Gramiketides, Novel Polyketide Derivatives of Fusarium graminearum, Are Produced during the Infection of Wheat
Abstract
1. Introduction
2. Materials and Methods
2.1. Generation of F. graminearum Mutant Strains
2.1.1. Inactivation of the PKS15 Gene
2.1.2. Generation of pks15 kmt6 Double Mutants
2.1.3. Generation of a tri5 pks4,13 Double Mutant
2.1.4. Complementation of the pks15 Mutation in the PH-1 Background
- Forward Primer: 5′—CGTTAAGCTTCTGGAAGACGTGTAC—3′,
- Reverse primer: 5′—TACACGTCTTCCAGAAGCTTAACGGCGGCT—3′.
2.2. Cultivation of Fungi
2.2.1. Cultivation in Liquid Minimal Medium
2.2.2. Cultivation on Native (12C) Glucose
2.2.3. Cultivation on 13C Labeled Glucose
2.2.4. Cultivation with Reversed Tracer Labeling Approach
2.2.5. Preparation of Fungal Samples for LC-HRMS Measurements
2.3. Cultivation and Treatment of Wheat Plants
2.3.1. Plant Cultivation and Infection
2.3.2. Preparation of Plant Samples
2.4. LC-HRMS(/MS) Measurements
2.4.1. Reversed Phase HPLC Method
2.4.2. HILIC HPLC Method
2.4.3. High Resolution Mass Spectrometry (HRMS(/MS)) Settings
2.5. Data Evaluation (Screening and Structure Annotation)
2.5.1. LC-HRMS Data Processing
2.5.2. Manual Metabolite Profile Screening
2.5.3. MetExtract II Data Processing
3. Results and Discussion
3.1. Genetics
3.2. Manual Screening for Differentially Produced Metabolites
3.3. Structural Analysis by Reversed Isotopic Labeling and LC-HRMS/MS
3.4. Merge of Results from In Vitro Cultivations and Plant Experiments
3.5. Time Course of Metabolite Abundance in Planta
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
ABA | Abscisic acid |
CAN | Acetonitrile |
AGC | Automatic gain control |
BGC | Biosynthetic gene clusters |
CE | Collision energy |
CYP | Cytochrome P450 |
DAI | Days after inoculation |
DDA | Data dependent acquisition |
DNA | Deoxyribonucleic acid |
DON | Deoxynivalenol |
ESI | Electrospray ionization |
HAI | Hours after inoculation |
FHB | Fusarium head blight |
HESI | Heated electrospray ionization |
HILIC | Hydrophilic interaction chromatography |
HPLC | High performance liquid chromatography |
HRMS | High resolution mass spectrometry |
LC | Liquid chromatography |
MeOH | Methanol |
MS | Mass spectrometry |
MS/MS | Tandem mass spectrometry |
NMR | Nuclear magnetic resonance |
NRPS | Non-ribosomal peptide synthase |
PKS | Polyketide synthase |
RP | Reversed-phase |
TPS | Terpenoid synthase |
ZEN | Zearalenone |
References
- Dean, R.; Van Kan, J.A.L.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Pietro, A.D.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef]
- Sieber, C.M.K.; Lee, W.; Wong, P.; Münsterkötter, M.; Mewes, H.-W.; Schmeitzl, C.; Varga, E.; Berthiller, F.; Adam, G.; Güldener, U. The Fusarium graminearum genome reveals more secondary metabolite gene clusters and hints of horizontal gene transfer. PLoS ONE 2014, 9, e110311. [Google Scholar] [CrossRef]
- Munkvold, G.P.; Proctor, R.H.; Moretti, A. Mycotoxin production in Fusarium according to contemporary species concepts. Annu. Rev. Phytopathol. 2021, 59, 373–402. [Google Scholar] [CrossRef]
- Adpressa, D.A.; Connolly, L.R.; Konkel, Z.M.; Neuhaus, G.F.; Chang, X.L.; Pierce, B.R.; Smith, K.M.; Freitag, M.; Loesgen, S. A metabolomics-guided approach to discover Fusarium graminearum metabolites after removal of a repressive histone modification. Fungal Genet. Biol. 2019, 132, 103256. [Google Scholar] [CrossRef]
- Hansen, F.T.; Gardiner, D.M.; Lysøe, E.; Fuertes, P.R.; Tudzynski, B.; Wiemann, P.; Sondergaard, T.E.; Giese, H.; Brodersen, D.E.; Sørensen, J.L. An update to polyketide synthase and non-ribosomal synthetase genes and nomenclature in Fusarium. Fungal Genet. Biol. 2015, 75, 20–29. [Google Scholar] [CrossRef]
- Brown, D.W.; Proctor, R.H. Insights into natural products biosynthesis from analysis of 490 polyketide synthases from Fusarium. Fungal Genet. Biol. 2016, 89, 37–51. [Google Scholar] [CrossRef]
- Gaffoor, I.; Brown, D.W.; Plattner, R.; Proctor, R.H.; Qi, W.; Trail, F. functional analysis of the polyketide synthase genes in the Filamentous Fungus Gibberella zeae (Anamorph Fusarium graminearum). Eukaryot. Cell 2005, 4, 1926–1933. [Google Scholar] [CrossRef]
- Kim, Y.-T.; Lee, Y.-R.; Jin, J.; Han, K.-H.; Kim, H.; Kim, J.-C.; Lee, T.; Yun, S.-H.; Lee, Y.-W. Two different polyketide synthase genes are required for synthesis of zearalenone in Gibberella zeae. Mol. Microbiol. 2005, 58, 1102–1113. [Google Scholar] [CrossRef] [PubMed]
- Westphal, K.R.; Muurmann, A.T.; Paulsen, I.E.; Nørgaard, K.T.H.; Overgaard, M.L.; Dall, S.M.; Aalborg, T.; Wimmer, R.; Sørensen, J.L.; Sondergaard, T.E. Who needs neighbors? PKS8 Is a stand-alone gene in Fusarium graminearum responsible for production of gibepyrones and prolipyrone, B. Molecules 2018, 23, 2232. [Google Scholar] [CrossRef] [PubMed]
- Sørensen, J.L.; Hansen, F.T.; Sondergaard, T.E.; Staerk, D.; Lee, T.V.; Wimmer, R.; Klitgaard, L.G.; Purup, S.; Giese, H.; Frandsen, R.J.N. Production of novel fusarielins by ectopic activation of the polyketide synthase 9 cluster in Fusarium graminearum. Environ. Microbiol. 2012, 14, 1159–1170. [Google Scholar] [CrossRef] [PubMed]
- Perincherry, L.; Lalak-Kańczugowska, J.; Stępień, Ł. Fusarium-Produced Mycotoxins in Plant-Pathogen Interactions. Toxins 2019, 11, 664. [Google Scholar] [CrossRef] [PubMed]
- Cambaza, E. Comprehensive description of Fusarium graminearum pigments and related compounds. Foods 2018, 7, 165. [Google Scholar] [CrossRef] [PubMed]
- Jørgensen, S.H.; Frandsen, R.J.N.; Nielsen, K.F.; Lysøe, E.; Sondergaard, T.E.; Wimmer, R.; Giese, H.; Sørensen, J.L. Fusarium graminearum PKS14 is involved in orsellinic acid and orcinol synthesis. Fungal Genet. Biol. 2014, 70, 24–31. [Google Scholar] [CrossRef] [PubMed]
