Next Article in Journal
Inoculation of Indigenous Arbuscular Mycorrhizal Fungi as a Strategy for the Recovery of Long-Term Heavy Metal-Contaminated Soils in a Mine-Spill Area
Next Article in Special Issue
Transcriptome Profiling Reveals Candidate Genes Related to Stipe Gradient Elongation of Flammulina filiformis
Previous Article in Journal
Does Forest Soil Fungal Community Respond to Short-Term Simulated Nitrogen Deposition in Different Forests in Eastern China?
Previous Article in Special Issue
Characteristics of the Genome, Transcriptome and Ganoderic Acid of the Medicinal Fungus Ganoderma lingzhi
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phylogenesis of the Functional 1-Aminocyclopropane-1-Carboxylate Oxidase of Fungi and Plants

Key Laboratory of Enzyme Engineering of Agricultural Microbiology, Ministry of Agriculture and Rural Affairs, College of Life Sciences, Henan Agricultural University, Zhengzhou 450002, China
*
Authors to whom correspondence should be addressed.
J. Fungi 2023, 9(1), 55; https://doi.org/10.3390/jof9010055
Submission received: 23 November 2022 / Revised: 20 December 2022 / Accepted: 27 December 2022 / Published: 29 December 2022
(This article belongs to the Special Issue Biotechnology of Edible Fungi)

Abstract

The 1-aminocyclopropane-1-carboxylic acid (ACC) pathway that synthesizes ethylene is shared in seed plants, fungi and probably other organisms. However, the evolutionary relationship of the key enzyme ACC oxidase (ACO) in the pathway among organisms remains unknown. Herein, we cloned, expressed and characterized five ACOs from the straw mushroom (Volvariella volvacea) and the oyster mushroom (Pleurotus ostreatus): VvACO1-4 and PoACO. The five mushroom ACOs and the previously identified AbACO of the button mushroom contained all three conserved residues that bound to Fe(II) in plant ACOs. They also had variable residues that were conserved and bound to ascorbate and bicarbonate in plant ACOs and harbored only 1–2 of the five conserved ACO motifs in plant ACOs. Particularly, VvACO2 and AbACO had only one ACO motif 2. Additionally, VvACO4 shared 44.23% sequence identity with the cyanobacterium Hapalosiphon putative functional ACO. Phylogenetic analysis showed that the functional ACOs of monocotyledonous and dicotyledonous plants co-occurred in Type I, Type II and Type III, while putative functional gymnosperm ACOs also appeared in Type III. The putative functional bacterial ACO, functional fungi and slime mold ACOs were clustered in ancestral Type IV. These results indicate that ACO motif 2, ACC and Fe(II) are essential for ACO activity. The ACOs of the other organisms may come from the horizontal transfer of fungal ACOs, which were found ordinarily in basidiomycetes. It is mostly the first case for the horizontal gene transfers from fungi to seed plants. The horizontal transfer of ACOs from fungi to plants probably facilitates the fungal-plant symbioses, plant–land colonization and further evolution to form seeds.

1. Introduction

A number of bacteria, fungi, slime molds, algae, and most groups of land plants synthesize, perceive and respond to ethylene, which regulates a variety of physiological activities, including growth, development, reproduction, senescence, and stress responses [1]. However, the ethylene biosynthetic pathways of these organisms are different, including the ethylene-forming enzyme (EFE) pathway, 2-keto-4-methylthiobutyric acid (KMBA) pathway, 1-aminocyclopropane-1-carboxylic acid (ACC) pathway and others. The key enzymes of the ACC pathway are ACC synthase (ACS) and ACC oxidase (ACO). ACS converts methionine-derived S-adenosyl-L-methionine to ACC, which is oxidized to ethylene by ACC oxidase [2,3].
The EFE pathway has been explored for the biosynthesis of ethylene by Pseudomonas syringae [4,5,6,7,8], Ralstonia solanacearum [9,10] and cyanobacterium Synechocystis [11]. Whereas the ethylene biosynthesis pathway in cyanobacterium Hapalosiphon is probably the ACC pathway since supplementation with ACC increases ethylene production [12]; however, the ACO of Hapalosiphon has not been identified.
Fungal ethylene biosynthesis pathways are quite diverse. The EFE pathway is involved in ethylene production by Fusarium oxysporum [13], Penicillium cyclopium [14] and P. digitatum [15]. The other ascomycetes: Aspergillus terreus [16], Botrytis cinerea [17,18], and Fusarium oxysporum [19], have the KMBA pathway for synthesizing ethylene. Similar to seed plants, the basidiomycetes Agaricus bisporus [20,21] and slime mold Dictyostelium mucoroides [22] synthesize ethylene via the ACC pathway.
The ethylene biosynthesis pathway in seed plants is a well-known ACC pathway, but the pathway should be absent in non-seed plants [23]. Although several red algae, green algae and mosses can convert ACC to ethylene, such as the red algae Pterocladiella capillacea [24], green algae Haematococcus pluviales [25], Acetabularia mediterranea [26], Ulva (Enteromorpha) intestinalis [27], Spirogyra pratensis [28] and moss Funaria hygrometrica [29]; however, a liverwort Riella helicophylla and fern Regnellidium diphyllum [30,31] do not convert [14C]-labeled ACC into ethylene. ACO genes are not present in the genomes of species of red algae [32,33], ferns, or bryophytes [34,35] and have not been reported in species of green algae. Thus, the non-seed plants produce ethylene presumably by an unknown non-ACC-dependent pathway [36].
ACO belongs to the 2-oxoglutarate-dependent dioxygenase (2OGD) superfamily of nonheme iron-containing proteins [37]. All 2OGDs have a typical 2-His-1-carboxylate motif required for Fe(II) binding. Dilley et al. [38] proposed the ACO reaction mechanism by using Malus domestica ACO1 as a model enzyme. Fe(II) participates in binding to ACC. Several positively charged amino-acid residues from ACO C-terminal α-helix 11, including Arg175, Arg244, Ser246, Lys158, Lys292, Arg299 and Phe300, form a “nest” binding with the other two substrates, ascorbate and bicarbonate. Ascorbate and bicarbonate coordinate the activation the ACO reaction. In particular, ascorbate provides a binding site to ACO for oxygen and donates electrons [38].
The 2OGD superfamily is widely distributed in microorganisms, fungi and mammals and involves many functions [39]; therefore, many proteins have sequence similarities to ACOs. It is difficult to directly extract ACO from biological tissues, and functional characterization of ACO requires the use of recombinant protein. Therefore, only a few functional ACO enzymes have been reported [40]. The phylogenetic analysis of the functional and putative ACOs divides the seed plant ACOs into three types, Type I, Type II, and Type III, and groups non-seed plant ACOs into one cluster of “ancient”, suggesting that the seed plant ACOs diverged from a shared non-seed plant ancestral ACO or 2ODG [40]. Nevertheless, the evolutionary relationship of the functional ACOs between plants and fungi remains unknown.
In previous studies, we found that the compost and casing soil of Agaricus bisporus contained ACC [41], and inhibitors that inhibited ACS and ACO in plants also inhibited button mushroom ethylene production. Two ACS genes and one ACO gene were cloned from the Agaricus bisporus genome and reduced gene expression decreased ethylene synthesis in Agaricus bisporus, similar to plants [42]. Ethylene inhibited mycelial growth and primordium formation but induced post-harvest mushroom maturation and senescence [20,43,44]. In this study, we cloned four and one ACO genes from the straw mushroom (Volvariella volvacea) and the oyster mushroom (Pleurotus ostreatus), respectively. The heterologously expressed proteins of the five ACO genes showed ACO activities. The evolutionary relationships of the ACOs in fungi and plants were explored.

2. Materials and Methods

2.1. Strains and Plasmids

Pleurotus ostreatus Heikang 650, and Volvariella volvacea V23 were provided by Henan Province Edible Fungi Germplasm Resource Bank. E. coli BL21, Pichia pastoris GS115, pET-28a and pPIC9K were purchased from BioVector NTCC Inc. (Beijing, China).

2.2. Bioinformatics Analysis

The ACO protein sequences were aligned using ClustalX 2.0. The phylogenetic tree was constructed by MEGA, version 11.0, using the maximum likelihood method with the bootstrap method (1000 replicates), Poisson model and complete deletion. Motifs were identified by MEME 5.4.1 with the following parameters: “five motifs should MEME find” mode, and other parameters were left as default. An NCBI Conserved Domain Search was used to predict the function of the motifs.

2.3. RT-PCR

The mycelia of the straw mushrooms and oyster mushrooms cultured in PDA plates were collected, the total RNA of the mycelia was extracted by the STE method [45], and cDNA was synthesized using HiScript® III RT SuperMix for qPCR (+gDNA wiper) (Vazyme Biotech Co., Ltd., Nanjing, China) following the manufacturers’ instructions. The four ACO genes in the straw mushrooms (designated VvACO1-4) and the one ACO gene in the oyster mushrooms (designated PoACO) were cloned by PCR. The PCR system contained 100 ng cDNA, 2 μL primer (10 μM), 25 μL 2× Tolo Fast Pfu Premix, and ddH2O to reach a total volume of 50 μL. The primers used are listed in Table 1. PCR was performed at 95 °C for 5 min, 32 cycles of 98 °C for 5 s, 57 °C for 30 s, and 72 °C for 30 s, followed by a 72 °C extension for 10 min. The PCR product was purified and then sequenced by Tsingke Biotechnology Co., Ltd. (Zhengzhou, China).

2.4. Construction of Mushroom ACO Expression Vectors

The four ACO genes of the straw mushrooms were digested with two enzymes (BamHI, HindIII, EcoRI or XbaI) and ligated with the plasmid pCold TF or pET-28a to obtain prokaryotic expression vectors. The ACO gene of the oyster mushrooms was digested with EcoRI and NotI and then ligated with the plasmid pPIC9K to obtain a eukaryotic expression vector.

2.5. Mushroom ACO Expression and Purification

Four ACO prokaryotic expression vectors of the straw mushrooms were transformed into E. coli BL21, which was cultured in LB medium at 37 °C and 220 rpm to an OD600 of 0.4 and then induced by 0.5 mM IPTG at 16 °C and 180 rpm for 12 h. The target proteins were purified using a HisTrapTM HP gravity flow column (GE Healthcare, Uppsala, Sweden), eluted with 200 mM–250 mM imidazole, and the eluate was detected by SDS-PAGE.
The oyster mushroom ACO eukaryotic expression vector was transformed into Pichia pastoris GS115 using the electroporation method. The transformants were grown and induced to express proteins according to methods described elsewhere [46]. The culture supernatant was collected and concentrated in a 10 kDa ultrafiltration tube. The concentrated solution was determined by SDS-PAGE.

2.6. ACO Enzyme Activity Assay

The enzyme activities of the expressed ACO proteins were assayed using a previously described method [21] with a slight modification. Briefly: a 5.5 mL headspace vial contained a 1.8 mL mixture composed of 150 mM NaHCO3, 30 mM ascorbic acid, 1.0 mM ACC, 0.1 mM FeSO4, and 0.1 mg enzyme protein in 100 mM Tris-HCl buffer at pH 7.2. After shaking incubation at 30 °C for 1 h, 1 mL gas was withdrawn for ethylene determination by gas chromatography (GC-2010 plus, Shimadzu, Kyoto, Japan) [47].

3. Results

3.1. Cloning, Expression and Enzyme Activities of ACO Proteins from Straw Mushrooms and Oyster Mushrooms

There are four ACO genes annotated in the straw mushroom V. volvacea V23 genome [48] and designated VvACO1-4 (Table 2). One ACO gene was annotated in the oyster mushroom P. ostreatus PC15 genome [49] and named PoACO (Table 2). The primers were designed according to the ACO gene sequences (Table 1), and four and one ACO genes were cloned from the mRNA of the straw mushroom V. volvacea V23 and P. ostreatus Heikang 650, respectively. After sequencing and alignment, the sequences of the five genes were completely consistent with the genome data.
The predicted molecular weights of VvACO1-4 were 39.97 kD, 42.08 kD, 42.04 kD and 39.44 kD, respectively. We first used the pET-28a plasmid to express the four proteins, but only VvACO3 was successfully expressed (Figure 1C). The other three proteins were expressed using the pCold TF plasmid. The molecular weights of VvACO1, VvACO2 and VvACO4 expressed by pCold TF vectors were approximately 90, 92, and 90 kDa, respectively, due to the molecular weight of TF (trigger factor from E. coli) being approximately 50 kDa (Figure 1A,B,D).
PoACO protein had an expected molecular weight of 36.95 kDa. We used pET-28a and pCold TF vectors to express PoACO but could not obtain free active protein. Then, we successfully obtained free active protein using the plasmid pPIC9K expressed in Pichia yeast. The molecular weight of the PoACO protein was approximately 50 kDa (Figure 1E), probably caused by glycosylation modification.
The ability of the purified proteins to oxidize ACC to produce ethylene was determined. All five proteins were able to oxidize ACC to produce ethylene, among which VvACO2 had the highest specific enzyme activity (Figure 2).

3.2. Residue Analysis of Functional Fungi, Slime Mold and Plant ACOs

Fungal functional ACOs included AbACO from button mushrooms [20,21], VvACO1-4 from straw mushrooms and PoACO from oyster mushrooms identified in this study. The functional ACO of slime mold was DmACO from D. mucoroides [22]. These seven functional ACOs were sequence aligned with the four representative plant-functional ACOs AtACO2 (Type I), AtACO1 (Type II), and AtACO5 and OsACO4 (Type III). Except for the sequence identity of PoACO and AbACO, which reached 41.36%, the sequence identity among the ACO proteins of other fungi and slime molds was 19.4–31.3%. The ACO proteins of these fungi and slime molds were only 18.0–27.3% identical in sequence to those of plants. Six of the eight conserved amino acid residues of the Fe(II) ascorbate family of dioxygenases [21] were harboured in all 11 ACO proteins, and the other two residues were variable. The two variable residues can occur in both plant ACOs, five fungal ACOs and slime mold ACOs. The three conserved Fe(II) binding residues in plant ACOs [64] were all involved in the six conserved residues, whereas the proposed ascorbate binding residues [38] and bicarbonate binding residues [65] in plant ACOs were all highly variable in fungal and slime mold ACOs. In addition, an entirely conserved RXS motif proposed to be involved in binding the carboxylate of ACC in plant ACOs [66] was also variable in XS in fungal ACOs (Figure 3).

3.3. Phylogenetic Analysis of Microbial and Plant ACOs

The identified functional ACOs of fungi, slime molds and some angiosperms and possibly functional ACOs of several bacteria and gymnosperms (Table 2) were selected to perform phylogenetic analysis to study their evolutionary relationships. These 27 ACOs should be divided into four types. Type I, Type II and Type III all contained the ACOs of monocotyledonous and dicotyledonous plants, while ACOs of gymnosperms were all grouped into Type III. Type IV contained only the ACOs of fungi, slime molds and bacteria (Figure 4).
Five conserved motifs were discovered in the 27 ACOs, which all belong to ACO motifs. The seed plant ACOs all contained these five conserved motifs, except OsACO6 and OsACO7, which had four conserved motifs. The ACOs of bacteria, fungi and slime moulds had only 1–2 conserved motifs, especially VvACO2, and AbACO had only one ACO motif 2 (PIRNAIVVNIGDQJEVJSNGRYKSVWHRV) (Figure 5).

4. Discussion

Five putative ACO genes from straw mushrooms and oyster mushrooms were cloned and expressed, and all showed ACO activities, such as the button mushroom AbACO and slime mold DmACO. The amino acid sequence identity between AbACO and plant ACOs is less than 25%, and the conserved ascorbate binding residues, bicarbonate binding residues and RXS in plant ACOs are not conserved in AbACO. The three conserved residues that bind Fe(II) in plant ACOs are conserved in AbACO. Mutation of the three conserved residues that bind Fe(II) reduces the specific activity of AbACO by 24–38%. However, mutating the G in the RXG of AbACO to S increased the specific activity of the enzyme two-fold and dramatically reduced the bicarbonate dependence. It is suggested that AbACO activity requires ACC, Fe(II) and bicarbonate but does not require ascorbate [21]. Similar to AbACO, 2–3 residues out of the three conserved and binding ascorbate residues in plant ACOs were not conserved in fungi and slime molds. Of the three conserved residues that bind bicarbonate in plant ACOs, one and 2–3 were not conserved in AtACO1 and the ACOs of fungi and slime molds. The RXS motif conserved in plant ACOs was replaced with RXG in PoACO, as in AbACO. The ACOs of straw mushroom, oyster mushroom and slime mold had 1–2 conserved ACO motifs, whereas the ACOs of plants had 4–5. In particular, VvACO2 and AbACO had only one ACO motif 2, indicating that ACO motif 2, ACC and Fe(II) should be essentially required for ACO activity.
Despite the fact that several ethylene receptors and ethylene signal transduction components of seed plants may originate from green algae [28], the ACOs in seed plants should not come from green algae. Houben and Van de Poel conducted a phylogenetic tree analysis of the ACOs of angiosperm plants along with putative ACOs of gymnosperms and other non-seed plants (without fungi), dividing these ACOs into Type I, Type II, Type III and the other group of the ancestral non-seed plant node of putative ACOs. Type I and Type II include ACOs of common angiosperm plants, and Type III includes ACOs of common angiosperm plants and putative ACOs of some gymnosperms. They proposed that the three types of ACOs diverged in parallel from a shared non-seed plant ancestral ACO [40]. However, neither putative ACO genes from gymnosperms nor non-seed plants were functionally characterized in vitro. The putative ACOs of the gymnosperms and other non-seed plants were almost all not ACOs but other 2OGDs.
The putative ACO protein PmACO of Pseudotsuga menziesii was able to bind to the Arabidopsis ACO antibody. Its expression was upregulated by mechanical wounding, consistent with the wound-induced increase in ethylene levels [62]. Three putative ACO genes, PtACO1-3, were cloned from Pinus taeda, and their promoters responded to indole-3-acetic acid (IAA), wounding, and gravitropic reorientation [63,64]. Cyanobacterium Hapalosiphon may have the ACC pathway to synthesize ethylene [12]. Two isopenicillin N synthase family oxygenases were annotated in the genome of Hapalosiphon sp. MRB220. One of them was 44.23% identical to VvACO4 in the deduced amino acid sequence and very likely to be ACO, named HaACO (GenBank WP_053457617.1). In this study, phylogenetic analysis of the identified functional ACOs of fungi, slime molds and some angiosperms, and possibly functional ACOs of several bacteria and gymnosperms, showed that the ACOs can be divided into four types. The ACOs of seed plants were grouped into Type I, Type II and Type III, similar to the above report [40]. Nevertheless, the ancestral Type IV contained only fungi, slime molds and bacteria. This suggests that the ACOs of seed plants may originate from microorganisms.
This study and a previous report [40] showed that the ACOs of monocotyledonous and dicotyledonous plants co-occur in Type I, Type II and Type III. Gymnosperm ACOs also appeared in Type III, implying the existence of horizontal gene transfer of ACOs in seed plants. In this study, the ACOs of bacteria, fungi and slime molds were clustered in Type IV, indicating that there was also horizontal gene transfer among them. ACOs are rarely found in bacteria but ordinarily in basidiomycetes, and the sequence identity of cyanobacterial HaACO and VvACO4 is as high as 44.23%, indicating that HaACO is likely to be horizontally transferred from fungi. Fungal ACOs contained only 1–2 conserved ACO motifs and were quite primitive and simple compared to plant ACOs. In addition, ACOs were not found in non-seed plants [34]. Therefore, ACOs in seed plants should be horizontally transferred from fungi. Horizontal gene transfers from fungi to seed plants have not been discovered previously [66]. The horizontal gene transfers from fungi to seed plants found in this study may be the first to be reported.
Ascomycota and Basidiomycota diverged about 500 million years ago—a little time before plants started their colonization of land [67]. The horizontal transfer of ACOs from fungi to plants probably facilitates fungal–plant symbioses, plant–land colonization and further evolution to form seeds.

5. Conclusions

We cloned, expressed and characterized five ACOs from basidiomycetes straw mushrooms and oyster mushrooms. The five ACOs, plus the previously identified AbACO of button mushroom, contained all three conserved residues that bind to Fe(II) in plant ACOs but did not contain the entire residues that conserved binding to ascorbate and bicarbonate in plant ACOs and only had 1–2 of the five conserved ACO motifs in plant ACOs. Interestingly, VvACO4 shared 44.23% sequence identity with the putative cyanobacterial HaACO. Evolutionary analysis of the functional ACOs of fungi, slime molds and angiosperm plants and the putative functional ACOs of cyanobacteria and gymnosperms can classify these ACOs into four types. The ACOs of monocotyledonous and dicotyledonous plants cooccurred in Type I, Type II and Type III. Gymnosperm ACOs also appeared in Type III. The ACOs of bacteria, fungi, and slime molds were clustered in Type IV. These results indicate that ACO motif 2, ACC and Fe(II) are essential for ACO activity. Horizontal gene transfer of ACOs exists between monocotyledonous and dicotyledonous plants, between seed plants and gymnosperms and between fungi and bacteria. The ACO genes of the other organisms may come from the horizontal transfer of fungal ACO genes.

Author Contributions

Conceptualization, L.Q. and M.W.; methodology, Y.L., M.Q., Q.Z., Z.X. and Y.Z.; formal analysis, Y.G. and Y.Q.; writing—original draft preparation, Y.L. and M.W.; writing—review and editing, L.Q.; funding acquisition, Y.L., L.Q. and M.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Science and Technology Department of Henan Province, grant numbers 202102110044 and 222102110302, and the National Natural Science Foundation of China, grant number 32102455.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Poel, B.V.D.; Cooper, E.D.; Delwiche, C.F.; Chang, C. An evolutionary perspective on the plant hormone ethylene. In Ethylene in Plants; Wen, C.K., Ed.; Springer: Dordrecht, The Netherlands, 2015; pp. 109–134. [Google Scholar]
  2. Kende, H. Ethylene biosynthesis. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1993, 44, 283–307. [Google Scholar] [CrossRef]
  3. Ali, S.; Kim, W.-C. Plant growth promotion under water: Decrease of waterlogging-induced ACC and ethylene levels by ACC deaminase-producing bacteria. Front. Microbiol. 2018, 9, 1096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Fukuda, H.; Ogawa, T.; Ishihara, K.; Fujii, T.; Nagahama, K.; Omata, T.; Inoue, Y.; Tanase, S.; Morino, Y. Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of Pseudomonas syringae pv. phaseolicola PK2. Biochem. Biophys. Res. Commun. 1992, 188, 826–832. [Google Scholar] [CrossRef] [Scilit]
  5. Tao, L.; Dong, H.J.; Chen, X.; Chen, S.F.; Wang, T.H. Expression of ethylene-forming enzyme (EFE) of Pseudomonas syringae pv. glycinea in Trichoderma viride. Appl. Microbiol. Biotechnol. 2008, 80, 573. [Google Scholar] [CrossRef] [Scilit]
  6. Martinez, S.; Fellner, M.; Herr, C.Q.; Ritchie, A.; Hu, J.; Hausinger, R.P. Structures and mechanisms of the non-heme Fe(II)-and 2-oxoglutarate-dependent ethylene-forming enzyme: Substrate binding creates a twist. J. Am. Chem. Soc. 2017, 139, 11980–11988. [Google Scholar] [CrossRef] [Scilit]
  7. Zhang, Z.; Smart, T.J.; Choi, H.; Hardy, F.; Lohans, C.T.; Abboud, M.I.; Richardson, M.S.W.; Paton, R.S.; McDonough, M.A.; Schofield, C.J. Structural and stereoelectronic insights into oxygenase-catalyzed formation of ethylene from 2-oxoglutarate. Proc. Natl. Acad. Sci. USA 2017, 114, 4667–4672. [Google Scholar] [CrossRef] [Scilit]
  8. Li, M.; Martinez, S.; Hausinger, R.P.; Emerson, J.P. Thermodynamics of iron (II) and substrate binding to the ethylene-forming enzyme. Biochemistry 2018, 57, 5696–5705. [Google Scholar] [CrossRef] [Scilit]
  9. Weingart, H.; Völksch, B.; Ullrich, M.S. Comparison of ethylene production by Pseudomonas syringae and Ralstonia solanacearum. Phytopathology 1999, 89, 360–365. [Google Scholar] [CrossRef] [Scilit]
  10. Valls, M.; Genin, S.; Boucher, C. Integrated regulation of the type III secretion system and other virulence determinants in Ralstonia solanacearum. PLoS Pathog. 2006, 2, e82. [Google Scholar] [CrossRef] [Scilit]
  11. Zavřel, T.; Knoop, H.; Steuer, R.; Jones, P.R.; Červený, J.; Trtílek, M. A quantitative evaluation of ethylene production in the recombinant cyanobacterium Synechocystis sp. PCC 6803 harboring the ethylene-forming enzyme by membrane inlet mass spectrometry. Bioresour Technol. 2016, 202, 142–151. [Google Scholar] [CrossRef] [Scilit]
  12. Huang, T.C.; Chow, T.J. Ethylene production by blue-green algae. Bot. Bull. Acad. Sin. 1984, 25, 81–86. [Google Scholar]
  13. Hottiger, T.; Boller, T. Ethylene biosynthesis in Fusarium oxysporum f. sp. tulipae proceeds from glutamate/2-oxoglutarate and requires oxygen and ferrous ions in vivo. Arch. Microbiol. 1991, 157, 18–22. [Google Scholar] [CrossRef] [Scilit]
  14. Pazout, J.; Pazoutova, S. Ethylene is synthesised by vegetative mycelium in surface cultures of Penicillium cyclopium Westling. Can. J. Microbiol. 1989, 35, 384–387. [Google Scholar] [CrossRef] [Scilit]
  15. Fukudaa, H.; Fujiia, T.; Ogawaa, T. Preparation of a cell-free ethylene- forming system from Penicillium digitatum. Agric. Biol. Chem. 1986, 50, 977–981. [Google Scholar] [CrossRef] [Scilit]
  16. Akhtar, M.J.; Arshad, M.; Khalid, A.; Mahmood, M.H. Substrate-dependent biosynthesis of ethylene by rhizosphere soil fungi and its influence on etiolated pea seedlings. Pedobiologia 2005, 49, 211–219. [Google Scholar] [CrossRef] [Scilit]
  17. Chagué, V.; Elad, Y.; Barakat, R.; Tudzynski, P.; Sharon, A. Ethylene biosynthesis in Botrytis cinerea. FEMS Microbiol. Ecol. 2002, 40, 143–149. [Google Scholar] [CrossRef] [Scilit]
  18. Cristescu, S.M.; De Martinis, D.; Hekkert, S.L.; Parker, D.H.; Harren, F.J.M. Ethylene production by Botrytis cinerea in vitro and in tomatoes. Appl. Environ. Microbiol. 2002, 68, 5342–5350. [Google Scholar] [CrossRef] [Scilit]
  19. Tzeng, D.; DeVay, J. Ethylene production and toxi genicity of methionine and its derivatives with riboflavin in cultures of Verticillium, Fusarium and Colletotrichum species exposed to light. Physiol. Plant 1984, 62, 545–552. [Google Scholar] [CrossRef] [Scilit]
  20. Zhang, C.; Huang, T.; Shen, C.; Wang, X.; Qi, Y.; Shen, J.; Song, A.; Qiu, L.; Ai, Y. Downregulation of ethylene production increases mycelial growth and primordia formation in the button culinary-medicinal mushroom, Agaricus bisporus (Agaricomycetes). Int. J. Med. Mushrooms 2016, 18, 1131–1140. [Google Scholar] [CrossRef] [Scilit]
  21. Meng, D.; Shen, L.; Yang, R.; Zhang, X.; Sheng, J. Identification and active site analysis of the 1-aminocyclopropane-1-carboxylic acid oxidase catalysing the synthesis of ethylene in Agaricus bisporus. Biochim. Biophys. Acta Gen. Subj. 2014, 1840, 120–128. [Google Scholar] [CrossRef] [Scilit]
  22. Amagai, A.; Maeda, Y. The ethylene action in the development of cellular slime molds: An analogy to higher plants. Protoplasma 1992, 167, 159–168. [Google Scholar] [CrossRef] [Scilit]
  23. Li, D.; Mou, W.; Van de Poel, B.; Chang, C. Something old, something new: Conservation of the ethylene precursor 1-amino-cyclopropane-1-carboxylic acid as a signaling molecule. Curr Opin Plant Biol. 2022, 65, 102116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Garcia-Jimenez, P.; Robaina, R.R. Effects of ethylene on tetrasporogenesis in Pterocladiella capillacea (Rhodophyta). J. Phycol. 2012, 48, 710–715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Maillard, P.; Thepenier, C.; Gudin, C. Determination of an ethylene biosynthesis pathway in the unicellular green alga, Haematococcus pluvialis. Relationship between growth and ethylene production. J. Appl. Phycol. 1993, 5, 93–98. [Google Scholar] [CrossRef] [Scilit]
  26. Driessche, T.V.; Kevers, C.; Collet, M.; Gaspar, T. Acetabularia mediterranea and ethylene: Production in relation with development, circadian rhythms in emission, and response to external application. J. Plant Physiol. 1988, 133, 635–639. [Google Scholar] [CrossRef] [Scilit]
  27. Plettner, I.N.A.; Steinke, M.; Malin, G. Ethene (ethylene) production in the marine macroalga Ulva (Enteromorpha) intestinalis L. (Chlorophyta, Ulvophyceae): Effect of light-stress and co-production with dimethyl sulphide. Plant Cell Environ. 2005, 28, 1136–1145. [Google Scholar] [CrossRef] [Scilit]
  28. Ju, C.; Van de Poel, B.; Cooper, E.D.; Thierer, J.H.; Gibbons, T.R.; Delwiche, C.F.; Chang, C. Conservation of ethylene as a plant hormone over 450 million years of evolution. Nat. Plants 2015, 1, 14004. [Google Scholar] [CrossRef] [Scilit]
  29. Rohwer, F.; Bopp, M. Ethylene synthesis in moss protonema. J. Plant Physiol. 1985, 117, 331–338. [Google Scholar] [CrossRef] [Scilit]
  30. Chernys, J.; Kende, H. Ethylene biosynthesis in Regnellidium diphyllum and Marsilea quadrifolia. Planta 1996, 200, 113–118. [Google Scholar] [CrossRef] [Scilit]
  31. Osborne, D.J.; Walters, J.; Milborrow, B.V.; Norville, A.; Stange, L.M.C. Evidence for a non-ACC ethylene biosynthesis pathway in lower plants. Phytochemistry 1996, 42, 51–60. [Google Scholar] [CrossRef] [Scilit]
  32. Uji, T.; Matsuda, R.; Takechi, K.; Takano, H.; Mizuta, H.; Takio, S. Ethylene regulation of sexual reproduction in the marine red alga Pyropia yezoensis (Rhodophyta). J. Appl. Phycol. 2016, 28, 3501–3509. [Google Scholar] [CrossRef] [Scilit]
  33. Endo, H.; Mizuta, H.; Uji, T. α-aminoisobutyric acid mimics the effect of 1-aminocyclopropane-1-carboxylic acid to promote sexual reproduction in the marine red alga Pyropia yezoensis (Rhodophyta). J. Appl. Phycol. 2021, 33, 1081–1087. [Google Scholar] [CrossRef] [Scilit]
  34. Li, F.-W.; Brouwer, P.; Carretero-Paulet, L.; Cheng, S.; de Vries, J.; Delaux, P.-M.; Eily, A.; Koppers, N.; Kuo, L.Y.; Li, Z.; et al. Fern genomes elucidate land plant evolution and cyanobacterial symbioses. Nat. Plants 2018, 4, 460–472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Katayose, A.; Kanda, A.; Kubo, Y.; Takahashi, T.; Motose, H. Distinct functions of ethylene and ACC in the basal land plant Marchantia polymorpha. Plant Cell Physiol. 2021, 62, 858–871. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Van de Poel, B.; Chang, C. Is losing ethylene a losing game? Mol. Plant 2022, 15, 788–790. [Google Scholar] [CrossRef] [Scilit]
  37. Kawai, Y.; Ono, E.; Mizutani, M. Evolution and diversity of the 2-oxoglutarate-dependent dioxygenase superfamily in plants. Plant J. 2014, 78, 328–343. [Google Scholar] [CrossRef] [Scilit]
  38. Dilley, D.R.; Wang, Z.; Kadirjan-Kalbach, D.K.; Ververidis, F.; Beaudry, R.; Padmanabhan, K. 1-aminocyclopropane-1-carboxylic acid oxidase reaction mechanism and putative post-translational activities of the ACCO protein. AoB Plants 2013, 5, plt031. [Google Scholar] [CrossRef] [Scilit]
  39. Aravind, L.; Koonin, E.V. The DNA-repair protein AlkB, EGL-9, and leprecan define new families of 2-oxoglutarate- and iron-dependent dioxygenases. Genome Biol. 2001, 2, research0007.1. [Google Scholar] [CrossRef] [Scilit]
  40. Houben, M.; Van de Poel, B. 1-Aminocyclopropane-1-carboxylic acid oxidase (ACO): The enzyme that makes the plant hormone ethylene. Front. Plant Sci. 2019, 10, 695. [Google Scholar] [CrossRef] [Scilit]
  41. Zhang, D.; Qi, Y.; Gao, Y.; Shen, J.; Qiu, L. Preliminary exploring on the mechanism of casing soil stimulating the primordium formation of Agaricus bisporus. Edible Fungi 2010, 32, 9–11. [Google Scholar]
  42. Eun, H.D.; Ali, S.; Jung, H.; Kim, K.; Kim, W.C. Profiling of ACC synthase gene (ACS11) expression in Arabidopsis induced by abiotic stresses. Appl. Biol. Chem. 2019, 62, 1–11. [Google Scholar] [CrossRef] [Scilit]
  43. Chen, S.; Qiu, C.; Huang, T.; Zhou, W.; Qi, Y.; Gao, Y.; Shen, J.; Qiu, L. Effect of 1-aminocyclopropane-1-carboxylic acid deaminase producing bacteria on the hyphal growth and primordium initiation of Agaricus bisporus. Fungal Ecol. 2013, 6, 110–118. [Google Scholar] [CrossRef] [Scilit]
  44. Li, T.; Zhang, J.; Gao, X.; Chen, J.; Zheng, Y.; Gao, Y.; Qiu, L. The molecular mechanism for the ethylene regulation of postharvest button mushrooms maturation and senescence. Postharvest Biol. Technol. 2019, 156, 110930. [Google Scholar] [CrossRef] [Scilit]
  45. Shui, P.R.; Zheng, X.B.; Lin, J.F.; Guo, L.Q. A rapid and efficient method for isolating high quality total RNA from edible fungi. Acta Edulis Fungi 2008, 15, 32–36. [Google Scholar]
  46. Furqan, B.R.N. Heterologous expression and characterization of thermostable lipase (Lk1) in Pichia pastoris GS115. Biocatal Agric Biotechnol. 2020, 23, 101448. [Google Scholar] [CrossRef] [Scilit]
  47. Zhang, C.; Shang, D.; Zhang, Y.; Gao, X.; Liu, D.; Gao, Y.; Li, Y.; Qi, Y.; Qiu, L. Two hybrid histidine kinases involved in the ethylene regulation of the mycelial growth and postharvest fruiting body maturation and senescence of Agaricus bisporus. Microbiol. Spectrum 2022, 10, 02411–02422. [Google Scholar] [CrossRef] [Scilit]
  48. Bao, D.; Gong, M.; Zheng, H.; Chen, M.; Zhang, L.; Wang, H.; Jiang, J.; Wu, L.; Zhu, Y.; Zhu, G.; et al. Sequencing and comparative analysis of the straw mushroom (Volvariella volvacea) genome. PLoS ONE 2013, 8, e58294. [Google Scholar] [CrossRef] [Scilit]
  49. Riley, R.; Salamov, A.A.; Brown, D.W.; Nagy, L.G.; Floudas, D.; Held, B.W.; Levasseur, A.; Lombard, V.; Morin, E.; Otillar, R.; et al. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi. Proc. Natl. Acad. Sci. USA 2014, 111, 9923–9928. [Google Scholar] [CrossRef] [Scilit]
  50. Vandenbussche, F.; Vriezen, W.H.; Smalle, J.; Laarhoven, L.J.J.; Harren, F.J.M.; Van Der Straeten, D. Ethylene and auxin control the Arabidopsis response to decreased light intensity. Plant Physiol. 2003, 133, 517–527. [Google Scholar] [CrossRef] [Scilit]
  51. Raz, V.; Ecker, J.R. Regulation of differential growth in the apical hook of Arabidopsis. Development 1999, 126, 3661–3668. [Google Scholar] [CrossRef] [Scilit]
  52. Dong, J.G.; Olson, D.; Silverstone, A.; Yang, S.F. Sequence of a cDNA coding for a 1-aminocyclopropane-1-carboxylate oxidase homolog from apple fruit. Plant Physiol. 1992, 98, 1530–1531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Clouse, R.M.; Carraro, N. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs). Front. Plant Sci. 2014, 5, 296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Mellidou, I.; Buts, K.; Hatoum, D.; Ho, Q.T.; Johnston, J.W.; Watkins, C.B.; Schaffer, R.J.; Gapper, N.E.; Giovannoni, J.J.; Rudell, D.R.; et al. Transcriptomic events associated with internal browning of apple during postharvest storage. BMC Plant Biol. 2014, 14, 328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Hamilton, A.J.; Bouzayen, M.; Grierson, D. Identification of a tomato gene for the ethylene-forming enzyme by expression in yeast. Proc. Natl. Acad. Sci. USA 1991, 88, 7434–7437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Sell, S.; Hehl, R. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced. J. DNA Seq. Mapp. 2005, 16, 80–82. [Google Scholar] [CrossRef] [Scilit]
  57. Zhang, Z.; Mao, C.; Shi, Z.; Kou, X. The amino acid metabolic and carbohydrate metabolic pathway play important roles during salt-stress response in tomato. Front. Plant Sci. 2017, 8, 1231. [Google Scholar] [CrossRef] [Scilit]
  58. Gallie, D.R.; Young, T.E. The ethylene biosynthetic and perception machinery is differentially expressed during endosperm and embryo development in maize. Mol. Genet. Genomics 2004, 271, 267–281. [Google Scholar] [CrossRef] [Scilit]
  59. Chae, H.S.; Cho, Y.G.; Park, M.Y.; Lee, M.C.; Eun, M.Y.; Kang, B.G.; Kim, W.T. Hormonal cross-talk between auxin and ethylene differentially regulates the expression of two members of the 1-aminocyclopropane-1-carboxylate oxidase gene family in rice (Oryza sativa L.). Plant Cell Physiol. 2000, 41, 354–362. [Google Scholar] [CrossRef] [Scilit]
  60. Iwai, T.; Miyasaka, A.; Seo, S.; Ohashi, Y. Contribution of ethylene biosynthesis for resistance to blast fungus infection in young rice plants. Plant Physiol. 2006, 142, 1202–1215. [Google Scholar] [CrossRef] [Scilit]
  61. Hudgins, J.W.; Ralph, S.G.; Franceschi, V.R.; Bohlmann, J. Ethylene in induced conifer defense: cDNA cloning, protein expression, and cellular and subcellular localization of 1-aminocyclopropane-1-carboxylate oxidase in resin duct and phenolic parenchyma cells. Planta 2006, 224, 865–877. [Google Scholar] [CrossRef] [Scilit]
  62. Yuan, S.; Wang, Y.; Dean, J.F. ACC oxidase genes expressed in the wood-forming tissues of loblolly pine (Pinus taeda L.) include a pair of nearly identical paralogs (NIPs). Gene 2010, 453, 24–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Yuan, S.; Dean, J.F. Differential responses of the promoters from nearly identical paralogs of loblolly pine (Pinus taeda L.) ACC oxidase to biotic and abiotic stresses in transgenic Arabidopsis thaliana. Planta 2010, 232, 873–886. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Shaw, J.; Chou, Y.; Chang, R.; Yang, S.F. Characterization of the ferrous ion binding sites of apple 1-aminocyclopropane-1-carboxylate oxidase by site-directed mutagenesis. Biochem. Biophys. Res. Commun. 1996, 700, 697–700. [Google Scholar] [CrossRef] [Scilit]
  65. Zhang, Z.; Ren, J.-S.; Clifton, I.J.; Schofield, C.J. Crystal structure and mechanistic implications of 1-aminocyclopropane-1-carboxylic acid oxidase—The ethylene-forming enzyme. Chem. Biol. 2004, 11, 1383–1394. [Google Scholar] [CrossRef] [Scilit]
  66. Richards, T.A.; Soanes, D.M.; Foster, P.G.; Leonard, G.; Thornton, C.R.; Talbot, N.J. Phylogenomic analysis demonstrates a pattern of rare and ancient horizontal gene transfer between plants and fungi. Plant Cell 2009, 21, 1897–1911. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Eastwood, D.C. Evolution of fungal wood decay. In Deterioration and Protection of Sustainable Biomaterials, ACS Symposium Series; Schultz, T.P., Goodell, B., Nicholas, D.D., Eds.; Amercian Chemical Society: Washington, DC, USA, 2014; pp. 93–112. [Google Scholar]
Figure 1. Expression and purification of the ACO proteins from straw mushrooms and oyster mushrooms. (A), VvACO1; (B), VvACO2; (C), VvACO3; (D), VvACO4; (E), PoACO. M, protein marker; C-E, control E. coli cell extract; CDS, cell disruption supernatant; C-Y, control yeast cell extract; PE, purified enzyme.
Figure 1. Expression and purification of the ACO proteins from straw mushrooms and oyster mushrooms. (A), VvACO1; (B), VvACO2; (C), VvACO3; (D), VvACO4; (E), PoACO. M, protein marker; C-E, control E. coli cell extract; CDS, cell disruption supernatant; C-Y, control yeast cell extract; PE, purified enzyme.
Jof 09 00055 g001
Figure 2. Specific activities of the heterologously expressed ACO enzymes from straw mushroom and oyster mushroom. The data shown were the mean of three independent experiments ± standard deviation (SD). They were analyzed by one-way analysis of variance (ANOVA) followed by the Tukey–Kramer multiple-comparison post hoc test. * Indicates a significant difference at p < 0.05.
Figure 2. Specific activities of the heterologously expressed ACO enzymes from straw mushroom and oyster mushroom. The data shown were the mean of three independent experiments ± standard deviation (SD). They were analyzed by one-way analysis of variance (ANOVA) followed by the Tukey–Kramer multiple-comparison post hoc test. * Indicates a significant difference at p < 0.05.
Jof 09 00055 g002
Figure 3. Selected functional ACO protein sequence alignment of mushrooms, slime molds and plants. Protein sequences were aligned using ClustalX 2.0. The important and conserved amino acid residues were marked in accordance with the legend shown.
Figure 3. Selected functional ACO protein sequence alignment of mushrooms, slime molds and plants. Protein sequences were aligned using ClustalX 2.0. The important and conserved amino acid residues were marked in accordance with the legend shown.
Jof 09 00055 g003
Figure 4. Unrooted phylogenetic tree of 27 ACO proteins generated by MEGA, version 11.0, with the maximum likelihood method. Numbers near branches show percentage bootstrap support. Red clades indicate fungal ACO proteins; blue clades indicate ACO proteins of gymnosperms; green clades indicate the ACO proteins of slime mold; purple clades indicate bacterial ACO proteins; black clades indicate the ACO proteins of angiosperms. The protein sequence information is listed in Table 2.
Figure 4. Unrooted phylogenetic tree of 27 ACO proteins generated by MEGA, version 11.0, with the maximum likelihood method. Numbers near branches show percentage bootstrap support. Red clades indicate fungal ACO proteins; blue clades indicate ACO proteins of gymnosperms; green clades indicate the ACO proteins of slime mold; purple clades indicate bacterial ACO proteins; black clades indicate the ACO proteins of angiosperms. The protein sequence information is listed in Table 2.
Jof 09 00055 g004
Figure 5. The phylogenetic relationships and conserved motif structure of the ACO protein sequences from the functional ACOs of fungi, slime molds and angiosperms plants, and the putative functional ACOs of cyanobacteria and gymnosperms. The phylogenetic trees were constructed MEGA version 11.0 with the maximum likelihood method. The conserved motif structure was discovered by MEME. The protein sequence information listed in Table 2.
Figure 5. The phylogenetic relationships and conserved motif structure of the ACO protein sequences from the functional ACOs of fungi, slime molds and angiosperms plants, and the putative functional ACOs of cyanobacteria and gymnosperms. The phylogenetic trees were constructed MEGA version 11.0 with the maximum likelihood method. The conserved motif structure was discovered by MEME. The protein sequence information listed in Table 2.
Jof 09 00055 g005
Table 1. List of primers used in the present study.
Table 1. List of primers used in the present study.
NameNucleotide Sequence (5′–3′)Application
PoACO-FATGCCTACGAAGGCATCTACACloning of PoACO
PoACO-RTTAGTTGAAATGCTTAATAACAGTTCCACGAATCC
pPIC9K-ACO-FAAGGCGAATTAATTCGCGGCCGCATGCCGACCAAAGCAAGCAConstruction for pPIC9K-PoACO
pPIC9K-ACO-RGCTGAAGCTTACGTAGAATTCTTAATGATGATGATGATGATGAA-
TCACTGTACCACG
VvACO3-FGGATCCATGTCCCATCTCAATTCTGCAGCCCloning of VvACOs and Construction for the VvACOs expression vectors
VvACO3-RAAGCTTTTAATAGGCACCGACTTGCCCG
VvACO1-FGGAATTCCATATGATGGCGGCTCCTAAATCTACC
VvACO1-RGCTCTAGATTAATACCTCCCCTTCTTCTCGTC
VvACO2-FCGGGATCCATGGCTGGCTTTGCCACGT
VvACO2-RGCTCTAGATCAAGCCTCAATGCGCTCAG
VvACO4-FCGGGATCCATGTTTATCTTAAGAACTCGGCTTC
VvACO4-RGCTCTAGATTACGAGTAGGTCACTGCCAGG
Table 2. Selected ACO sequences used in the phylogenetic analyses.
Table 2. Selected ACO sequences used in the phylogenetic analyses.
SpeciesProtein NameProtein IDTypeProtein (aa)Reference
Volvariella volvaceaVvACO4JGI 1119304354This study
VvACO3JGI 1166154374This study
VvACO2JGI 1186064381This study
VvACO1JGI 1111424353This study
Pleurotus ostreatusPoACOKDQ325804324This study
Agaricus bisporusAbACOJGI 1957894368[20]
Dictyostelium mucoroidesDmACOBAF648404368[22]
Arabidopsis thalianaAtACO1AT2G19590.12310[50]
AtACO2AT1G62380.11320[51]
AtACO5AT1G77330.13307[50]
Apple
(Malus domestica)
MdACO1MDP00001958851314[52]
MdACO6MDP00000256503298[53]
MdACO7MDP00002008962305[54]
Tomato
(Solanum lycopersicum)
SlACO1Solyc07g049530.2.11315[55]
SlACO5Solyc07g026650.2.12301[56]
SlACO7Solyc06g060070.2.13314[57]
Maize
(Zea mays)
ZmACO20Zm00008a017510_T011323[58]
ZmACO15Zm00008a037502_T013314[22]
Rice
(Oryza sativa)
OsACO1LOC_Os09g27820.11322[59]
OsACO6LOC_Os06g37590.12293[60]
OsACO7LOC_Os01g39860.12312[22]
OsACO4LOC_Os11g08380.13309[22]
Douglas fir
(Pseudotsuga menziesii)
PmACOABF205544320[61]
Loblolly pine
(Pinus taeda)
PtACO1ADD657624333[62,63]
PtACO2ADD657614333[62,63]
PtACO3ADD657604323[62,63]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, Y.; Qi, M.; Zhang, Q.; Xu, Z.; Zhang, Y.; Gao, Y.; Qi, Y.; Qiu, L.; Wang, M. Phylogenesis of the Functional 1-Aminocyclopropane-1-Carboxylate Oxidase of Fungi and Plants. J. Fungi 2023, 9, 55. https://doi.org/10.3390/jof9010055

AMA Style

Li Y, Qi M, Zhang Q, Xu Z, Zhang Y, Gao Y, Qi Y, Qiu L, Wang M. Phylogenesis of the Functional 1-Aminocyclopropane-1-Carboxylate Oxidase of Fungi and Plants. Journal of Fungi. 2023; 9(1):55. https://doi.org/10.3390/jof9010055

Chicago/Turabian Style

Li, Yanan, Man Qi, Qi Zhang, Zhixu Xu, Yan Zhang, Yuqian Gao, Yuancheng Qi, Liyou Qiu, and Mingdao Wang. 2023. "Phylogenesis of the Functional 1-Aminocyclopropane-1-Carboxylate Oxidase of Fungi and Plants" Journal of Fungi 9, no. 1: 55. https://doi.org/10.3390/jof9010055

APA Style

Li, Y., Qi, M., Zhang, Q., Xu, Z., Zhang, Y., Gao, Y., Qi, Y., Qiu, L., & Wang, M. (2023). Phylogenesis of the Functional 1-Aminocyclopropane-1-Carboxylate Oxidase of Fungi and Plants. Journal of Fungi, 9(1), 55. https://doi.org/10.3390/jof9010055

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop