Next Article in Journal
Ras2 Is Responsible for the Environmental Responses, Melanin Metabolism, and Virulence of Botrytis cinerea
Previous Article in Journal
The Mortality Attributable to Candidemia in C. auris Is Higher than That in Other Candida Species: Myth or Reality?
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Characterization of Effector Protein-Encoding Genes in Sclerospora graminicola and Its Validation in Response to Pearl Millet Downy Mildew Disease Stress

1
Laboratory of Plant Healthcare and Diagnostics, PG Department of Biotechnology and Microbiology, Karnatak University, Dharwad 580003, India
2
Division of Biological Sciences, School of Science and Technology, University of Goroka, Goroka 441, Papua New Guinea
3
Department of Studies in Biotechnology, University of Mysore, Manasagangotri, Mysuru 570006, India
4
Department of Zoology, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451, Saudi Arabia
5
Research Center for Thermotolerant Microbial Resources, Yamaguchi University, Yamaguchi 753-8515, Japan
6
Department of Environmental Science, Central University of Kerala, Tejaswini Hills, Periye (PO) 671316, Kasaragod (DT), Kerala, India
*
Author to whom correspondence should be addressed.
J. Fungi 2023, 9(4), 431; https://doi.org/10.3390/jof9040431
Submission received: 9 February 2023 / Revised: 28 March 2023 / Accepted: 28 March 2023 / Published: 31 March 2023
(This article belongs to the Section Fungi in Agriculture and Biotechnology)

Abstract

Pearl millet [Pennisetum glaucum (L.) R. Br.] is the essential food crop for over ninety million people living in drier parts of India and South Africa. Pearl millet crop production is harshly hindered by numerous biotic stresses. Sclerospora graminicola causes downy mildew disease in pearl millet. Effectors are the proteins secreted by several fungi and bacteria that manipulate the host cell structure and function. This current study aims to identify genes encoding effector proteins from the S. graminicola genome and validate them through molecular techniques. In silico analyses were employed for candidate effector prediction. A total of 845 secretory transmembrane proteins were predicted, out of which 35 proteins carrying LxLFLAK (Leucine–any amino acid–Phenylalanine–Leucine–Alanine–Lysine) motif were crinkler, 52 RxLR (Arginine, any amino acid, Leucine, Arginine), and 17 RxLR-dEER putative effector proteins. Gene validation analysis of 17 RxLR-dEER effector protein-producing genes was carried out, of which 5genes were amplified on the gel. These novel gene sequences were submitted to NCBI. This study is the first report on the identification and characterization of effector genes in Sclerospora graminicola. This dataset will aid in the integration of effector classes that act independently, paving the way to investigate how pearl millet responds to effector protein interactions. These results will assist in identifying functional effector proteins involving the omic approach using newer bioinformatics tools to protect pearl millet plants against downy mildew stress. Considered together, the identified effector protein-encoding functional genes can be utilized in screening oomycetes downy mildew diseases in other crops across the globe.

1. Introduction

Effectors are proteins secreted by several fungi and bacteria that manipulate the host cell structure and function. They are reported to cause infection or induce defense responses in the host [1,2]. This contradictory nature of effectors has been encountered in many fungal and bacterial plant diseases [3,4]. Depending on where they are found inside the host plant, effectors are categorized into two types: cytoplasmic and apoplastic. In the plant extracellular spaces, apoplastic effectors are released, whereas cytoplasmic effectors, on the other hand, are discharged within the plant cytoplasm via the pathogen’s specialized structures, such as haustoria and vesicles. The delivery methods of effectors in fungi and oomycetes are yet unknown [5]. Effector delivery has been linked to conserved sequence motifs in the sequence divergent oomycete effectors [6]. The classification of fungal effectors based on sequence characteristics and conserved motifs poses a major challenge [7]. A ‘pathogen’s effectome (sometimes referred to as effectorome) is the repertoire of all its effector proteins [8]. The cytoplasmic RxLR effectors consist of conserved N-terminal 4 amino acids, RxLR (Arginine, any amino acid, Leucine, Arginine) motif [9], followed by a dEER (Aspartic acid, Glutamic acid, Glutamic acid-Arginine) motif [10,11,12]. The crinkler cytoplasmic effector contains LxLFLAK (Leucine–any amino acid–Phenylalanine–Leucine–Alanine–Lysine) motif [12,13,14]. The migration of effectorsfurther into a plant is found to be dependent on these motifs [15]. In the Peronosporales clade, which includes downy mildew pathogens, numerous RxLR effectors were reported [16,17]. The intrinsic disorder of oomycete RxLR protein is a typical feature [18,19]. Several evolutionary mechanisms that can drive RxLR effector diversity within Peronosporales have been documented, including gene recombination, duplication events, and point mutations [20,21]. Although sequence motif and Hidden Markov Model searches are well-established approaches in oomycetes for predicting certain classes of cytoplasmic effectors, they overlook genuine effectors without such motifs, domains, or apoplastic effectors [22].
Plant diseases caused by fungus and oomycetes are devastating. These eukaryotic filamentous pathogens produce effector proteins that infect the plant body. The fungal and oomycete pathogens have different infection methods, and their effectors differ considerably in sequence homology. However, they share similar host habitats, plant apoplasts, or cytoplasms and hence may share some unifying qualities based on the host compartments’ requirements [23]. A typical example of an oomycete pathogen is Sclerospora graminicola, which causes downy mildew (green ear) disease in pearl millet [24] with 20–80% yield loss [25]. Downy mildew occurrence has been moderately adaptable on diverse hybrids, and more than 90% incidence has been noted on some crosses in ‘farmers’ fields [26,27]. The spread of downy mildew disease is favored by high relative humidity (85–90%) with moderate temperatures (20–30 °C). They are included in a heterogeneous group of obligatory biotrophs that infect economically important crops such as grapevines [28], sorghum [29], and pearl millet [25]. These physiognomies of the fungus make it exceptionally flexible and adjustable to varied environmental situations [30,31].
Despite the economic importance of the disease caused by Sclerospora graminicola, the functional annotation of the genome has not been documented, and their effector report is unknown. Additionally, there is a lack of literature on the role of effector proteins in S. graminicola and its expression data. Hence, the current investigation was carried out to identify and characterize the candidate effector proteins of S. graminicola by data mining and computational analysis and validation through molecular techniques.

2. Materials and Methods

2.1. GeneMark-ES Suite

The draft genome of Sclerospora graminicola was recovered from https://www.ncbi.nlm.nih.gov/bioproject/PRJNA325098/ (accessed on 27 August 2021) to predict genes and proteins using the GeneMark-ES suite. The ES and fungus flags were used with GeneMark script to enable self-training and branch point model to predict genes with default parameters, and the following measures were used to include the sequence containing the gene in the test set: a. The gene must have an initiator codon ATG, a conical acceptor/donor site; b. Intron/exon assembly must be reinforced by expressed sequence tag/complementary deoxyribonucleic acid [32,33]; c. The annotationdoes have to include substitute isoforms accompanied by EST/cDNA; d. There must be no gene overlap with any other genes that have been annotated; e. Multiple-gene sequences are more suitable for precision evaluation [34,35].

2.2. Identification of Signal Peptides (SP) in the N-Terminal Region

SignalP 6.0 (services.healthtech.dtu.dk/services/SignalP-6.0/) (accessed on 23 March 2022) was used to detect signal peptides (SP) in the N-terminal region. The amino acid sequence was converted into FASTA format and pasted in the given empty box given. Furthermore, appropriate options were selected, and the command line “signalpinput.fasta” was submitted. The results showed predicted SP and the position of the cleavage site [36,37,38].

2.3. Target P Server

The sequences obtained from SignalP 6.0 were evaluated by TargetP v1.1 (http://www.cbs.dtu.dk/services/TargetP/) (accessed on 1 December 2021) [39] for their sub-cellular location based on N-terminal pre-sequences (at least the first 130 amino acids of the N-terminus required). The input data was a one-letter amino acid code reset; other symbols got converted to X before processing, and a non-plant option was selected before submitting the input [40,41,42].

2.4. TMHMM v2.0

The input sequences were in FASTA format with functional and secretory pathway proteins, and signal peptides were checked for the presence of transmembrane domains by TMHMM v2.0 (https://services.healthtech.dtu.dk/service.php?TMHMM-2.0) (accessed on 3 January 2022) [43,44,45]. Proteins with 0 and 1 TM domains (an N-terminal signal peptide) were combined to get the secretome of Sclerospora graminicola. Further, LxLFLAK and RxLR motifs were searched in secretome proteins using pattern matches to identify crinkler (CRN) and RxLR proteins, and all the results were cross verified with EffectorP 3.0 (http://effectorp.csiro.au/) tool (accessed on 27 April 2022) [23]. The protein sequences were translated to their respective gene sequence, and a similarity search was carried out using the Basic Local Alignment Search Tool (BLAST) of NCBI (https://blast.ncbi.nlm.nih.gov/) (accessed on 18 November 2022).

2.5. Host and Pathogen

The downy mildew pathogen, Sclerospora graminicola, was isolated from a highly susceptible pearl millet host cultivar (7042S) grown in earthen pots (12–15 cm diameter) under greenhouse conditions. The pathogen was maintained on the same host throughout the experiment.

2.6. Extraction of RNA from Scelrospora Graminicola and cDNA Synthesis

The genomic DNA of the host plant was isolated from susceptible pearl millet leaves, as described by Divya et al. [46]. Leaf samples were collected from Sclerospora graminicola-infected pearl millet plants, rinsed with water to eliminate unwanted dirt and dust, and cleaned with sterile tissue paper. Clean leaves were stapled onto wet blotter disc and placed on the upper lid of a sterile Petri dish. The sterile Petri dish was filled with 15 mL of sterile water and incubated overnight at a temperature of 18–20 °C. During the early hours, spores were collected in the lower lid of the Petri dish and centrifuged at 5000 rpm for 5 min. Total RNA extraction processes were initiated by repeatedly washing the zoospores three times in sterile distilled water. The zoospores were washed thrice in sterile distilled water, and total RNA extraction was executed with the aid of RNAeasy plant micro kit as per manufacturer instructions (Qiagen, Hilden, Germany). Total RNA isolated from S. graminicola was checked for its purity at the absorbance of A260/A280 in Ultraviolet-visible spectroscopy of Agilent (Cary 60 UV-Vis). The cDNA synthesis was performed with RNA templates using oligo (dT) 18 primers (ThermoFisher, Madison, WI, USA).

2.7. Primer Designing

For gene validation, PCR primers for a subset of anticipated full-length RxLR-dEER coding genes were designed and synthesized (Sigma-Aldrich Chemicals Pvt. Ltd., Bangalore, India). The designed primers used in this present study are mentioned in Table 1. Briefly, the full length of the effector protein-encoding nucleotide sequence from the genome was designed manually by selecting a few nucleotides from the site of initiation and the site of termination. A few nucleotides were selected based on the reverse complement tool. To calculate the melting temperature of the primer, we used the percent GC Oligocalc tool.

2.8. PCR Amplification

Polymerase Chain Reaction (PCR) experiments were carried out in a thermal cycler (C1000 Touch, part no, #1851148, BioRad, Philadelphia, PA, USA) on cDNA, and only the successfully amplified and reproducible segments were analyzed after the procedure was repeated thrice for each isolate individually. Deoxyribonucleic acid amplification was conducted in a 20 µL reaction mixture containing 0.2 mM of primer and dNTPs, 0.6 units Taq pol (Banglore Genei, Bengaluru, India), 10 mM of tris hydrochloride (pH 9.0), 1.5 mM magnesium chloride, 50 mM potassium chloride, and 50 ng DNA. PCR cycling settings were as follows: initial denaturation at 94 °C for 4 min followed by 40 cycles of 1 min at 94 °C, 1 min at primer-specific annealing temperature (Table 1), and 2min at 72 °C, with final extension for 10 min at 72 °C. The amplicons were electrophoresed on an agarose gel after adding bromophenol blue on 1.5% agarose gel stained with EtBr using 1 Tris-borate Ethylene diamine tetra-acetic acid buffer pH 8.3 [47]. A 1 kb DNA Ladder (part no: G571A, Promega Corporation, Madison, WI, USA) was used as molecular weight marker (m) at 60–65 V. The gel slab was removed and visualized under a molecular imager (Gel Doc imaging systems XR+, BIO RAD).
The amplicons were extracted from the gel with a sharp, sterile scalpel blade when the gel was illuminated with a UV-transilluminator (70%). The dissected gel fragments were added to a clean 2 mL microcentrifuge tube that had been pre-weighed. According to the technique provided, with the help of PureLink Quick Gel Extraction Kit (Cat.No.K210012, Invitrogen, Waltham, MA, USA), the required amplicon was recovered off the agarose gel, and the eluted product was subjected to Sanger sequencing (3730 DNA Analyzer 48-Capillary Array). The results were BLAST analyzed in NCBI for homology with any RxLR effector protein-encoding genes. The amplified nucleotide sequences of RxLR-dEER effectors were retrieved from the direct sequencing and converted to their respective amino acid sequences using the Translate tool, and the sequences with 5′ to 3′, which had no gap, were selected. Screening of RxLR and dEER motif was carried out manually, and the intrinsic disorder of the respective proteins was investigated based on the predicted output of the PONDAR VL-XT tool [48,49].

3. Results

3.1. Secretome Mapping

Protein sequences were obtained from Genemark-ES software and used as inputs for SignalP 6.0 to identify secretory proteins. Signal peptides, identified by SignalP 6.0, were present in 935 protein sequences. Out of 935 proteins, 911 were predicted to be involved in secretory pathway signal peptides as per TargetP v1.1.TMHMM v2.0 was used, which predicted 845 secretory proteins in which 803 proteins had 0 TM, and 42 proteins had 1 TM domain (an N-terminal signal peptide) as output. One of the requirements for classifying a protein as an effector is that it secretes extracellularly through the N-terminal secretion signal [50,51]. It was observed that in 35 proteins, LxLFLAK motifs were present, and 152 proteins had RxLR motifs.

3.2. Annotation for Crinklerand RxLR Effectors

Leucine–any amino acid–Phenylalanine–Leucine–Alanine–Lysine (LxLFLAK) motifs were present in 35 proteins and were labeled as crinkler (CRN) effector proteins. Furthermore, RxLR proteins were filtered based on the criteria that these motifs are present within 30–60 amino acids after signal cleavage site, and cleavage site is present within 30 amino acids using in-house pearl scripts [52,53]. This led to the identification of 69 RxLR motifs containing proteins that are designated as RxLR and further RxLR effectors carrying dEER motifs were screened, and 17 were identified based on the dEER motifs they were carrying in amino acid sequence after RxLR motifs (Figure 1).

3.3. EffectorP Machine Learning

All the predicted proteins were cytoplasmic effectors with 0 to 1 values. Interestingly, 4 CRN effectors (1492_g, 10105_g, 42778_g, and 53743_g) out of 35 (Table 2), 5 RxLR effectors (12504_g, 11898_g, 59897_g, 63043_g, and 64364_g) out of 52 (Table 3), and 1RxLR-dEER effector (1854_g) out of 17 were predicted as non-effector by EffectorP 3.0 tool. In addition, 7856_g (Table 4) was predicted to be a cytoplasmic effector and apoplastic effector.

3.4. Similarity Search Using NCBI BLAST Tool

The predicted Crinkler and RxLR nucleotide sequences were subjected to NCBI BLAST search. Out of 35 crinkler (CRN) genes, 9 had similarity with Phytophthora sojae strain P6479, 10 with Plasmopara halstedii, 3 with Phytophthora infestans T30-4, 3 with Lagenidium giganteum f. caninum, and 10 had no similarity with any of the genes in the database. Out of 52 RxLR genes, only one gene had a similarity with Plasmopara halstedii, the rest of the 51 had no similarity, and all 17 RxLR-dEER effectors had no similarity in the NCBI database. However, the translated RxLR protein sequence showed similarity with other proteins found in the NCBI database (Supplementary Table S1; Supplementary Figures S1–S5).

3.5. Confirmation of the Presence of RxLR-dEER Effectors Genes

Total RNA isolated from S. graminicola had a purity of 1.80 at the absorbance of A260/A280 in Cary 60 UV-Vis, an Ultraviolet-visible spectrophotometer by Agilent. The amplicons of all the 17 RxLR-dEER protein-coding genes were subjected to 1.5% agarose gel electrophoresis along with host DNA (Pennisetum glaucum), a ladder of 1 kb. Interestingly, only 5bands (6877_g, 60945_g, 8311_g, 35983_g, and 60741_g) were visible at 885, 1248, 1254, 1410, and 1533 base pairs, respectively (Figure 2). These five genes were BLAST analyzed in the NCBI database for homology with any RxLR effectors. All five amplicons had no significant similarity in the NCBI database. Hence, the amplified sequences were submitted to NCBI Gene Bank (Table 5).

3.6. Analysis of Overall Disorder Regions in RxLR-dEER Effector Proteins Using PONDR VL-XT

The nucleotide sequences of the five amplicons were translated to their respective amino acid sequences using the bioinformatics tool Translate, and the sequences were selected in the frame of 5′ to 3′endswith no gaps in it and at least having one open reading frame (ORF). The disordered content in predicted RxLR-dEER proteins ranged from 46.17% to 25.05% (Figure 3A–E), and the mean disorder content was 33.928% (Table 6). The sequence features and predicted domains of the five novel effector proteins are presented in Figure 4 and Table 7.

4. Discussion

Pathogens release effector proteins into the plant apoplast or transport them into the host cytoplasm, where they inhibit defense responses or change host metabolism [51,54]. The oomycete cytoplasmic RxLR and crinkler (CRN) effector classes are well documented based on the modular structure [55]. CRNs are a deep-rooted family of effectors discovered in various oomycete species with different evolutionary relationships [15]. In this present study, we discovered 104 effector-encoding genes in S. graminicola. A similar study carried out by Muller et al. [56] found 844 putative effector genes in Blumeria graminis f. sp. tritici. Huang et al. [57] used bioinformatic prediction approaches to identify 316 candidates secreted effector proteins (CSEPs) in the complete genome of Fusarium sacchari. A total of 95 CSEPs, spanning 40 superfamilies and 18 domains, had known conserved structures, while another 91 CSEPs comprised 7 recognized motifs. A total of 14 of the 130 CSEPs with no known domains or motifs had 1 of 4 unique motifs. The roles of 163 CSEPs were investigated using a heterogeneous expression system in Nicotianabenthamiana. In N. benthamiana, seven CSEPs reduced BAX-triggered programmed cell death, while four caused cell death. These eleven CSEPs’ expression characteristics during F. sacchari infection revealed that they could be involved in sugarcane-F. sacchari interaction. The B. graminis f. sp. tritici, the powdery mildew pathogen of the wheat, genome sequence revealed that it encoded 7588 proteins that coded genes in 180 Mb genomic size. B. graminis f. sp. hordei genome has 5854 protein-coding genes [58]. A total of 660 and 620 secretory proteins were recognized in 2 individual races, 77 and 106, of Puccinia triticina, respectively [59]. Our analysis of S. graminicola predicted that 845 out of 79,754 proteins are secretory trans-membrane proteins. Furthermore, out of these secretory proteins, 35 CRN effector and 69 RxLR effector proteins were identified. This is the first report on the identification and characterization of effector genes in Sclerospora graminicola, a downy mildew agent affecting Pennisetum glaucum.
From this present work, it is evident that the genome of S. graminicola has only thirty-five crinkler (CRN) effectors proteins present. This might be because oomycetes are known to secrete CRN without a traditional signal peptide via an unusual secretion pathway. Because CRNs are known to cause necrosis, which is unfavorable to biotrophy, the lower CRN level in downy mildew pathogens could indicate an adaptation to biotrophy [17]. Moreover, 152 RxLR motifs contained effector proteins, out of which 69 had RxLR motifs within 30–60 amino acid sequences present after the signal cleavage site and cleavage site within 30 amino acids [52] in S. graminicola. In the future, a better understanding of fungal effector function and the underlying mechanisms and the application of host-induced gene silencing technology to generate disease-resistant crops could be an effective method for preventing and controlling plant illnesses [60].
The pathogenicity factors of downy mildew pathogens with the N-terminal RxLR motif are the best understood. Purayannur et al. [17] reported 296 RxLR effectors in P. humuli. Similarly, Tyler et al. [61] discovered 350 RxLR effectors in Phytophthora sojae and P. ramorum genomes, respectively. At least fifty downy mildew effectors have been discovered in Hyaloperonospora parasitica by Morgan and Kamoun [62]. Kamoun [63] reported 200 effectors in P. sojae, P. capsici, P. infestans, and P. ramorum, respectively. Baxter et al. [14] found 130 genes in H. arabidopsidis expressing putative effector proteins with RxLR dEER motifs. In a different study, Cai et al. [64] reported that the virulence of the bacterial pathogen, Aeromonas salmonicida is highly dependent on the effector protein hcp gene for its pathogenicity. In this study, the hypersensitive reaction was indicated by the development of necrotic areas on the resistant pearl millet callus within 2 h post inoculation, thus triggering defense signaling responses in the neighboring cells.
This study witnessed RxLR-dEER protein 35893_g (OM365913) had the highest disordered residues of 46.17% in the secretome of S. graminicola. Similarly, in a different investigation, it was reported that P. sojae had an average of 63% of disordered amino acid residues as RxLR-dEER proteins have a unique amino acid makeup and are high in disorder-promoting residue, and the disordered structure of the effectors may boost their pathogenic ability. Thus, proteins could interface with plant proteins to imitate host defense signaling molecules and control plant physiological responses [19,65,66]. Parallel to the genomic investigations that paved the way for studying effector and pathogen genetics, transcriptome analyses on biotrophs are popular; it has also improved pathogen understanding by bringing transcriptome research and genome-slicing investigations, employing complementary DNA libraries. Because biotroph effector molecules are generally unique and have little resemblance to existing proteins, selecting candidates based solely on sequences becomes more difficult [67]. Hacquard et al. [68] discovered a multistep mode of action of mildew candidate secretory effector proteins (CSEPs) in powdery mildew pathogenesis on barley and immune compromised Arabidopsis, with a first wave of CSEP transcripts accumulating during host cell entry (12 h) and a second wave of transcripts accumulating at the stage of haustorium formation (24 h). In wheat powdery mildew, a comparable high induction of CSEPs was seen during the haustorial stage [69].

5. Conclusions

Obligate biotrophs are among the fastest developing pathogens; they might use many mechanisms driving effector development or encode a high quantity of nontypically discharged effector-producing genes. Transcripts jammed with the host nucleotide sequences may obscure effector detection as these organisms tightly govern effector regulations and analyze expression in diseased plants. Effector proteins have an extremely varied sequence, and almost no protein has a resemblance to identified effectors. In this present study, Gene mark ES suite, SignalP 6.0, TargetP, and TMHMM v.2.0 could define the ‘organism’s entire secretome from the projected proteomes, and Effector 3.0 positively correlated with the results of the above tools. This study clearly shows that the genome of Sclerospora graminicola comprises two classes of effectors that are RxLR and crinkler (CRN), of which five of the novel RxLR with dEER motif effector proteins are documented in the NCBI database. Furthermore, the presence of intrinsic disorder in these proteins is a unique structural property of RxLR proteins. This is the first report to document the presence of CRN, RxLR, and RxLR-dEER effector proteins in the S. graminicola genome. Further study on the interaction of RxLR proteins with host plants would provide a new area for confirmation of the pathogenic or mimicking activity of the protein to trespass the host immune response to cause the disease.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof9040431/s1, Table S1: Phylogenetic relationships RxLR protein other proteins. Figure S1: Phylogenetic tree of protein 8311_g; Figure S2: Phylogenetic tree of protein 60945_g; Figure S3: Phylogenetic tree of protein 35983_g; Figure S4: Phylogenetic tree of protein 6877_g; Figure S5: Phylogenetic tree of protein 60741_g.

Author Contributions

Conceptualization, S.J.; methodology, software, and validation, S.H., N.G., A.C.U. and S.J.; formal analysis, C.S.N., D.A., S.A., S.D.B. and S.-i.I.; investigation and data curation, S.H.; writing—original draft, review, and editing, S.H., S.D.B., S.-i.I. and S.J.; supervision and project administration, S.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by Researchers Supporting Project number (RSP2023R27), King Saud University, Riyadh, Saudi Arabia.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data used to support the results of this paper is available at the NCBI repository with accession numbers OM135515, OM365911, OM365912, OM365913, and OM365914 is accessible through the following link, https://www.ncbi.nlm.nih.gov/nucleotide/ (accessed on 27 August 2022). Sclerosporagraminicola genome available in NCBI GenBank used for transcriptome mapping: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA325098/ (accessed on 27 August 2022).

Acknowledgments

This research was supported by Researchers Supporting Project number (RSP2023R27), King Saud University, Riyadh, Saudi Arabia. All the authors highly acknowledge to their Universities for this collaborative research work.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Mukhi, N.; Gorenkin, D.; Banfield, M.J. Exploring folds, evolution and host interactions: Understanding effector structure/function in disease and immunity. New Phytol. 2020, 227, 326–333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Wen, Z.; Yao, L.; Singer, S.D.; Muhammad, H.; Li, Z.; Wang, X. Constitutive heterologous overexpression of a TIR-NB-ARC-LRR gene encoding a putative disease resistance protein from wild Chinese Vitis pseudoreticulata in Arabidopsis and tobacco enhances resistance to phytopathogenic fungi and bacteria. Plant Physiol. Biochem. 2017, 112, 346–361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Derbyshire, M.C.; Newman, T.E.; Khentry, Y.; Taiwo, A.O. The evolutionary and molecular features of the broad-host-range plant pathogen Sclerotinia sclerotiorum. Mol. Plant Pathol. 2022, 23, 1075–1090. [Google Scholar] [CrossRef] [Scilit]
  4. Kanja, C.; Hammond-Kosack, K.E. Proteinaceous effector discovery and characterization in filamentous plant pathogens. Mol. Plant Pathol. 2020, 21, 1353–1376. [Google Scholar] [CrossRef] [Scilit]
  5. Presti, L.L.; Kahmann, R. How filamentous plant pathogen effectors are translocated to host cells. Curr. Opin. Plant Biol. 2017, 38, 19–24. [Google Scholar] [CrossRef] [Scilit]
  6. Lin, X.; Wang, S.; de Rond, L.; Bertolin, N.; Wouters, R.H.M.; Wouters, D.; Domazakis, E.; Bitew, M.K.; Win, J.; Dong, S.; et al. Divergent Evolution of PcF/SCR74 Effectors in Oomycetes Is Associated with Distinct Recognition Patterns in Solanaceous Plants. Mbio 2020, 11, e00947-20. [Google Scholar] [CrossRef] [Scilit]
  7. Outram, M.A.; Figueroa, M.; Sperschneider, J.; Williams, S.J.; Dodds, P.N. Seeing is believing: Exploiting advances in structural biology to understand and engineer plant immunity. Curr. Opin. Plant Biol. 2022, 67, 102210. [Google Scholar] [CrossRef] [Scilit]
  8. Arroyo-Velez, N.; González-Fuente, M.; Peeters, N.; Lauber, E.; Noël, L.D. From effectors to effectomes: Are functional studies of individual effectors enough to decipher plant pathogen infectious strategies? PLoS Pathog. 2020, 16, e1009059. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Chepsergon, J.; Motaung, T.E.; Bellieny-Rabelo, D.; Moleleki, L.N. Organize, Don’t Agonize: Strategic Success of Phytophthora Species. Microorganisms 2020, 8, 917. [Google Scholar] [CrossRef] [Scilit]
  10. Perrine-Walker, F. Phytophthorapalmivora–Cocoa Interaction. J. Fungi 2020, 6, 167. [Google Scholar] [CrossRef] [Scilit]
  11. Wang, W.; Jiao, F. Effectors of Phytophthora pathogens are powerful weapons for manipulating host immunity. Planta 2019, 250, 413–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Wawra, S.; Belmonte, R.; Löbach, L.; Saraiva, M.; Willems, A.; van West, P. Secretion, delivery and function of oomycete effector proteins. Curr. Opin. Microbiol. 2012, 15, 685–691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Maximo, H.J.; Dalio, R.J.D.; Dias, R.O.; Litholdo, C.G.; Felizatti, H.L.; Machado, M.A. PpCRN7 and PpCRN20 of Phythophthora parasitica regulate plant cell death leading to enhancement of host susceptibility. BMC Plant Biol. 2019, 19, 544. [Google Scholar] [CrossRef] [Scilit]
  14. Baxter, L.; Tripathy, S.; Ishaque, N.; Boot, N.; Cabral, A.; Kemen, E.; Thines, M.; Ah-Fong, A.; Anderson, R.; Badejoko, W.; et al. Signatures of Adaptation to Obligate Biotrophy in the Hyaloperonospora arabidopsidis Genome. Science 2010, 330, 1549–1551. [Google Scholar] [CrossRef] [Scilit]
  15. Schornack, S.; van Damme, M.; Bozkurt, T.O.; Cano, L.M.; Smoker, M.; Thines, M.; Gaulin, E.; Kamoun, S.; Huitema, E. Ancient class of translocated oomycete effectors targets the host nucleus. Proc. Natl. Acad. Sci. USA 2010, 107, 17421–17426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Pecrix, Y.; Buendia, L.; Penouilh-Suzette, C.; Maréchaux, M.; Legrand, L.; Bouchez, O.; Rengel, D.; Gouzy, J.; Cottret, L.; Vear, F.; et al. Sunflower resistance to multiple downy mildew pathotypes revealed by recognition of conserved effectors of the oomycete Plasmopara halstedii. Plant J. 2018, 97, 730–748. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Purayannur, S.; Cano, L.M.; Bowman, M.J.; Childs, K.L.; Gent, D.H.; Quesada-Ocampo, L.M. The Effector Repertoire of the Hop Downy Mildew Pathogen Pseudoperonospora humuli. Front. Genet. 2020, 11, 910. [Google Scholar] [CrossRef] [Scilit]
  18. Yang, L.-N.; Liu, H.; Duan, G.-H.; Huang, Y.-M.; Liu, S.; Fang, Z.-G.; Wu, E.-J.; Shang, L.; Zhan, J. The Phytophthora infestans AVR2 Effector Escapes R2 Recognition Through Effector Disordering. Mol. Plant-Microbe Interact. 2020, 33, 921–931. [Google Scholar] [CrossRef] [Scilit]
  19. Shen, D.; Li, Q.; Sun, P.; Zhang, M.; Dou, D. Intrinsic disorder is a common structural characteristic of RxLR effectors in oomycete pathogens. Fungal Biol. 2017, 121, 911–919. [Google Scholar] [CrossRef] [Scilit]
  20. Goss, E.M.; Press, C.M.; Grünwald, N.J. Evolution of RXLR-Class Effectors in the Oomycete Plant Pathogen Phytophthora ramorum. PLoS ONE 2013, 8, e79347. [Google Scholar] [CrossRef] [Scilit]
  21. Jiang, R.H.Y.; Tripathy, S.; Govers, F.; Tyler, B.M. RXLR effector reservoir in two Phytophthora species is dominated by a single rapidly evolving superfamily with more than 700 members. Proc. Natl. Acad. Sci. USA 2008, 105, 4874–4879. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Wood, K.J.; Nur, M.; Gil, J.; Fletcher, K.; Lakeman, K.; Gann, D.; Gothberg, A.; Khuu, T.; Kopetzky, J.; Naqvi, S.; et al. Effector prediction and characterization in the oomycete pathogen Bremia lactucae reveal host-recognized WY domain proteins that lack the canonical RXLR motif. PLoS Pathog. 2020, 16, e1009012. [Google Scholar] [CrossRef] [Scilit]
  23. Sperschneider, J.; Dodds, P.N. EffectorP 3.0: Prediction of Apoplastic and Cytoplasmic Effectors in Fungi and Oomycetes. Mol. Plant-Microbe Interact. 2022, 35, 146–156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Jogaiah, S.; Kurjogi, M.; Govind, S.R.; Huntrike, S.S.; Basappa, V.A.; Tran, L.-S.P. Isolation and evaluation of proteolytic actinomycete isolates as novel inducers of pearl millet downy mildew disease protection. Sci. Rep. 2016, 6, 30789. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Jogaiah, S.; Sharathchandra, R.G.; Raj, N.; Vedamurthy, A.B.; Shetty, H.S. Development of SCAR marker associated with downy mildew disease resistance in pearl millet (Pennisetum glaucum L.). Mol. Biol. Rep. 2014, 41, 7815–7824. [Google Scholar] [CrossRef] [Scilit]
  26. Thakur, R.P.; Shetty, H.S.; Khairwal, I.S. Pearl Millet Downy Mildew Research in India: Progress and Perspectives. Int. Sorghum Millets Newsl. 2006, 47, 125–130. [Google Scholar]
  27. Rao, V.R.; Kadwani, D.L.; Sharma, Y.K.; Sharma, R.; Thakur, R.P. Prevalence of Pearl millet Downy Mildew, Sclerospora graminicola in Gujarat and Pathogenic Characterization of Its Isolates. Indian J. Plant Prot. 2007, 35, 291–295. [Google Scholar]
  28. Koledenkova, K.; Esmaeel, Q.; Jacquard, C.; Nowak, J.; Clément, C.; Barka, E.A. Plasmopara viticola the Causal Agent of Downy Mildew of Grapevine: From Its Taxonomy to Disease Management. Front. Microbiol. 2022, 13, 889427. [Google Scholar] [CrossRef] [Scilit]
  29. Mathur, K.; Thakur, R.P.; Rao, V.P. Characterization of Colletotrichum graminicola Populations from a Sorghum Hybrid CSH 9 for Morphological and Pathogenic Variability. Indian Phytopathol. 2001, 54, 299–303. [Google Scholar]
  30. Tiwari, S.; Rahul, S.N.; Sehrawat, A.; Rawat, B. Circadian Redox Rhythms Play an Important Role in Plant-Pathogen Interaction. In Plant Microbiome Paradigm; Springer: Berlin/Heidelberg, Germany, 2020; pp. 147–162. [Google Scholar] [CrossRef] [Scilit]
  31. Mustafa, G.; Masood, S.; Ahmed, N.; Saboor, A.; Ahmad, S.; Hussain, S.; Bilal, M.; Ali, M.A. Seed Priming for Disease Resistance in Plants. In Priming and Pretreatment of Seeds and Seedlings; Springer: Berlin/Heidelberg, Germany, 2019; pp. 333–362. [Google Scholar]
  32. Feurtey, A.; Lorrain, C.; Croll, D.; Eschenbrenner, C.; Freitag, M.; Habig, M.; Haueisen, J.; Möller, M.; Schotanus, K.; Stukenbrock, E.H. Genome compartmentalization predates species divergence in the plant pathogen genus Zymoseptoria. BMC Genom. 2020, 21, 588. [Google Scholar] [CrossRef] [Scilit]
  33. Florea, L.; Hartzell, G.; Zhang, Z.; Rubin, G.M.; Miller, W. A Computer Program for Aligning a cDNA Sequence with a Genomic DNA Sequence. Genome Res. 1998, 8, 967–974. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Ter-Hovhannisyan, V.; Lomsadze, A.; Chernoff, Y.O.; Borodovsky, M. Gene prediction in novel fungal genomes using an ab initio algorithm with unsupervised training. Genome Res. 2008, 18, 1979–1990. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Pavy, N.; Rombauts, S.; Déhais, P.; Mathé, C.; Ramana, D.V.; Leroy, P.; Rouzé, P. Evaluation of gene prediction software using a genomic data set: Application to Arabidopsis thaliana sequences. Bioinformatics 1999, 15, 887–899. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Chai, C.; Chen, C.; Zhu, L.; Liu, J.; Hui, F. Genome Sequence Resource of Albifimbria verrucaria Causing the Leaf Spot Disease of the Spinach Plant Spinacia oleracea. Plant Dis. 2022, 106, 2511–2513. [Google Scholar] [CrossRef] [Scilit]
  37. Meng, Y.; Gleason, M.L.; Zhang, R.; Sun, G. Genome Sequence Resource of the Wide-Host-Range Anthracnose Pathogen Colletotrichum siamense. Mol. Plant-Microbe Interact. 2019, 32, 931–934. [Google Scholar] [CrossRef] [Scilit]
  38. Teufel, F.; Armenteros, J.J.A.; Johansen, A.R.; Gíslason, M.H.; Pihl, S.I.; Tsirigos, K.D.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat. Biotechnol. 2022, 40, 1023–1025. [Google Scholar] [CrossRef] [Scilit]
  39. Emanuelsson, O.; Nielsen, H.; Brunak, S.; von Heijne, G. Predicting Subcellular Localization of Proteins Based on their N-terminal Amino Acid Sequence. J. Mol. Biol. 2000, 300, 1005–1016. [Google Scholar] [CrossRef] [Scilit]
  40. Dahal, S.; Gour, P.; Raghuvanshi, S.; Prasad, Y.K.; Saikia, D.; Ghatani, S. Multi-stage transcriptome profiling of the neglected food-borne echinostome Artyfechino stomum sufrartyfex reveal potential diagnostic and drug targets. Acta Trop. 2022, 233, 106564. [Google Scholar] [CrossRef] [Scilit]
  41. Zhang, Y.; Wei, J.; Qi, Y.; Li, J.; Amin, R.; Yang, W.; Liu, D. Predicating the Effector Proteins Secreted by Puccinia triticina Through Transcriptomic Analysis and Multiple Prediction Approaches. Front. Microbiol. 2020, 11, 538032. [Google Scholar] [CrossRef] [Scilit]
  42. Levin, E.; Kishore, A.; Ballester, A.R.; Raphael, G.; Feigenberg, O.; Liu, Y.; Norelli, J.; Gonzalez-Candelas, L.; Wisniewski, M.; Droby, S. Identification of pathogenicity-related genes and the role of a subtilisin-related peptidase S8 (PePRT) in authophagy and virulence of Penicillium expansum on apples. Postharvest Biol. Technol. 2018, 149, 209–220. [Google Scholar] [CrossRef] [Scilit]
  43. Jing, L.; Guo, D.; Hu, W.; Niu, X. The prediction of a pathogenesis-related secretome of Puccinia helianthi through high-throughput transcriptome analysis. BMC Bioinform. 2017, 18, 166. [Google Scholar] [CrossRef] [Scilit]
  44. Ai, G.; Yang, K.; Ye, W.; Tian, Y.; Du, Y.; Zhu, H.; Li, T.; Xia, Q.; Shen, D.; Peng, H.; et al. Prediction and Characterization of RXLR Effectors in Pythium Species. Mol. Plant-Microbe Interact. 2020, 33, 1046–1058. [Google Scholar] [CrossRef] [Scilit]
  45. Breeze, E.; Vale, V.; McLellan, H.; Godiard, L.; Grant, M.; Frigerio, L. The Plant Endoplasmic Reticulum Is Both Receptive and Responsive to Pathogen Effectors. Plant Biol. 2020. preprint. [Google Scholar] [CrossRef] [Scilit]
  46. Divya, K.; Kishor, P.B.K.; Bhatnagar-Mathur, P.; Singam, P.; Sharma, K.K.; Vadez, V.; Reddy, P.S. Isolation and functional characterization of three abiotic stress-inducible (Apx, Dhn and Hsc70) promoters from pearl millet (Pennisetum glaucum L.). Mol. Biol. Rep. 2019, 46, 6039–6052. [Google Scholar] [CrossRef] [Scilit]
  47. Sudisha, J.; Kumar, S.A.; Niranjana, S.R.; Shetty, N.P.; Shetty, H.S. Cloning and Development of Pathotype-Specific SCAR Marker Associated with Sclerospora graminicola Isolates from Pearl Millet. Australas. Plant Pathol. 2009, 38, 216–221. [Google Scholar] [CrossRef] [Scilit]
  48. Evans, S.R.; West, C.; Klein-Seetharaman, J. Similarity of the non-amyloid-β component and C-terminal tail of monomeric and tetrameric alpha-synuclein with 14-3-3 sigma. Comput. Struct. Biotechnol. J. 2021, 19, 5348–5359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. MacCready, J.S.; Basalla, J.L.; Vecchiarelli, A.G. The McdAB Carboxysome Positioning System Is Widespread Among β-Cyanobacteria. Microbiology 2019. preprint. [Google Scholar] [CrossRef] [Scilit]
  50. Yu, L.; Liu, F.; Li, Y.; Luo, J.; Jing, R. DeepT3_4: A Hybrid Deep Neural Network Model for the Distinction between Bacterial Type III and IV Secreted Effectors. Front. Microbiol. 2021, 12, 605782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Jaswal, R.; Kiran, K.; Rajarammohan, S.; Dubey, H.; Singh, P.K.; Sharma, Y.; Deshmukh, R.; Sonah, H.; Gupta, N.; Sharma, T. Effector Biology of Biotrophic Plant Fungal Pathogens: Current Advances and Future Prospects. Microbiol. Res. 2020, 241, 126567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. McGowan, J.; O’Hanlon, R.; Owens, R.A.; Fitzpatrick, D.A. Comparative Genomic and Proteomic Analyses of Three Widespread Phytophthora Species: Phytophthora chlamydospora, Phytophthora gonapodyides and Phytophthora pseudosyringae. Microorganisms 2020, 8, 653. [Google Scholar] [CrossRef] [Scilit]
  53. Win, J.; Morgan, W.; Bos, J.; Krasileva, K.; Cano, L.M.; Chaparro-Garcia, A.; Ammar, R.; Staskawicz, B.J.; Kamoun, S. Adaptive Evolution Has Targeted the C-Terminal Domain of the RXLR Effectors of Plant Pathogenic Oomycetes. Plant Cell 2007, 19, 2349–2369. [Google Scholar] [CrossRef] [Scilit]
  54. Naveed, Z.A.; Wei, X.; Chen, J.; Mubeen, H.; Ali, G.S. The PTI to ETI Continuum in Phytophthora-Plant Interactions. Front. Plant Sci. 2020, 11, 593905. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Chepsergon, J.; Motaung, T.E.; Moleleki, L.N. “Core” RxLR effectors in phytopathogenic oomycetes: A promising way to breeding for durable resistance in plants? Virulence 2021, 12, 1921–1935. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Müller, M.C.; Praz, C.R.; Sotiropoulos, A.G.; Menardo, F.; Kunz, L.; Schudel, S.; Oberhänsli, S.; Poretti, M.; Wehrli, A.; Bourras, S.; et al. A chromosome-scale genome assembly reveals a highly dynamic effector repertoire of wheat powdery mildew. New Phytol. 2018, 221, 2176–2189. [Google Scholar] [CrossRef] [Scilit]
  57. Huang, Z.; Li, H.; Zhou, Y.; Bao, Y.; Duan, Z.; Wang, C.; Powell, C.A.; Chen, B.; Zhang, M.; Yao, W. Predication of the Effector Proteins Secreted by Fusarium sacchari Using Genomic Analysis and Heterogenous Expression. J. Fungi 2022, 8, 59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Spanu, P.D.; Abbott, J.C.; Amselem, J.; Burgis, T.A.; Soanes, D.M.; Stüber, K.; van Themaat, E.V.L.; Brown, J.K.M.; Butcher, S.A.; Gurr, S.J.; et al. Genome Expansion and Gene Loss in Powdery Mildew Fungi Reveal Tradeoffs in Extreme Parasitism. Science 2010, 330, 1543–1546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Kiran, K.; Rawal, H.C.; Dubey, H.; Jaswal, R.; Devanna, B.; Gupta, D.K.; Bhardwaj, S.C.; Prasad, P.; Pal, D.; Chhuneja, P.; et al. Draft Genome of the Wheat Rust Pathogen (Puccinia triticina) Unravels Genome-Wide Structural Variations during Evolution. Genome Biol. Evol. 2016, 8, 2702–2721. [Google Scholar] [CrossRef] [Scilit]
  60. Van de Wouw, A.P.; Idnurm, A. Biotechnological potential of engineering pathogen effector proteins for use in plant disease management. Biotechnol. Adv. 2019, 37, 107387. [Google Scholar] [CrossRef] [Scilit]
  61. Tyler, B.M.; Tripathy, S.; Zhang, X.; Dehal, P.; Jiang, R.H.Y.; Aerts, A.; Arredondo, F.D.; Baxter, L.; Bensasson, D.; Beynon, J.L.; et al. Phytophthora Genome Sequences Uncover Evolutionary Origins and Mechanisms of Pathogenesis. Science 2006, 313, 1261–1266. [Google Scholar] [CrossRef] [Scilit]
  62. Morgan, W.; Kamoun, S. RXLR effectors of plant pathogenic oomycetes. Curr. Opin. Microbiol. 2007, 10, 332–338. [Google Scholar] [CrossRef] [Scilit]
  63. Kamoun, S. Groovy times: Filamentous pathogen effectors revealed. Curr. Opin. Plant Biol. 2007, 10, 358–365. [Google Scholar] [CrossRef] [Scilit]
  64. Cai, H.; Yu, J.; Qiao, Y.; Ma, Y.; Zheng, J.; Lin, M.; Yan, Q.; Huang, L. Effect of the Type VI Secretion System Secreted Protein Hcp on the Virulence of Aeromonas salmonicida. Microorganisms 2022, 10, 2307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Dalio, R.J.D.; Paschoal, D.; Arena, G.D.; Magalhães, D.M.; Oliveira, T.S.; Merfa, M.V.; Maximo, H.J.; Machado, M.A. Hypersensitive response: From NLR pathogen recognition to cell death response. Ann. Appl. Biol. 2020, 178, 268–280. [Google Scholar] [CrossRef] [Scilit]
  66. Trivedi, P.; Leach, J.E.; Tringe, S.G.; Sa, T.; Singh, B.K. Plant–microbiome interactions: From community assembly to plant health. Nat. Rev. Microbiol. 2020, 18, 607–621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Hunziker, L.; Tarallo, M.; Gough, K.; Guo, M.; Hargreaves, C.; Loo, T.S.; McDougal, R.L.; Mesarich, C.H.; Bradshaw, R.E. Apoplastic effector candidates of a foliar forest pathogen trigger cell death in host and non-host plants. Sci. Rep. 2021, 11, 19958. [Google Scholar] [CrossRef] [Scilit]
  68. Hacquard, S.; Kracher, B.; Maekawa, T.; Vernaldi, S.; Schulze-Lefert, P.; van Themaat, E.V.L. Mosaic genome structure of the barley powdery mildew pathogen and conservation of transcriptional programs in divergent hosts. Proc. Natl. Acad. Sci. USA 2013, 110, E2219–E2228. [Google Scholar] [CrossRef] [Scilit]
  69. Praz, C.R.; Menardo, F.; Robinson, M.; Müller, M.C.; Wicker, T.; Bourras, S.; Keller, B. Non-parent of Origin Expression of Numerous Effector Genes Indicates a Role of Gene Regulation in Host Adaption of the Hybrid Triticale Powdery Mildew Pathogen. Front. Plant Sci. 2018, 9, 49. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Secretome mapping and annotation for CRN and RxLR effectors.
Figure 1. Secretome mapping and annotation for CRN and RxLR effectors.
Jof 09 00431 g001
Figure 2. The fingerprint of 17 PCR amplicons (1 to 17) and Host (H) (Pennisetum glaucum) on 1.5% agarose gel electrophoresis, out of which only 5 bands with base pair size 885 (lane 7), 1248 (lane 9), 1254 (lane 10), 1410 (lane 11), and 1533(lane 12) are visible. The lane marked L represents a 1 kb ladder.
Figure 2. The fingerprint of 17 PCR amplicons (1 to 17) and Host (H) (Pennisetum glaucum) on 1.5% agarose gel electrophoresis, out of which only 5 bands with base pair size 885 (lane 7), 1248 (lane 9), 1254 (lane 10), 1410 (lane 11), and 1533(lane 12) are visible. The lane marked L represents a 1 kb ladder.
Jof 09 00431 g002
Figure 3. RxLR-dEER effector proteins showing the disorder regions. (A). Sequence 35983_g with overall 46.17% disordered amino acid residues. (B). Sequence 6877_g with overall 43.88% disordered amino acid residues. (C). Sequence8311_g with overall 28.06% disordered amino acid residues. (D). Sequence60945_g with overall 26.75% disordered amino acid residues. (E). Sequence 60741_g with overall 25.05% disordered amino acid residues.
Figure 3. RxLR-dEER effector proteins showing the disorder regions. (A). Sequence 35983_g with overall 46.17% disordered amino acid residues. (B). Sequence 6877_g with overall 43.88% disordered amino acid residues. (C). Sequence8311_g with overall 28.06% disordered amino acid residues. (D). Sequence60945_g with overall 26.75% disordered amino acid residues. (E). Sequence 60741_g with overall 25.05% disordered amino acid residues.
Jof 09 00431 g003
Figure 4. Effector proteins representing the secretary signal peptide and its cleavage site generated using SignalP 6.0. (A). One secretory signal peptide exists in protein 6877_g, and its cleavage site is located at position 16 with a probability of 0.9996. (B). A secretory signal peptide with cleavage site at 21st position, and a probability of 0.9997 is present in the protein 60945_g. (C). A secretory signal peptide and a cleavage site, both with a probability of 0.9997, are present in protein 8311_g. (D). Protein 35983_g has one secretory signal peptide and cleavage site at 19th position with likelihood of 0.9998. (E). A secretory signal peptide and cleavage site are present in 60741_g at position 19 with likelihood of 0.9998.
Figure 4. Effector proteins representing the secretary signal peptide and its cleavage site generated using SignalP 6.0. (A). One secretory signal peptide exists in protein 6877_g, and its cleavage site is located at position 16 with a probability of 0.9996. (B). A secretory signal peptide with cleavage site at 21st position, and a probability of 0.9997 is present in the protein 60945_g. (C). A secretory signal peptide and a cleavage site, both with a probability of 0.9997, are present in protein 8311_g. (D). Protein 35983_g has one secretory signal peptide and cleavage site at 19th position with likelihood of 0.9998. (E). A secretory signal peptide and cleavage site are present in 60741_g at position 19 with likelihood of 0.9998.
Jof 09 00431 g004
Table 1. Primer designing for RxLR effectors with dEER motif.
Table 1. Primer designing for RxLR effectors with dEER motif.
Serial NumberSequence IDSequence
ForwardJof 09 00431 i001
Jof 09 00431 i002Reverse
TM 1AT 2
111472_gJof 09 00431 i003ATGAATAAGCGATATCTTTTG
CCTTATAAACCAATCAATTATJof 09 00431 i004
49
47
48
214151_gATGAAACAGATGATAAAAAGC
TTAGCGTTTTGACTTTTTACC
49
51
50
318087_gATGAACCCGAACATCATCTTC
CTAGGGATTATTGACAAAGTA
55
51
53
475485_gATGCGTCCTGTGTCCATCTTG
TCACTTTGCAAAGCGTGAAAT
59
53
56
57856_gATGAGACCGAACATTTTCTTC
CTAGGGATTCTTGGCAAAGTA
53
55
54
669274_gATGAACCCGAACATTGTATTC
CTAGGGATTCTTTTTGGCAAA
53
53
53
76877_gATGCGTCTCCGTCTGTTCCT
TTACTCGCTCGCTTCACTGG
58
58
58
810624_gATGCGCTATTCCATCCTTCTC
TTAATGTTTTTTATACCAGTC
57
47
52
960945_gATGCGGTCCGTCTCTATCCTC
TTAGACTGGGTGGGCATTCTT
61
57
59
108311_gATGCGGTCCGTCTCTATCCT
TTAGACTGGGTGGGCATTCT
58
56
57
1135983_gATGATCTACGCCCCCTTAGTT
TTTGAACGGGCAATGGTGTAG
57
57
57
1260741_gATGCGTTTCCATAGCCTGATT
TTCCTCTGTAGCGGAAGCTCT
55
59
57
1338171_gATGGTCAACGCACTCTTGGTT
TTAATTTACGCGACGTTTCTT
57
51
54
1446338_gATGATCAACAAACTCTTGGTT
TTACGCGATTTTTCTTCTTTT
51
49
50
1574027_gATGATCCACAAACTCTTGGTT
TTACGCGATTTTTCTTCTTTT
53
49
51
1610548_gATGAAGCTTTCTCTTCTCTTC
TTACGGTGACATGAGCTTCCG
53
59
56
171854_gATGAGAGCAACTTGTCTCCTA
TCACTGACGGTACCCGTTCTT
55
59
57
1 TM: Melting Temperature, 2 AT: Annealing Temperature.
Table 2. List of crinkler (CRN) proteins prognosticated by EffectorP tool.
Table 2. List of crinkler (CRN) proteins prognosticated by EffectorP tool.
Serial
Number
Protein
Number
Cytoplasmic EffectorApoplastic EffectorNon-EffectorPrediction
1681_gY (0.856)--Cytoplasmic effector
21492_g--Y (0.833)Non-effector
31671_gY (0.823)--Cytoplasmic effector
43769_gY (0.785)--Cytoplasmic effector
55109_gY (0.799)--Cytoplasmic effector
65588_gY (0.89)--Cytoplasmic effector
78689_gY (0.856)--Cytoplasmic effector
88943_gY (0.903)--Cytoplasmic effector
910070_gY (0.89)--Cytoplasmic effector
1010105_g--Y (0.735)Non-effector
1112349_gY (0.856)--Cytoplasmic effector
1223122_gY (0.856)--Cytoplasmic effector
1324510_gY (0.887)--Cytoplasmic effector
1427640_gY (0.891)--Cytoplasmic effector
1527641_gY (0.924)--Cytoplasmic effector
1628426_gY (0.726)--Cytoplasmic effector
1736964_gY (0.575)--Cytoplasmic effector
1837717_gY (0.831)--Cytoplasmic effector
1938162_gY (0.815)--Cytoplasmic effector
2040025_gY (0.934)--Cytoplasmic effector
2141242_gY (0.934)--Cytoplasmic effector
2242778_g--Y (0.73)Non-effector
2347345_gY (0.523)--Cytoplasmic effector
2449318_gY (0.785)--Cytoplasmic effector
2550963_gY (0.729)--Cytoplasmic effector
2653743_g--Y (0.768)Non-effector
2754388_gY (0.835)--Cytoplasmic effector
2862219_gY (0.523)--Cytoplasmic effector
2962440_gY (0.891)--Cytoplasmic effector
3062442_gY (0.822)--Cytoplasmic effector
3162857_gY (0.89)--Cytoplasmic effector
3262858_gY (0.859)--Cytoplasmic effector
3368815_gY (0.813)--Cytoplasmic effector
3470580_gY (0.582)--Cytoplasmic effector
3572237_gY (0.824)--Cytoplasmic effector
Table 3. List of RxLR proteins predicted by Effector P tool.
Table 3. List of RxLR proteins predicted by Effector P tool.
Serial
Number
Protein
Number
Cytoplasmic EffectorApoplastic EffectorNon-EffectorPrediction
121379_gY (0.959)--Cytoplasmic effector
23464_gY (0.809)--Cytoplasmic effector
347557_gY (0.905)--Cytoplasmic effector
412504_g--Y (0.755)Non-effector
555207_gY (0.791)--Cytoplasmic effector
625335_gY (0.843)--Cytoplasmic effector
711898_g--Y (0.81)Non-effector
835685_gY (0.903)--Cytoplasmic effector
959897_g--Y (0.8)Non-effector
1063043_g--Y (0.573)Non-effector
119023_gY (0.84)--Cytoplasmic effector
1218507_gY (0.736)--Cytoplasmic effector
1365651_gY (0.685)--Cytoplasmic effector
1410686_gY (0.906)--Cytoplasmic effector
1545770_gY (0.868)--Cytoplasmic effector
1626637_gY (0.876)--Cytoplasmic effector
1746575_gY (0.761)--Cytoplasmic effector
181289_gY (0.905)--Cytoplasmic effector
1953288_gY (0.955)--Cytoplasmic effector
2010613_gY (0.832)--Cytoplasmic effector
2120048_gY (0.723)--Cytoplasmic effector
2223346_gY (0.832)--Cytoplasmic effector
2335739_gY (0.806)--Cytoplasmic effector
2444650_gY (0.827)--Cytoplasmic effector
2560111_gY (0.903)--Cytoplasmic effector
2670669_gY (0.86)--Cytoplasmic effector
277606_gY (0.827)--Cytoplasmic effector
289639_gY (0.832)--Cytoplasmic effector
2922687_gY (0.883)--Cytoplasmic effector
3024069_gY (0.921)--Cytoplasmic effector
3129669_gY (0.883)--Cytoplasmic effector
3235014_gY (0.964)--Cytoplasmic effector
3339202_gY (0.87)--Cytoplasmic effector
3462695_gY (0.964)--Cytoplasmic effector
3560583_gY (0.569)--Cytoplasmic effector
3668703_gY (0.571)--Cytoplasmic effector
3771584_gY (0.96)--Cytoplasmic effector
3813581_gY (0.808)--Cytoplasmic effector
3934223_gY (0.894)--Cytoplasmic effector
4037513_gY (0.759)--Cytoplasmic effector
4177025_gY (0.731)--Cytoplasmic effector
4229984_gY (0.746)--Cytoplasmic effector
4342066_gY (0.872)--Cytoplasmic effector
4442069_gY (0.945)--Cytoplasmic effector
4532234_gY (0.915)--Cytoplasmic effector
4628623_gY (0.927)--Cytoplasmic effector
4732891_gY (0.845)--Cytoplasmic effector
481182_gY (0.88)--Cytoplasmic effector
4917918_gY (0.803)--Cytoplasmic effector
5019540_gY (0.64)--Cytoplasmic effector
5164364_g--Y (0.781)Non-effector
5275770_gY (0.796)--Cytoplasmic effector
Table 4. List of RxLR-dEER proteins prognosticated by Effector P tool.
Table 4. List of RxLR-dEER proteins prognosticated by Effector P tool.
Serial
Number
Sequence IDCytoplasmic EffectorApoplastic EffectorNon-EffectorPrediction
110548_gY (0.7)--Cytoplasmic effector
214151_gY (0.927)--Cytoplasmic effector
360741_gY (0.908)--Cytoplasmic effector
475485_gY (0.946)--Cytoplasmic effector
511472_gY (0.893)--Cytoplasmic effector
66877_gY (0.898)--Cytoplasmic effector
71854_g--Y (0.619)Non-effector
835983_gY (0.8)--Cytoplasmic effector
938171_gY (0.88)--Cytoplasmic effector
1046338_gY (0.908)--Cytoplasmic effector
1174027_gY (0.908)--Cytoplasmic effector
127856_gY (0.585)Y (0.501)-Cytoplasmic/apoplastic effector
1318087_gY (0.816)--Cytoplasmic effector
1469274_gY (0.799)--Cytoplasmic effector
1560945_gY (0.921)--Cytoplasmic effector
168311_gY (0.92)--Cytoplasmic effector
1710624_gY (0.938)--Cytoplasmic effector
Table 5. List of novel RxLR-dEER gene sequences.
Table 5. List of novel RxLR-dEER gene sequences.
Serial NumberSequence IDGene Bank Accession NumberSize in
Base Pairs
135983_gOM3659131410
26877_gOM135515885
38311_gOM3659121254
460945_gOM3659111248
560741_gOM3659141533
Table 6. Percentage of overall intrinsic disorder of the amino acid sequences.
Table 6. Percentage of overall intrinsic disorder of the amino acid sequences.
Band
Number
Sequence
ID
Gene Bank
Accession Number
Overall
Disorder (%)
76877_gOM13551543.88
960945_gOM36591126.75
108311_gOM36591228.06
1135983_gOM36591346.17
1260741_gOM36591425.05
Table 7. Sequence features and predicted domains of the effector proteins.
Table 7. Sequence features and predicted domains of the effector proteins.
Serial NumberProtein NameSignal Peptide
Likelihood
Cleavage Site between PositionRxLR Motif PositionDEER Motif Position
16877_g0.999616 and 1740 to 4353 to 56
260945_g0.999721 and 2248 to 5158 to 61
38311_g0.999721 and 2248 to 5158 to 61
435983_g0.999819 and 2043 to 4655 to 58
560741_g0.999819 and 2043 to 4656 to 59
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hadimani, S.; De Britto, S.; Udayashankar, A.C.; Geetha, N.; Nayaka, C.S.; Ali, D.; Alarifi, S.; Ito, S.-i.; Jogaiah, S. Genome-Wide Characterization of Effector Protein-Encoding Genes in Sclerospora graminicola and Its Validation in Response to Pearl Millet Downy Mildew Disease Stress. J. Fungi 2023, 9, 431. https://doi.org/10.3390/jof9040431

AMA Style

Hadimani S, De Britto S, Udayashankar AC, Geetha N, Nayaka CS, Ali D, Alarifi S, Ito S-i, Jogaiah S. Genome-Wide Characterization of Effector Protein-Encoding Genes in Sclerospora graminicola and Its Validation in Response to Pearl Millet Downy Mildew Disease Stress. Journal of Fungi. 2023; 9(4):431. https://doi.org/10.3390/jof9040431

Chicago/Turabian Style

Hadimani, Shiva, Savitha De Britto, Arakere C. Udayashankar, Nagaraj Geetha, Chandra S. Nayaka, Daoud Ali, Saud Alarifi, Shin-ichi Ito, and Sudisha Jogaiah. 2023. "Genome-Wide Characterization of Effector Protein-Encoding Genes in Sclerospora graminicola and Its Validation in Response to Pearl Millet Downy Mildew Disease Stress" Journal of Fungi 9, no. 4: 431. https://doi.org/10.3390/jof9040431

APA Style

Hadimani, S., De Britto, S., Udayashankar, A. C., Geetha, N., Nayaka, C. S., Ali, D., Alarifi, S., Ito, S.-i., & Jogaiah, S. (2023). Genome-Wide Characterization of Effector Protein-Encoding Genes in Sclerospora graminicola and Its Validation in Response to Pearl Millet Downy Mildew Disease Stress. Journal of Fungi, 9(4), 431. https://doi.org/10.3390/jof9040431

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop