Functional Study of the Chitinase CaChi93 Gene from the Mycoparasitic Cladosporium sp. SYC23
Abstract
1. Introduction
2. Materials and Methods
2.1. Strain Cultivation
2.2. Determination of N-Acetyl-D-Glucosamine Content
2.3. Identification and Bioinformatics Analysis of Hypothetical Chitinase Amino Acid Sequence in SYC23
2.4. Analysis of Chitinase Gene Expression in SYC23 Strain
2.5. Construction of the pET28a-CaChi93 Expression Vector
2.6. Expression and Purification of the Recombinant Chitinase CaChi93 Protein
2.7. Study on the Enzymatic Activity Characteristics of Recombinant Chitinase CaChi93
2.8. Study on the Inactivation of Aecidium pourthiaea Rust Spores by Recombinant Chitinase CaChi93
3. Results
3.1. Identification and Sequence Characterization of the CaChis Genes
3.2. Phylogenetic Analysis, Structural Features, and Analysis of Conserved Domains of CaCHis
3.3. Analysis of the CaChis Family Gene Promoters

3.4. Construction and Analysis of CaChis Protein Structures

3.5. Expression Relative to the CaChis Genes

3.6. Changes in N-Acetylglucosamine Production by SYC23 Strain Under Different Conditions

3.7. Protein Expression Assays and Purification

3.8. Chitinase Activity and Optimal Temperature and pH

3.9. Enzyme Activity on Aeciospores

4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A. Detailed List of Bioinformatics Analysis Online Websites
| Database | Function | Online Websites |
| CD-search | Conservative Domain Prediction | https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi (accessed on 16 March 2026) |
| SMART | https://smart.embl.de/ (accessed on 16 March 2026) | |
| ExPASy-ProtParm | Prediction of Basic Physical and Chemical Properties | https://www.psort.org/psortb/ (accessed on 16 March 2026) |
| SignalP 5.0 | Predictive signal peptide site | https://services.healthtech.dtu.dk/service.php?SignalP-5.0 (accessed on 16 March 2026) |
| TMHMM | Predicting Transmembrane Structures | https://services.healthtech.dtu.dk/service.php?TMHMM-2.0 (accessed on 16 March 2026) |
| MEME | Conservative Module Prediction | https://meme-suite.org/meme/tools/meme (accessed on 16 March 2026) |
| WoLF PSORT | Predicting Subcellular Localization | https://wolfpsort.hgc.jp/ (accessed on 16 March 2026) |
| Sompa | Predicting Secondary Structure | http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?pa-ge=npsa_sopma.html (accessed on 16 March 2026) |
| Plantcare | Prediction of Promoter Cis-Actin Elements | https://bioinformatics.psb.ugent.be/webtools/plantcare/html/ (accessed on 16 March 2026) |
| Protein blast | Chitinase Homologous Sequence Search | http://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 16 March 2026) |
| MAFFT v.7.0 | Multiple sequence alignment | https://mafft.cbrc.jp/alignment/software/ (accessed on 16 March 2026) |
| ChiPlot | Phylogenetic Tree construction and optimization | https://www.chiplot.online/ (accessed on 16 March 2026) |
References
- Editorial Committee of Flora of China. Flora of China; Chinese Academy of Sciences: Beijing, China, 1983; Volume 76. [Google Scholar]
- Min, Y.C. Landscape Dendrology, 2nd ed.; China Building Industry Press: Beijing, China, 2011. [Google Scholar]
- Guo, J.L.; Fang, C.C. Advances in Study of Genus Photinia. Resour. Appl. Landsc. Plants 2009, 44–47. [Google Scholar]
- Wan, X.S.; Mo, Y.; Bin, Z.; Sheng, Q.Z.; Jiang, G.; Shi, F.N. Overview of Pharmaceutical Research on Photinia Lindl. Anim. Husb. Feed. Sci. 2011, 11, 58–60. [Google Scholar]
- Can, C.; Wu, J.R. Study on the Aecidium pourthiaea syd. of heather rust. North Hortic. 2008, 1, 208–210. [Google Scholar]
- Li, M.; Xie, J.; Li, X.; Chen, Y. Hyperparasitism on Aecidium pourthiaea and Species Identification of the Mycoparasite. J. Northeast. For. Univ. 2016, 44, 92–96. [Google Scholar] [CrossRef]
- Zhu, L.; Tao, K.; Zuo, Y.; Zhao, Z.; Chen, Y. The biological characteristics of aeciospore germination of Aecidium wenshanense. Plant Prot. 2020, 46, 203–207. [Google Scholar] [CrossRef]
- Chul, K.S.; Hoe, K.C. Studies on the Disease of Pear Rust caused by Gymnosporangium haraeanum SYDOW I. Some Ecological Investigation of Inoculum Source. Korean J. Plant Prot. 1980, 19, 39–44. [Google Scholar]
- Lace, B.; Bankina, B. Evaluation of european pear rust severity depending on agro-ecological factors. Res. Rural. Dev. 2013, 1, 6–12. [Google Scholar]
- Deng, J.; Lv, X.; Yang, L.; Zhao, B.; Zhou, C.; Yang, Z.; Jiang, J.; Ning, N.; Zhang, J.; Shi, J. Assessing Macro Disease Index of Wheat Stripe Rust Based on Segformer with Complex Background in the Field. Sensors 2022, 22, 5676. [Google Scholar] [CrossRef] [PubMed]
- Avelino, J.; Cristancho, M.; Georgiou, S.; Imbach, P.; Aguilar, L.; Bornemann, G.; Läderach, P.; Anzueto, F.; Hruska, A.J.; Morales, C. The coffee rust crises in Colombia and Central America (2008–2013): Impacts, plausible causes and proposed solutions. Food Secur. 2015, 7, 303–321. [Google Scholar] [CrossRef]
- Castillo, N.E.T.; Acosta, Y.A.; Parra-Arroyo, L.; Martínez-Prado, M.A.; Rivas-Galindo, V.M.; Iqbal, H.M.; Bonaccorso, A.D.; Melchor-Martínez, E.M.; Parra-Saldívar, R. Towards an eco-friendly coffee rust control: Compilation of natural alternatives from a nutritional and antifungal perspective. Plants 2022, 11, 2745. [Google Scholar] [CrossRef]
- Mukherjee, P.K.; Mendoza-Mendoza, A.; Zeilinger, S.; Horwitz, B.A. Mycoparasitism as a mechanism of Trichoderma-mediated suppression of plant diseases. Fungal Biol. Rev. 2022, 39, 15–33. [Google Scholar] [CrossRef]
- Zhao, H.; Zhou, T.; Xie, J.; Cheng, J.; Fu, Y. Mycoparasitism illuminated by genome and transcriptome sequencing of Coniothyrium minitans, an important biocontrol fungus of the plant pathogen Sclerotinia sclerotiorum. Microb. Genom. 2020, 6, e000345. [Google Scholar] [CrossRef]
- Chao, M.; De, J.Y.; Jing, W.S.; Qiu, M.Z.; Cong, J.Y.; Hui, Y.C.; Jing, L. Identification and Transcriptomic Analysis of the Parasitic Branch Spore Fungus. Jiangsu Agric. Sci. 2023, 51, 19–29. [Google Scholar] [CrossRef]
- Chao, M.; Chang, S.F.; Man, X.A.; Jing, L. Genome sequencing and mycoparasitism mechanism of a Cladosporium sp. strain. Microbiol. China 2022, 49, 3310–3323. [Google Scholar] [CrossRef]
- Lei, K.; De, J.Y.; Yun, D.Z.; Chao, M.; Hui, Y.C.; Jing, L. The Diversity Analysis of Polyketide Synthase Genes in Mycoparasite Pestalotiopsis sp.cr013 Strain. J. West China For. Sci. 2021, 50, 144–150+156. [Google Scholar] [CrossRef]
- Yu, J.; Kong, L.; Fan, S.; Li, M.; Li, J. Genomic Characterization of the Mycoparasite Pestalotiopsis sp. Strain cr013 from Cronartium ribicola. Pol. J. Microbiol. 2023, 72, 433–442. [Google Scholar] [CrossRef]
- Weindling, R.; Emerson, O. The Isolation of a toxic substance from the culture filtrate of trichoderma. J. Biol. Chem. 1936, 26, 1068–1070. [Google Scholar]
- Zhuang, Y.; Liu, H.; Xu, M. Research progress in fungal chitinases. Acta Microbiol. Sin. 2024, 64, 4022–4035. [Google Scholar] [CrossRef]
- Hartl, L.; Zach, S.; Seidl-Seiboth, V. Fungal chitinases: Diversity, mechanistic properties and biotechnological potential. Appl. Microbiol. Biotechnol. 2012, 93, 533–543. [Google Scholar]
- Langner, T.; Göhre, V. Fungal chitinases: Function, regulation, and potential roles in plant/pathogen interactions. Curr. Genet. 2016, 62, 243–254. [Google Scholar]
- Sharma, C.K.; Vishnoi, V.K.; Dubey, R.; Maheshwari, D. A twin rhizospheric bacterial consortium induces systemic resistance to a phytopathogen Macrophomina phaseolina in mung bean. Rhizosphere 2018, 5, 71–75. [Google Scholar] [CrossRef]
- Li, J.; Zhou, L.; Chen, Y.; Li, Y. The Study on Degrading Enzymes of Cell Wall from Two Mycoparasites of Cronartium ribicola. Chin. Agric. Sci. Bull. 2012, 28, 85–91. [Google Scholar]
- Ting, J. Whole Genome Analysis and Optimization of Femrentation Technology for High-Yield Chitinase Strain EBI-001. Master’s Thesis, Harbin Institute of Technology, Harbin, China, 2020. [Google Scholar]
- Qin, L. Sequence Analysis and Cloning and Expression of Chitinase from Streptomyces Diastaticus CS1801. Master’s Thesis, Soochow University, Suzhou, China, 2021. [Google Scholar]
- Junges, Â.; Boldo, J.T.; Souza, B.K.; Guedes, R.L.M.; Sbaraini, N.; Kmetzsch, L.; Thompson, C.E.; Staats, C.C.; de Almeida, L.G.P.; de Vasconcelos, A.T.R. Genomic analyses and transcriptional profiles of the glycoside hydrolase family 18 genes of the entomopathogenic fungus Metarhizium anisopliae. PLoS ONE 2014, 9, e107864. [Google Scholar]
- Jing, W.S.; Cong, J.Y.; Chang, S.F.; Jiao, M.L.; Qing, Y.Z.; Jing, L. Identification and Expression Analysis of the Chitinases Gene Family in Pestalotiopsis kenyana. J. Southwest For. Univ. 2024, 44, 21–30. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Li, X.G. Cloning, Expression, Enzymatic Properties, and Physiological Function of the Chitinase ChiB Gene from Aspergillus niger. Master’s Thesis, Nanjing Normal University, Nanjing, China, 2018. [Google Scholar]
- Qiao, Z.; Cheng, Y.L. Heterologous Expression and Catalytic Properties of Chitinase Gene from Vibrio Natriegens. Food Sci. Technol. 2022, 47, 10–17. [Google Scholar] [CrossRef]
- Seidl, V.; Huemer, B.; Seiboth, B.; Kubicek, C.P. A complete survey of Trichoderma chitinases reveals three distinct subgroups of family 18 chitinases. FEBS J. 2005, 272, 5923–5939. [Google Scholar] [CrossRef]
- Goughenour, K.D.; Whalin, J.; Slot, J.C.; Rappleye, C.A. Diversification of fungal chitinases and their functional differentiation in Histoplasma capsulatum. Mol. Biol. Evol. 2021, 38, 1339–1355. [Google Scholar] [CrossRef]
- Kim, D.-J.; Baek, J.-M.; Uribe, P.; Kenerley, C.M.; Cook, D.R. Cloning and characterization of multiple glycosyl hydrolase genes from Trichoderma virens. Curr. Genet. 2002, 40, 374–384. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Chen, X.; Li, S.; Wang, Q.; Liu, Y.; Zhang, Z.; Yang, C.; Xu, S.; Mao, K.; Ma, F. MdMYB54 reduces disease severity caused by Fusarium solani in apple by modulating cell wall cellulose and pectate lyase-dependent defense. Plant J. 2025, 121. [Google Scholar] [CrossRef]
- Chen, L.; Geng, X.; Ma, Y.; Zhao, J.; Li, T.; Ding, S.; Shi, Y.; Li, H. Identification of basic helix-loop-helix transcription factors reveals candidate genes involved in pathogenicity of Fusarium pseudograminearum. Can. J. Plant Pathol. 2019, 41, 200–208. [Google Scholar]
- Fan, S.C.; Sui, W.G.; Yang, J.C.; Li, M.J.; Li, J. Genome-wide Identification and Analysis of the bHLH Transcription Factor Family in Mycoparasite cladosporium SYC63 Strain. Mol. Plant Breed. 2023, 1–15. Available online: https://link.cnki.net/urlid/46.1068.S.20231117.1713.002 (accessed on 19 March 2026).
- Jun, C.Y.; Wen, J.S.; Shi, C.F.; Ming, J.L.; Jing, L. Identification and Analysis of the MYB Transcription Factor Family in Mycoparasite Pestalotiopsis kenyana PG52 Strain. Mol. Plant Breed. 2023, 1–15. Available online: http://kns.cnki.net/kcms/detail/46.1068.S.20230228.1512.011.html (accessed on 16 March 2026).
- Jing, W.S.; Chao, M.; Cong, J.Y.; Chang, S.F.; Jiao, M.L.; Jing, L. Genome-wide identification and analysis of the MYB transcription factor family in mycoparasite Cladosporium SYC63 strain. Microbiol. China 2023, 50, 615–631. [Google Scholar] [CrossRef]
- Vieira, P.M.; Coelho, A.S.G.; Steindorff, A.S.; de Siqueira, S.J.L.; Silva, R.d.N.; Ulhoa, C.J. Identification of differentially expressed genes from Trichoderma harzianum during growth on cell wall of Fusarium solani as a tool for biotechnological application. BMC Genom. 2013, 14, 177. [Google Scholar]
- López-Calva, V.L.; de Jesús Huerta-García, A.; Téllez-Jurado, A.; Mercado-Flores, Y.; Anducho-Reyes, M.A. Isolation and selection of autochthonous strains of Trichoderma spp. with inhibitory activity against Sporisorium reilianum. Braz. J. Microbiol. 2023, 54, 3173–3185. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, J.; Wang, W. Identification of mycoparasitism-related genes in Trichoderma harzianum T4 that are active against Colletotrichum musae. Arch. Microbiol. 2023, 206, 29. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.Y.; Bao, Z.R.; Li, J.; Ao, X.Y.; Zhu, J.Y.; Chen, Y.H. Identification of differentially expressed genes from Trichoderma atroviride strain SS003 in the presence of cell wall of Cronartium ribicola. Genes Genom. 2017, 39, 473–484. [Google Scholar] [CrossRef]
- Ferrari, A.R.; Gaber, Y.; Fraaije, M.W. A fast, sensitive and easy colorimetric assay for chitinase and cellulase activity detection. Biotechnol. Biofuels 2014, 7, 37. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.Y.; He, J.M.; Kang, Y.J. Reviews on Strategies of Enhance Heterologous ProteinSoluble Expression in Escherichia coli. World Sci. Tech. R&D 2015, 37, 627–630. [Google Scholar] [CrossRef]
- Yan, Z.S. Identification of the Nematicidal Function of Endochitinase Gene T6-Echi18-5 in Trichoderma longibrachiatum T6 Strain. Doctoral Thesis, Gansu Agricultural University, Lanzhou, China, 2023. [Google Scholar]
- Ouyang, Y.; Lin, M.; Wang, Q.; Lu, B.; Lü, X.; Huang, J.; Zhou, R.; Liang, S.; Qin, Q.; Wang, Q.; et al. Expression and Characterization of Chitinase from Microbulbifer thermotolerans YLW106. Guangxi Sci. 2024, 31, 731–741. [Google Scholar] [CrossRef]
- Ying, L. Fuanctional Study of Chitinase VC1073, VCA0027 and VC1952 from Vibrio Cholerae. Master’s Thesis, Shandong University, Jinan, China, 2018. [Google Scholar]
- Jing, Z.; Li, X.G.; Yu, S.J.; Yu, W.; Hua, Z.L. Structure analysis and recombinant expression of chitinase ChiB from Aspergillusnidulans. J. Chongqing Univ. Technol. 2022, 36, 268–273. [Google Scholar]
- Jia, L. The Characteristics and Functions of Chitinases and Chitin-Binding Protein from Xenorhabdus nematophila. Doctoral Thesis, Hebei Agricultural University, Baoding, China, 2020. [Google Scholar]
- Song, X.W.; Lei, M.; Ying, Z.L.; Tuo, L.; Han, Z.; Yang, D.L.; Rong, Q.S. Cloning, expression and enzymology characteristics of an endo-chitinase gene chi8 from Trichoderma guizhouense NJAU4742. J. Nanjing Agric. Univ. 2021, 44, 111–118. [Google Scholar]
- Elshahawy, I.E.; Marrez, D.A. Antagonistic activity of Trichoderma asperellum against Fusarium species, chemical profile and their efficacy for management of Fusarium-root rot disease in dry bean. Pest Manag. Sci. 2024, 80, 1153–1167. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.Y.; Wei, T.; Quan, H.X. Enzymatic Properties and Antimicrobial Activity of Recombinant Pichia pastoris Expressing the Chitinase gene02524 from Trichoderma harzianum. Jiangsu Agric. Sci. 2022, 50, 96–103. [Google Scholar] [CrossRef]
- Harighi, M.J.; Zamani, M.R.; Motallebi, M. Evaluation of Antifungal Activity of Purified Chitinase 42 from Trichoderma atroviride PTCC5220. Biotechnology 2007, 6, 28–33. [Google Scholar]


| Primer Name | Primer Sequence (5′ to 3′) | Primer Name | Primer Sequence (5′ to 3′) |
|---|---|---|---|
| ITS1-F | TCCGTAGGTGAACCTGCGG | ITS4-R | TCCTCCGCTTATTGATATGC |
| CaChi45-F | TTCGCCGTTCCTATGTCCAC | CaChi45-R | ACCTTCCTTTGGGCTCTGTG |
| CaChi40-F | CGGTATGGGTGTACCTCAGC | CaChi40-R | ACTATTGAGAGCGGCGACAG |
| CaChi82-F | GCGTGTCGAACAACAACACT | CaChi82-R | AATCTCCGTCTTGCGACCTG |
| CaChi67-F | GGGTCTACAAGTTTGCGTGC | CaChi67-R | GCATCCGCTTGGTAGAGACA |
| CaChi34-F | CCTGGATGTGGGTGAAGGAG | CaChi34-R | GCGGATCAGATGTCGTTCCA |
| CaChi286-F | CATCAGACTCGACACCCTCG | CaChi286-R | GAATCTCACCCTCGCCAGTC |
| CaChi92-F | TATGATGTGGGATGCGAGCC | CaChi92-R | CACCCTCACACCATCCCTTC |
| CaChi93-F | CATGGTTGATGTCACGGCTG | CaChi93-R | TTTGCCTGCTACTGCTGAGG |
| Gene Sequence ID | Gene Name | Length (aa) | Molecular Weight (kDa) | pI | Aliphatic | Hydrophilicity Index (GRAVY) | Signal Peptide | Subcellular Localization | Transmembrane Structure | Structure Domain |
|---|---|---|---|---|---|---|---|---|---|---|
| NODE_9_0000379_t | CaChi45 | 403 | 44.91 | 5.31 | 67.59 | −0.465 | - | extr: | - | Glyco_hydro_18 |
| NODE_11_0000661_t | CaChi40 | 361 | 39.51 | 5.79 | 84.29 | −0.212 | - | mito: | - | Glyco_hydro_18, UBA_like_SF |
| NODE_32_0002076_t | CaChi82 | 782 | 82.34 | 7.7 | 63.82 | −0.218 | + | extr: | - | Glyco_hydro_18 |
| NODE_34_0002517_t | CaChi67 | 603 | 66.73 | 4.74 | 65.56 | −0.341 | - | cyto: | - | Glyco_hydro_18, ChtBD1 |
| NODE_39_0002890_t | CaChi34 | 316 | 33.86 | 4.48 | 81.2 | −0.142 | - | extr: | - | Glyco_hydro_18 |
| NODE_44_0003251_t | CaChi286 | 2633 | 286.03 | 4.94 | 69.85 | −0.317 | + | extr: | 5 | Glyco_hydro_18, ChtBD1, ZntA, AprE, Peptidases_S8_S53 |
| NODE_53_0003630_t | CaChi92 | 821 | 91.54 | 5.86 | 74.57 | −0.354 | - | plas: | - | Glyco_hydro_18, MOSC, FNR_like |
| NODE_73_0003950_t | CaChi93 | 842 | 92.52 | 5.89 | 86.56 | 0.048 | + | plas: | 10 | Glyco_hydro_18, GH18_chitinase, AA_permease_2, PotE |
| Sequence ID | α-Helix/% | β-Angle/% | Irregular Curling/% | Extension Chain/% |
|---|---|---|---|---|
| CaChi34 | 39.24 | 5.38 | 43.99 | 11.39 |
| CaChi40 | 30.47 | 3.6 | 52.08 | 13.85 |
| CaChi45 | 30.02 | 5.64 | 50.12 | 14.39 |
| CaChi67 | 20.73 | 3.15 | 60.53 | 15.59 |
| CaChi82 | 16.24 | 2.3 | 68.16 | 13.3 |
| CaChi92 | 28.62 | 6.09 | 47.5 | 17.78 |
| CaChi93 | 32.78 | 8.19 | 39.07 | 19.95 |
| CaChi286 | 22.86 | 3.68 | 59.13 | 14.32 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Chen, C.; Li, M.; Gao, R.; Yan, M.; Zhou, T.; Tang, Y.; Li, J. Functional Study of the Chitinase CaChi93 Gene from the Mycoparasitic Cladosporium sp. SYC23. J. Fungi 2026, 12, 237. https://doi.org/10.3390/jof12040237
Chen C, Li M, Gao R, Yan M, Zhou T, Tang Y, Li J. Functional Study of the Chitinase CaChi93 Gene from the Mycoparasitic Cladosporium sp. SYC23. Journal of Fungi. 2026; 12(4):237. https://doi.org/10.3390/jof12040237
Chicago/Turabian StyleChen, Chen, Mingjiao Li, Ruotian Gao, Mengling Yan, Ting Zhou, Yanping Tang, and Jing Li. 2026. "Functional Study of the Chitinase CaChi93 Gene from the Mycoparasitic Cladosporium sp. SYC23" Journal of Fungi 12, no. 4: 237. https://doi.org/10.3390/jof12040237
APA StyleChen, C., Li, M., Gao, R., Yan, M., Zhou, T., Tang, Y., & Li, J. (2026). Functional Study of the Chitinase CaChi93 Gene from the Mycoparasitic Cladosporium sp. SYC23. Journal of Fungi, 12(4), 237. https://doi.org/10.3390/jof12040237