- Adam, G.; Wiesenberger, G.; Güldener, U. Fusarium mycotoxins and their role in plant–pathogen interactions. In Biosynthesis and Molecular Genetics of Fungal Secondary Metabolites; Springer: Berlin/Heidelberg, Germany, 2015; Volume 2, pp. 199–233. [Google Scholar] [CrossRef]
- Bahadoor, A.; Brauer, E.K.; Bosnich, W.; Schneiderman, D.; Johnston, A.; Aubin, Y.; Blackwell, B.; Melanson, J.E.; Harris, L.J. Gramillin A and B: Cyclic lipopeptides identified as the nonribosomal biosynthetic products of Fusarium graminearum. J. Am. Chem. Soc. 2018, 140, 16783–16791. [Google Scholar] [CrossRef]
- Jia, L.-J.; Tang, H.-Y.; Wang, W.-Q.; Yuan, T.-L.; Wei, W.-Q.; Pang, B.; Gong, X.-M.; Wang, S.-F.; Li, Y.-J.; Zhang, D.; et al. A linear nonribosomal octapeptide from Fusarium graminearum facilitates cell-to-cell invasion of wheat. Nat. Commun. 2019, 10, 922. [Google Scholar] [CrossRef]
- Westphal, K.R.; Bachleitner, S.; Severinsen, M.M.; Brundtø, M.L.; Hansen, F.T.; Sørensen, T.; Wollenberg, R.D.; Lysøe, E.; Studt, L.; Sørensen, J.L.; et al. Cyclic, hydrophobic hexapeptide fusahexin is the product of a nonribosomal peptide synthetase in Fusarium graminearum. J. Nat. Prod. 2021, 84, 2070–2080. [Google Scholar] [CrossRef]
- Nielsen, M.R.; Sondergaard, T.E.; Giese, H.; Sørensen, J.L. Advances in linking polyketides and non-ribosomal peptides to their biosynthetic gene clusters in Fusarium. Curr. Genet. 2019, 65, 1263–1280. [Google Scholar] [CrossRef]
- Niehaus, E.-M.; Münsterkötter, M.; Proctor, R.H.; Brown, D.W.; Sharon, A.; Idan, Y.; Oren-Young, L.; Sieber, C.M.; Novák, O.; Pěnčík, A.; et al. Comparative “Omics” of the Fusarium fujikuroi Species Complex Highlights Differences in Genetic Potential and Metabolite Synthesis. Genome Biol. Evol. 2016, 8, 3574–3599. [Google Scholar] [CrossRef]
- Kroken, S.; Glass, N.L.; Taylor, J.W.; Yoder, O.; Turgeon, B.G. Phylogenomic analysis of type I polyketide synthase genes in pathogenic and saprobic ascomycetes. Proc. Natl. Acad. Sci. USA 2003, 100, 15670–15675. [Google Scholar] [CrossRef]
- Wiemann, P.; Sieber, C.M.; Von Bargen, K.W.; Studt, L.; Niehaus, E.-M.; Espino, J.J.; Huss, K.; Michielse, C.B.; Albermann, S.; Wagner, D. Deciphering the cryptic genome: Genome-wide analyses of the rice pathogen Fusarium fujikuroi reveal complex regulation of secondary metabolism and novel metabolites. PLoS Pathog. 2013, 9, e1003475. [Google Scholar] [CrossRef]
- Doppler, M.; Bueschl, C.; Kluger, B.; Koutnik, A.; Lemmens, M.; Buerstmayr, H.; Rechthaler, J.; Krska, R.; Adam, G.; Schuhmacher, R. Stable isotope–assisted plant metabolomics: Combination of global and tracer-based labeling for enhanced untargeted profiling and compound annotation. Front. Plant Sci. 2019, 10, 1366. [Google Scholar] [CrossRef] [PubMed]
- Doppler, M.; Kluger, B.; Bueschl, C.; Steiner, B.; Buerstmayr, H.; Lemmens, M.; Krska, R.; Adam, G.; Schuhmacher, R. Stable isotope-assisted plant metabolomics: Investigation of phenylalanine-related metabolic response in wheat upon treatment with the fusarium virulence factor deoxynivalenol. Front. Plant Sci. 2019, 10, 1137. [Google Scholar] [CrossRef] [PubMed]
- Twaruschek, K.; Spörhase, P.; Michlmayr, H.; Wiesenberger, G.; Adam, G. New Plasmids for Fusarium Transformation Allowing Positive-Negative Selection and Efficient Cre- loxP Mediated Marker Recycling. Front. Microbiol. 2018, 9, 1954. [Google Scholar] [CrossRef] [PubMed]
- Namiki, F.; Matsunaga, M.; Okuda, M.; Inoue, I.; Nishi, K.; Fujita, Y.; Tsuge, T. Mutation of an arginine biosynthesis gene causes reduced pathogenicity in Fusarium oxysporum f. sp. melonis. Mol. Plant Microbe Interact. 2001, 14, 580–584. [Google Scholar] [CrossRef]
- Güldener, U.; Heinisch, J.; Koehler, G.; Voss, D.; Hegemann, J. A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Res. 2002, 30, e23. [Google Scholar] [CrossRef]
- Horton, R.M. In vitro recombination and mutagenesis of DNA. In PCR Cloning Protocols: From Molecular Cloning to Genetic Engineering; White, B.A., Ed.; Humana Press: Totowa, NJ, USA, 1997; pp. 141–150. [Google Scholar] [CrossRef]
- Seidl, B.; Schuhmacher, R.; Büschl, C. CPExtract, a Software Tool for the Automated Tracer-Based Pathway Specific Screening of Secondary Metabolites in LC-HRMS Data. Anal. Chem. 2022, 94, 3543–3552. [Google Scholar] [CrossRef]
- Warth, B.; Parich, A.; Büschl, C.; Schöfbeck, D.; Neumann, N.K.N.; Kluger, B.; Schuster, K.; Krska, R.; Adam, G.; Lemmens, M.; et al. GC–MS based targeted metabolic profiling identifies changes in the wheat metabolome following deoxynivalenol treatment. Metabolomics 2015, 11, 722–738. [Google Scholar] [CrossRef]
- Chambers, M.C.; Maclean, B.; Burke, R.; Amodei, D.; Ruderman, D.L.; Neumann, S.; Gatto, L.; Fischer, B.; Pratt, B.; Egertson, J. A cross-platform toolkit for mass spectrometry and proteomics. Nat. Biotechnol. 2012, 30, 918–920. [Google Scholar] [CrossRef]
- Smith, C.A.; Want, E.J.; O’Maille, G.; Abagyan, R.; Siuzdak, G. XCMS: Processing mass spectrometry data for metabolite profiling using nonlinear peak alignment, matching, and identification. Anal. Chem. 2006, 78, 779–787. [Google Scholar] [CrossRef]
- Gatto, L.; Lilley, K.S. MSnbase-an R/Bioconductor package for isobaric tagged mass spectrometry data visualization, processing and quantitation. Bioinformatics 2012, 28, 288–289. [Google Scholar] [CrossRef]
- Büschl, C.; Kluger, B.; Neumann, N.K.N.; Doppler, M.; Maschietto, V.; Thallinger, G.G.; Meng-Reiterer, J.; Krska, R.; Schuhmacher, R. MetExtract II: A software suite for stable isotope assisted untargeted metabolomics. Anal. Chem. 2017, 89, 9518–9526. [Google Scholar] [CrossRef] [PubMed]
- Connolly, L.R.; Smith, K.M.; Freitag, M. The Fusarium graminearum histone H3 K27 methyltransferase KMT6 regulates development and expression of secondary metabolite gene clusters. PLoS Genet. 2013, 9, e1003916. [Google Scholar] [CrossRef] [PubMed]
- Steiger, M.G.; Vitikainen, M.; Uskonen, P.; Brunner, K.; Adam, G.; Pakula, T.; Penttilä, M.; Saloheimo, M.; Mach, R.L.; Mach-Aigner, A.R. Transformation system for Hypocrea jecorina (Trichoderma reesei) that favors homologous integration and employs reusable bidirectionally selectable markers. Appl. Environ. Microbiol. 2011, 77, 114–121. [Google Scholar] [CrossRef] [PubMed]
- Djoumbou Feunang, Y.; Eisner, R.; Knox, C.; Chepelev, L.; Hastings, J.; Owen, G.; Fahy, E.; Steinbeck, C.; Subramanian, S.; Bolton, E. ClassyFire: Automated chemical classification with a comprehensive, computable taxonomy. J. Cheminform. 2016, 8, 61. [Google Scholar] [CrossRef] [PubMed]
- Dührkop, K.; Fleischauer, M.; Ludwig, M.; Aksenov, A.A.; Melnik, A.V.; Meusel, M.; Dorrestein, P.C.; Rousu, J.; Böcker, S. SIRIUS 4: A rapid tool for turning tandem mass spectra into metabolite structure information. Nat. Methods 2019, 16, 299–302. [Google Scholar] [CrossRef]
- Dührkop, K.; Nothias, L.F.; Fleischauer, M.; Reher, R.; Ludwig, M.; Hoffmann, M.A.; Petras, D.; Gerwick, W.H.; Rousu, J.; Dorrestein, P.C.; et al. Systematic classification of unknown metabolites using high-resolution fragmentation mass spectra. Nat. Biotechnol. 2021, 39, 462–471. [Google Scholar] [CrossRef]
- Kim, H.W.; Wang, M.; Leber, C.A.; Nothias, L.-F.; Reher, R.; Kang, K.B.; van der Hooft, J.J.J.; Dorrestein, P.C.; Gerwick, W.H.; Cottrell, G.W. NPClassifier: A deep neural network-based structural classification tool for natural products. J. Nat. Prod. 2021, 84, 2795–2807. [Google Scholar] [CrossRef]
- Hufsky, F.; Scheubert, K.; Böcker, S. Computational mass spectrometry for small-molecule fragmentation. TrAC Trends Anal. Chem. 2014, 53, 41–48. [Google Scholar] [CrossRef]
- Schweiger, W.; Steiner, B.; Vautrin, S.; Nussbaumer, T.; Siegwart, G.; Zamini, M.; Jungreithmeier, F.; Gratl, V.; Lemmens, M.; Mayer, K.F.X.; et al. Suppressed recombination and unique candidate genes in the divergent haplotype encoding Fhb1, a major Fusarium head blight resistance locus in wheat. Theor. Appl. Genet. 2016, 129, 1607–1623. [Google Scholar] [CrossRef]
- Güldener, U.; Seong, K.-Y.; Boddu, J.; Cho, S.; Trail, F.; Xu, J.-R.; Adam, G.; Mewes, H.-W.; Mühlbauer, G.J.; Kistler, H.C. Development of a Fusarium graminearum Affymetrix GeneChip for profiling fungal gene expression in vitro and in planta. Fungal Genet. Biol. 2006, 43, 316–325. [Google Scholar] [CrossRef]
- Stephens, A.E.; Gardiner, D.M.; White, R.G.; Munn, A.L.; Manners, J.M. Phases of infection and gene expression of Fusarium graminearum During Crown Rot Disease of Wheat. Mol. Plant-Microbe Interact. 2008, 21, 1571–1581. [Google Scholar] [CrossRef] [PubMed]
- Lysøe, E.; Seong, K.-Y.; Kistler, H.C. The Transcriptome of Fusarium graminearum during the infection of wheat. Mol. Plant-Microbe Interact. 2011, 24, 995–1000. [Google Scholar] [CrossRef]
- Westphal, K.R.; Nielsen, K.A.H.; Wollenberg, R.D.; Møllehøj, M.B.; Bachleitner, S.; Studt, L.; Lysøe, E.; Giese, H.; Wimmer, R.; Sørensen, J.L.; et al. Fusaoctaxin A, an Example of a two-step mechanism for non-ribosomal peptide assembly and maturation in fungi. Toxins 2019, 11, 277. [Google Scholar] [CrossRef] [PubMed]
- Tang, Z.; Tang, H.; Wang, W.; Xue, Y.; Chen, D.; Tang, W.; Liu, W. Biosynthesis of a new fusaoctaxin virulence factor in Fusarium graminearum relies on a distinct path to form a guanidinoacetyl starter unit priming nonribosomal octapeptidyl assembly. J. Am. Chem. Soc. 2021, 143, 19719–19730. [Google Scholar] [CrossRef] [PubMed]
Strain Name | Construction (Plasmids Used for Transformation of Parental Strain) | Genotype | Strain Number |
---|---|---|---|
PH-1 | Wild-type (NRRL31084) | - | |
PPKS2 | PH-1/pKR3 + pKR9 | pks15∆::loxP-(PPKI1HSV-TK hphTcbh2)-loxP | 1983 |
PPKS4 | PH-1/pKR3+pKR9 (independent transformant) | pks15∆::loxP-(PPKI1HSV-TK hphTcbh2)-loxP | 1984 |
IARS43 | PH-1/pRS107 | kmt6∆::loxP-(PtrpC nptII TtrpC)-loxP | 1288 |
IARS45 | PH-1/pRS107 (independent transformant) | kmt6∆::loxP-(PtrpC nptII TtrpC)-loxP | 1289 |
KPKS5 | PPKS4/pRS105+pRS106 | pks15∆::loxP-(PPKI1HSV-TK hphTcbh2)-loxP kmt6∆::loxP-(PtrpC nptII TtrpC)-loxP | 2025 |
KPKS12 | PPKS4/pRS105+pRS106 | pks15∆::loxP-(PPKI1HSV-TK hphTcbh2)-loxP kmt6∆::loxP-(PtrpC nptII TtrpC)-loxP | 2026 |
dTRI5#11 | PH-1 split marker 3.6 kb NotI-PstI from pGW859-12 (486 bp TRI5 5′ region with up-tag Not-SpeI in pGW859), 2.1 kb NotI-SacII from pGW860-19 (503 bp TRI5 3’ region with down-tag in pGW851) | tri5Δ::loxP-(hph PXYN1-Cre)-loxP | 330 |
dTRI5#11-19 | dTRI5#11 Cre-mediated popout (hygromycin sensitive) | tri5Δ::loxP | 461 |
IAG4_9 | dTRI5#11-19, split hph - PKS4 and PKS13 flanking regions | tri5Δ::loxP pks4,13:: loxP-(hph PXYN1-Cre)-loxP | 614 |
IAG4_9_1 | IAG4_9 Cre-mediated popout, hygromycin sensitive | tri5Δ::loxP pks4,13:: loxP | 750 |
IARS49 | IAG4_9_1/pRS105+pRS106 | tri5Δ::loxP pks4,13:: loxP kmt6∆::loxP-(PtrpC nptII TtrpC)-loxP | 1290 |
IARS54 | IAG4_9_1/pRS105+pRS106 | tri5Δ::loxP pks4,13:: loxP kmt6∆::loxP-(PtrpC nptII TtrpC)-loxP | 1291 |
TPKS2 | IAG4_9_1/pKR3+pKR9/popout | tri5Δ::loxP pks4,13:: loxP pks15∆::loxP | 2119 |
TPKS4 | IAG4_9_1/pKR3+pKR9/popout | tri5Δ::loxP pks4,13:: loxP pks15∆::loxP | 2120 |
KTPKS17 | TPKS4/pRS105+pRS106 | tri5Δ::loxP pks4,13:: loxP pks15∆::loxP-(PPKI1HSV-TK hphTcbh2)-loxP kmt6∆::loxP-(PtrpC nptII TtrpC)-loxP | 2263 |
KTPKS38 | TPKS4/ pRS105+pRS106 | tri5Δ::loxP pks4,13:: loxP pks15∆::loxP-(PPKI1HSV-TK hphTcbh2)-loxP kmt6∆::loxP-(PtrpC nptII TtrpC)-loxP | 2266 |
7C PPKS3 | PPKS4 in locus complemented/additional silent HindIII in ORF | PKS15-C7131T | 2284 |
m/z (Native) | Rel. Abundance | Formula | Formal Loss | m/z Fully 13C | |
---|---|---|---|---|---|
Precursor | 521.30902 | 0.01 | C29H45O8 | - | 549.40291 |
Fragment 1 | 485.28986 | 0.51 | C29H41O6 | H4O2 | 514.38706 |
Fragment 2 | 467.27933 | 0.22 | C29H39O5 | H6O3 | 496.37649 |
Fragment 3 | 453.26367 | 0.11 | C28H37O5 | CH8O3 | 481.35749 |
Fragment 4 | 267.12268 | 0.10 | C14H19O5 | C15H26O3 | 281.16967 |
Fragment 5 | 211.06017 | 1.00 | C10H11O5 | C19H34O3 | 221.09365 |
Fragment 6 | 197.04457 | 0.53 | C9H9O5 | C20H36O3 | 206.07464 |
Fragment 7 | 183.02893 | 0.22 | C8H7O5 | C21H38O3 | 191.05564 |
Fragment 8 | 179.03395 | 0.71 | C9H7O4 | C20H38O4 | 188.06408 |
Fragment 9 | 165.01833 | 0.13 | C8H5O4 | C21H40O4 | 173.04507 |
Fragment 10 | 145.1013 | 0.11 | C11H13 | C18H32O8 | 156.13808 |
Fragment 11 | 133.10135 | 0.26 | C10H13 | C19H32O8 | 143.13473 |
Fragment 12 | 131.03407 | 0.18 | C5H7O4 | C24H38O4 | 136.05066 |
Fragment 13 | 113.02368 | 0.36 | C5H5O3 | C24H40O5 | 118.04009 |
Fragment 14 | 67.01859 | 0.22 | C4H3O | C25H42O7 | 71.03126 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Seidl, B.; Rehak, K.; Bueschl, C.; Parich, A.; Buathong, R.; Wolf, B.; Doppler, M.; Mitterbauer, R.; Adam, G.; Khewkhom, N.; et al. Gramiketides, Novel Polyketide Derivatives of Fusarium graminearum, Are Produced during the Infection of Wheat. J. Fungi 2022, 8, 1030. https://doi.org/10.3390/jof8101030
Seidl B, Rehak K, Bueschl C, Parich A, Buathong R, Wolf B, Doppler M, Mitterbauer R, Adam G, Khewkhom N, et al. Gramiketides, Novel Polyketide Derivatives of Fusarium graminearum, Are Produced during the Infection of Wheat. Journal of Fungi. 2022; 8(10):1030. https://doi.org/10.3390/jof8101030
Chicago/Turabian StyleSeidl, Bernhard, Katrin Rehak, Christoph Bueschl, Alexandra Parich, Raveevatoo Buathong, Bernhard Wolf, Maria Doppler, Rudolf Mitterbauer, Gerhard Adam, Netnapis Khewkhom, and et al. 2022. "Gramiketides, Novel Polyketide Derivatives of Fusarium graminearum, Are Produced during the Infection of Wheat" Journal of Fungi 8, no. 10: 1030. https://doi.org/10.3390/jof8101030
APA StyleSeidl, B., Rehak, K., Bueschl, C., Parich, A., Buathong, R., Wolf, B., Doppler, M., Mitterbauer, R., Adam, G., Khewkhom, N., Wiesenberger, G., & Schuhmacher, R. (2022). Gramiketides, Novel Polyketide Derivatives of Fusarium graminearum, Are Produced during the Infection of Wheat. Journal of Fungi, 8(10), 1030. https://doi.org/10.3390/jof8101030