz1 Gene
2.3. Construction of Plasmid pFC333-Pcpcz1 for CRISPR/Cas9-Mediated Disruption of pcz1 in P. rubens Wis 54-1255
2.4. Transformation of P. rubens Wis 54-1255 and Obtainment of Transformants
2.5. Growth, Conidiation, and Conidial Germination Analyses
2.6. Production of Benzylpenicillin and HPLC Analyses
2.7. qRT-PCR Analysis of the Expression of Penicillin Biosynthesis Genes
2.8. Phylogenetic Analysis of Pcz1
3. Results
3.1. Analysis of the pcz1 Gene and Deduced Protein from P. rubens Wis 54-1255
3.2. Generation of pcz1-Disrupted Strains of P. rubens Wis 54-1255 by CRISPR-Cas9
3.3. Morphological Features of the pcz1-Disrupted Strains of P. rubens Wis 54-1255
3.4. The Disruption of pcz1 Reduces Growth and Conidiation, but Promotes Conidial Germination in P. rubens Wis 54-1255
3.5. The Inactivation of pcz1 Reduces the Production of Penicillin and the Expression of the Penicillin Gene Cluster in P. rubens Wis 54-1255
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Houbraken, J.; Kocsubé, S.; Visagie, C.M.; Yilmaz, N.; Wang, X.C.; Meijer, M.; Kraak, B.; Hubka, V.; Bensch, K.; Samson, R.A.; et al. Classification of Aspergillus, Penicillium, Talaromyces and related genera (Eurotiales): An overview of families, genera, subgenera, sections, series and species. Stud. Mycol. 2020, 95, 5–169. [Google Scholar] [CrossRef] [PubMed]
- Houbraken, J.; Frisvad, J.C.; Samson, R.A. Fleming’s penicillin producing strain is not Penicillium chrysogenum but P. rubens. IMA Fungus 2011, 2, 87–95. [Google Scholar] [CrossRef]
- Fierro, F.; Vaca, I.; Castillo, N.I.; García-Rico, R.O.; Chávez, R. Penicillium chrysogenum, a vintage model with a cutting-edge profile in biotechnology. Microorganisms 2022, 10, 573. [Google Scholar] [CrossRef]
- García-Estrada, C.; Martín, J.F.; Cueto, L.; Barreiro, C. Omics approaches applied to Penicillium chrysogenum and penicillin production: Revealing the secrets of improved productivity. Genes 2020, 11, 712. [Google Scholar] [CrossRef] [PubMed]
- Sawant, A.M.; Vamkudoth, K.R. Biosynthetic process and strain improvement approaches for industrial penicillin production. Biotechnol. Lett. 2022, 44, 179–192. [Google Scholar] [CrossRef]
- El Hajj Assaf, C.; Zetina-Serrano, C.; Tahtah, N.; Khoury, A.E.; Atoui, A.; Oswald, I.P.; Puel, O.; Lorber, S. Regulation of secondary metabolism in the Penicillium genus. Int. J. Mol. Sci. 2020, 21, 9462. [Google Scholar] [CrossRef] [PubMed]
- Martín, J.F. Vacuolal and peroxisomal calcium ion transporters in yeasts and fungi: Key role in the translocation of intermediates in the biosynthesis of fungal metabolites. Genes 2022, 13, 1450. [Google Scholar] [CrossRef] [PubMed]
- Fierro, F.; García-Estrada, C.; Castillo, N.I.; Rodríguez, R.; Velasco-Conde, T.; Martin, J.F. Transcriptional and bioinformatics analysis of the 58.6 kb DNA region amplified in tandem repeats containing the penicillin gene cluster in Penicillium chrysogenum. Fungal Genet. Biol. 2006, 43, 618–629. [Google Scholar] [CrossRef]
- van den Berg, M.A.; Westerlaken, I.; Leeflang, C.; Kerkman, R.; Bovenberg, R.A.L. Functional characterization of the penicillin biosynthetic gene cluster of Penicillium chrysogenum Wisconsin 54-1255. Fungal Genet. Biol. 2007, 44, 830–844. [Google Scholar] [CrossRef]
- García-Estrada, C.; Domínguez-Santos, R.; Kosalková, K.; Martín, J.-F. Transcription factors controlling primary and secondary metabolism in filamentous fungi: The β-lactam paradigm. Fermentation 2018, 4, 47. [Google Scholar] [CrossRef]
- MacPherson, S.; Larochelle, M.; Turcotte, B. A fungal family of transcriptional regulators: The zinc cluster proteins. Microbiol. Mol. Biol. Rev. 2006, 70, 583–604. [Google Scholar] [CrossRef]
- van den Berg, M.A.; Albang, R.; Albermann, K.; Badger, J.H.; Daran, J.M.; Driessen, A.J.; Garcia-Estrada, C.; Fedorova, N.D.; Harris, D.M.; Heijne, W.H.; et al. Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat. Biotechnol. 2008, 26, 1161–1168. [Google Scholar] [CrossRef]
- Guzmán-Chávez, F.; Salo, O.; Nygård, Y.; Lankhorst, P.P.; Bovenberg, R.A.L.; Driessen, A.J.M. Mechanism and regulation of sorbicillin biosynthesis by Penicillium chrysogenum. Microb. Biotechnol. 2017, 10, 958–968. [Google Scholar] [CrossRef] [PubMed]
- Tudzynski, B. Nitrogen regulation of fungal secondary metabolism in fungi. Front. Microbiol. 2014, 5, 656. [Google Scholar] [CrossRef] [PubMed]
- Espeso, E.A.; Villarino, M.; Carreras, M.; Alonso-Guirado, L.; Alonso, J.M.; Melgarejo, P.; Larena, I. Altered nitrogen metabolism in biocontrol strains of Penicillium rubens. Fungal Genet. Biol. 2019, 132, 103263. [Google Scholar] [CrossRef]
- Gil-Durán, C.; Rojas-Aedo, J.F.; Medina, E.; Vaca, I.; García-Rico, R.O.; Villagrán, S.; Levicán, G.; Chávez, R. The pcz1 gene, which encodes a Zn(II)2Cys6 protein, is involved in the control of growth, conidiation, and conidial germination in the filamentous fungus Penicillium roqueforti. PLoS ONE 2015, 10, e0120740. [Google Scholar] [CrossRef]
- Rojas-Aedo, J.F.; Gil-Durán, C.; Goity, A.; Vaca, I.; Levicán, G.; Larrondo, L.F.; Chávez, R. The developmental regulator Pcz1 affects the production of secondary metabolites in the filamentous fungus Penicillium roqueforti. Microbiol. Res. 2018, 212–213, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Pohl, C.; Kiel, J.A.K.W.; Driessen, A.J.M.; Bovenberg, R.A.L.; Nygård, Y. CRISPR/Cas9 based genome editing of Penicillium chrysogenum. ACS Synth. Biol. 2016, 5, 754–764. [Google Scholar] [CrossRef]
- Pohl, C.; Polli, F.; Schütze, T.; Viggiano, A.; Mózsik, L.; Jung, S.; de Vries, M.; Bovenberg, R.A.L.; Meyer, V.; Driessen, A.J.M. A Penicillium rubens platform strain for secondary metabolite production. Sci. Rep. 2020, 10, 7630. [Google Scholar] [CrossRef]
- Mózsik, L.; Büttel, Z.; Bovenberg, R.A.L.; Driessen, A.J.M.; Nygård, Y. Synthetic control devices for gene regulation in Penicillium chrysogenum. Microb. Cell Fact. 2019, 18, 203. [Google Scholar] [CrossRef]
- Mózsik, L.; Hoekzema, M.; de Kok, N.A.W.; Bovenberg, R.A.L.; Nygård, Y.; Driessen, A.J.M. CRISPR-based transcriptional activation tool for silent genes in filamentous fungi. Sci. Rep. 2021, 11, 1118. [Google Scholar] [CrossRef]
- Del-Cid, A.; Gil-Durán, C.; Vaca, I.; Rojas-Aedo, J.F.; García-Rico, R.O.; Levicán, G.; Chávez, R. Identification and functional analysis of the mycophenolic acid gene cluster of Penicillium roqueforti. PLoS ONE 2016, 11, e0147047. [Google Scholar] [CrossRef]
- Fierro, F.; Montenegro, E.; Gutiérrez, S.; Martín, J.F. Mutants blocked in penicillin biosynthesis show a deletion of the entire penicillin gene cluster at a specific site within a conserved hexanucleotide sequence. Appl. Microbiol. Biotechnol. 1996, 44, 597–604. [Google Scholar] [CrossRef]
- Stemmer, M.; Thumberger, T.; Del Sol Keyer, M.; Wittbrodt, J.; Mateo, J.L. CCTop: An intuitive, flexible and reliable CRISPR/Cas9 target prediction tool. PLoS ONE 2015, 10, e0124633. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Ouedraogo, J.-P.; Kolbusz, M.; Nguyen, T.T.M.; Tsang, A. Efficient genome editing using tRNA promoter-driven CRISPR/Cas9 gRNA in Aspergillus niger. PLoS ONE 2018, 13, e0202868. [Google Scholar] [CrossRef] [PubMed]
- van Leeuwe, T.M.; Arentshorst, M.; Ernst, T.; Alazi, E.; Punt, P.J.; Ram, A.F.J. Efficient marker free CRISPR/Cas9 genome editing for functional analysis of gene families in filamentous fungi. Fungal Biol. Biotechnol. 2019, 6, 13. [Google Scholar] [CrossRef] [PubMed]
- Nødvig, C.S.; Nielsen, J.B.; Kogle, M.E.; Mortensen, U.H. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS ONE 2015, 10, e0133085. [Google Scholar] [CrossRef]
- Chávez, R.; Roa, A.; Navarrete, K.; Trebotich, J.; Espinosa, Y.; Vaca, I. Evaluation of properties of several cheese-ripening fungi for potential biotechnological applications. Mycoscience 2010, 51, 84–87. [Google Scholar] [CrossRef]
- Ivey, F.D.; Hodge, P.N.; Turner, G.E.; Borkovich, K.A. The Gαi homologue gna-1 controls multiple differentiation pathways in Neurospora crassa. Mol. Biol. Cell. 1996, 7, 1283–1297. [Google Scholar] [CrossRef]
- García-Rico, R.O.; Martín, J.F.; Fierro, F. The pga1 gene of Penicillium chrysogenum NRRL 1951 encodes a heterotrimeric G protein alpha subunit that controls growth and development. Res. Microbiol. 2007, 158, 437–446. [Google Scholar] [CrossRef]
- Pérez, E.A.; Fernández, F.J.; Fierro, F.; Mejía, A.; Marcos, A.T.; Martín, J.F.; Barrios-González, J. Yeast HXK2 gene reverts glucose regulation mutation of penicillin biosynthesis in P. chrysogenum. Braz. J. Microbiol. 2014, 45, 873–883. [Google Scholar] [CrossRef] [PubMed]
- García-Estrada, C.; Vaca, I.; Lamas-Maceiras, M.; Martín, J.F. In vivo transport of the intermediates of the penicillin biosynthetic pathway in tailored strains of Penicillium chrysogenum. Appl. Microbiol. Biotechnol. 2007, 76, 169–182. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Kosalková, K.; García-Estrada, C.; Ullán, R.V.; Godio, R.P.; Feltrer, R.; Teijeira, F.; Mauriz, E.; Martín, J.F. The global regulator LaeA controls penicillin biosynthesis, pigmentation and sporulation, but not roquefortine C synthesis in Penicillium chrysogenum. Biochimie 2009, 91, 214–225. [Google Scholar] [CrossRef]
- Domínguez-Santos, R.; Martín, J.F.; Kosalková, K.; Prieto, C.; Ullán, R.V.; García-Estrada, C. The regulatory factor PcRFX1 controls the expression of the three genes of β-lactam biosynthesis in Penicillium chrysogenum. Fungal Genet. Biol. 2012, 49, 866–881. [Google Scholar] [CrossRef]
- Pérez-Pérez, W.D.; Carrasco-Navarro, U.; García-Estrada, C.; Kosalková, K.; Gutiérrez-Ruíz, M.C.; Barrios-González, J.; Fierro, F. bZIP transcription factors PcYap1 and PcRsmA link oxidative stress response to secondary metabolism and development in Penicillium chrysogenum. Microb. Cell Fact. 2022, 21, 50. [Google Scholar] [CrossRef] [PubMed]
- Domínguez-Santos, R.; García-Estrada, C.; Kosalková, K.; Prieto, C.; Santamarta, I.; Martín, J.F. PcFKH1, a novel regulatory factor from the forkhead family, controls the biosynthesis of penicillin in Penicillium chrysogenum. Biochimie 2015, 115, 162–176. [Google Scholar] [CrossRef] [PubMed]
- Böhm, J.; Hoff, B.; O’Gorman, C.M.; Wolfers, S.; Klix, V.; Binger, D.; Zadra, I.; Kürnsteiner, H.; Pöggeler, S.; Dyer, P.S.; et al. Sexual reproduction and mating-type-mediated strain development in the penicillin-producing fungus Penicillium chrysogenum. Proc. Natl. Acad. Sci. USA 2013, 110, 1476–1481. [Google Scholar] [CrossRef]
- Sigl, C.; Haas, H.; Specht, T.; Pfaller, K.; Kürnsteiner, H.; Zadra, I. Among developmental regulators, StuA but not BrlA is essential for penicillin V production in Penicillium chrysogenum. Appl. Environ. Microbiol. 2011, 77, 972–982. [Google Scholar] [CrossRef]
- Chang, P.K.; Ehrlich, K.C. Genome-wide analysis of the Zn(II)2Cys6 zinc cluster-encoding gene family in Aspergillus flavus. Appl. Microbiol. Biotechnol. 2013, 97, 4289–4300. [Google Scholar] [CrossRef]
- Choudhury, B.I.; Whiteway, M. Evolutionary transition of GAL regulatory circuit from generalist to specialist function in Ascomycetes. Trends Microbiol. 2018, 26, 692–702. [Google Scholar] [CrossRef] [PubMed]
- Khan, R.; Ghazali, F.M.; Mahyudin, N.A.; Samsudin, N.I.P. Aflatoxin biosynthesis, genetic regulation, toxicity, and control strategies: A review. J. Fungi 2021, 7, 606. [Google Scholar] [CrossRef] [PubMed]
- Coton, E.; Coton, M.; Hymery, N.; Mounier, J.; Jany, J.-L. Penicillium roqueforti: An overview of its genetics, physiology, metabolism and biotechnological applications. Fungal Biol. Rev. 2020, 34, 59–73. [Google Scholar] [CrossRef]
- García-Rico, R.O.; Fierro, F.; Mauriz, E.; Gómez, A.; Fernández-Bodega, M.A.; Martín, J.F. The heterotrimeric Gα protein Pga1 regulates biosynthesis of penicillin, chrysogenin and roquefortine in Penicillium chrysogenum. Microbiology 2008, 154, 3567–3578. [Google Scholar] [CrossRef]









| Name of the Primer | Sequence (5′---3′) | Used for: |
|---|---|---|
| Conf-Pcz1-CRISPR-FW Conf-Pcz1-CRISPR-RV | TCAACCACTACACACCCC GAACGCCATCAGATCCG | Amplification of the target sequence of the pcz1 gene |
| qPCR-pcbAB-fw qPCR-pcbAB-rv | ACGACAACTTCTTCCGCCTA AGATGCTGACCGAGAGTCGT | pcbAB gene expression analysis by qRT-PCR |
| qPCR-pcbC-fw qPCR-pcbC-rv | GACGTGTCGCTCATTACCGT AATTGACCAGGTAGGCGTTG | pcbC gene expression analysis by qRT-PCR |
| qPCR-penDE-fw qPCR-penDE-rv | CATCCTCTGTCAAGGCACTCC CCATCTTTCCTCGATCACGC | penDE gene expression analysis by qRT-PCR |
| qRT-btub-fw qRT-btub-rv | TCCAAGGTTTCCAGATCACC GAACTCCTCACGGATCTTGG | β-tubulin gene expression analysis by qRT-PCR |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gil-Durán, C.; Palma, D.; Marcano, Y.; Palacios, J.-L.; Martínez, C.; Rojas-Aedo, J.F.; Levicán, G.; Vaca, I.; Chávez, R. CRISPR/Cas9-Mediated Disruption of the pcz1 Gene and Its Impact on Growth, Development, and Penicillin Production in Penicillium rubens. J. Fungi 2023, 9, 1010. https://doi.org/10.3390/jof9101010
Gil-Durán C, Palma D, Marcano Y, Palacios J-L, Martínez C, Rojas-Aedo JF, Levicán G, Vaca I, Chávez R. CRISPR/Cas9-Mediated Disruption of the pcz1 Gene and Its Impact on Growth, Development, and Penicillin Production in Penicillium rubens. Journal of Fungi. 2023; 9(10):1010. https://doi.org/10.3390/jof9101010
Chicago/Turabian StyleGil-Durán, Carlos, Diego Palma, Yudethzi Marcano, José-Luis Palacios, Claudio Martínez, Juan F. Rojas-Aedo, Gloria Levicán, Inmaculada Vaca, and Renato Chávez. 2023. "CRISPR/Cas9-Mediated Disruption of the pcz1 Gene and Its Impact on Growth, Development, and Penicillin Production in Penicillium rubens" Journal of Fungi 9, no. 10: 1010. https://doi.org/10.3390/jof9101010
APA StyleGil-Durán, C., Palma, D., Marcano, Y., Palacios, J.-L., Martínez, C., Rojas-Aedo, J. F., Levicán, G., Vaca, I., & Chávez, R. (2023). CRISPR/Cas9-Mediated Disruption of the pcz1 Gene and Its Impact on Growth, Development, and Penicillin Production in Penicillium rubens. Journal of Fungi, 9(10), 1010. https://doi.org/10.3390/jof9101010

