Next Article in Journal
Molecular Identification and Pathogenicity of Fusarium Fungi Causing Potato Dry Rot in Shanxi Province, China
Next Article in Special Issue
Morphology and Updated Phylogeny Revealed Three New Species in Chlorencoelia (Cenangiaceae, Helotiales) from China
Previous Article in Journal
Effects of Insect Cuticular Compounds on Appressorium Formation and Metabolic Activity in Beauveria bassiana
Previous Article in Special Issue
Metagenomic Insights into Disease-Induced Microbial Dysbiosis and Elemental Cycling Alterations in Morchella Cultivation Soils: Evidence from Two Distinct Regions
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Global Diversity, Host Associations, and New Insights into Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae

Shenzhen Key Laboratory of Microbial Genetic Engineering, College of Life Science and Oceanography, Shenzhen University, Shenzhen 518060, China
*
Author to whom correspondence should be addressed.
J. Fungi 2025, 11(12), 834; https://doi.org/10.3390/jof11120834
Submission received: 28 October 2025 / Revised: 17 November 2025 / Accepted: 19 November 2025 / Published: 25 November 2025
(This article belongs to the Special Issue Ascomycota: Diversity, Taxonomy and Phylogeny, 3rd Edition)

Abstract

During a survey of plant litter-associated microfungi in Guangdong and Jiangxi Provinces, China, several specimens that have carbonaceous ascomata were collected. Morphological characteristics combined with multi-gene (LSU, SSU, and tef1-α) phylogeny revealed that they belong to the Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae families. Phylogenetic analyses were conducted using Maximum Likelihood (ML) and Bayesian Inference (BI) approaches. Caryospora pruni and Pseudoastrosphaeriella zingiberacearum are introduced as new species, and Astrosphaeriella bambusae, C. quercus, Fissuroma caryotae, and Neoastrosphaeriella aquatica are introduced as new host records. In addition, Caryospora minima is synonymized under C. aquatica based on close morphological and phylogenetic relationships. All the newly introduced species fit well with their respective generic concepts and can be distinguished from closely related species in their morphology and DNA molecular data. The new host records also provide similar morphological characteristics to their respective type species, and multi-gene phylogeny analyses also offer evidence for their placements. In addition, we compiled the geographical distribution and host associations of species in Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae. This provides a database for future studies to understand the ecological interactions and geographical variations.

1. Introduction

Global fungal diversity is a critical aspect of global biodiversity, and realistic estimations have been controversial for decades (Figure 1). Mycologists have used various estimation criteria to achieve the realistic fungal diversity over time [1,2,3,4,5,6,7,8]. For instance, based on the plant-to-fungi ratio of 1:6, Hawksworth [1] estimated that there are approximately 1.5 million species. This assessment was revised by Hammond [2] and Rossman [3] and assessed to have 1 million species. Subsequently, the number of fungal species worldwide fluctuated significantly with varying numbers, such as 1.5 million [9], 9.9 million [10], 0.5 million [4], >1.5 million [11], 0.5–9.9 million [12], 3.5–5.1 million [13], 0.72 million [14], 5.1 million [5], and 1.5–3 million [15]. In 2017, Hawksworth and Lücking adjusted the fungal diversity figure to 2.2–3.8 million species, considering plant-to-fungi ratios, hidden cryptic species, high-throughput data, unexplored habitats, and the ongoing discovery of novel taxa. This was further expanded to 11.7–13.2 million [7] and to 6.3 million species [16,17] with the consideration of high-throughput sequencing (HTS)-powered metabarcoding approaches.
This dramatic increase in estimated diversity is attributed to advancements in DNA sequencing technologies and the comprehensive studies that collectively assess fungal diversity across various ecosystems. However, despite this vast diversity of fungal communities, only about 150,000 species have been formally described, highlighting a considerable gap in our understanding of fungal life forms and their ecological roles [18]. The discrepancy between estimated and described species numbers emphasizes the need for extensive investigations into fungal diversity, especially within unexplored niches and biodiversity hotspots, substrates, and regions.
Figure 1. Estimations of the global number of fungal species [19,20,21,22,23,24,25,26,27,28,29,30,31,32,33].
Figure 1. Estimations of the global number of fungal species [19,20,21,22,23,24,25,26,27,28,29,30,31,32,33].
Jof 11 00834 g001
China is recognized as a global hotspot for fungal diversity, particularly due to the vast geographical and ecological variety (e.g., forests, grasslands, lakes, mangroves, mountains, rivers, and seas), which contributes to a rich array of fungal species [34,35,36]. In particular, the highly variable climate and luxuriant vegetation in China make favorable settings for the growth and reproduction of fungal species [37,38]. Over the past three decades, mycologists in China have significantly contributed to the inclusive range of fungal discoveries [34,38,39,40,41,42,43,44,45]. Initially, fungal taxonomy studies in China were mainly based on morphological characteristics coupled with hand-drawn illustrations with descriptions and taxonomic keys [46,47,48,49]. However, this has undergone a revolutionary shift from traditional morphology-based identification to molecular-based techniques with the rapid evolution of DNA sequencing technology [45,50,51,52]. In addition, current HTS platforms generate millions of barcode reads within hours, enabling researchers to resolve cryptic species, detect rare or dark taxa in complex substrates, and reconstruct phylogenies [53,54,55]. As a result, China has emerged as a key contributor to global fungal research, with an increasing number of studies and novel discoveries. Currently, China accounts for almost 7% of recorded fungal species, occupying the second-highest position worldwide [38].
Therefore, our research group at the College of Life Science and Oceanography in Shenzhen University has been conducting investigations into the microfungal diversity of plant litter substrates (e.g., dead wood, leaves, branches, seeds, twigs, and fruits) in China. Mainly, we are focusing on their geographical distribution, host associations, morphological characteristics, and phylogenetic affinities [56,57]. As a result, we collected six plant litter specimens bearing carbonaceous ascomata from Arenga undulatifolia, Citrus maxima, Hedychium coronarium, Metroxylon sagu, Phoenix paludosa, and Prunus persica. They apparently belong to the families Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae based on ascomata characteristics (e.g., carbonaceous, conical to hemispherical shape) and the previous literature [58,59,60]. The objectives of this study are (1) to identify the isolated taxa using both morphology and phylogenetic approaches and (2) to provide an updated checklist (host occurrence and global distribution) of the species in Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae. In particular, this study offers a database for future studies to understand the worldwide distribution and host connections of those families.

2. Materials and Methods

2.1. Samples Collection, Microscopic Observations, and Fungal Isolation

Decaying plant litter samples (dead stems and pericarp of fruit) were collected from Guangdong and Jiangxi Provinces during 2024–2025. Collected specimens were taken back to the laboratory in sealed envelopes for morphology examination. All the specimens were incubated in a plastic box with a wet tissue paper (two days). Initially, the macro-morphological characteristics were checked using a stereomicroscope (AXIOSKOP 2 PLUS Series, Göttingen, Germany), and mainly surface characteristics of ascomata, such as color, shape, and position of the host surface (e.g., immersed, semi-immersed, and erumpent or superficial), were recorded. Ascomata were manually sectioned using a razor blade and mounted in water on a slide to observe their microscopic features (e.g., shape, the arrangement of peridium cells). Microscopic slides were prepared using the needle of an aseptic syringe and distilled water. Micro-morphological characteristics were examined using a Nikon ECLIPSE Ni-U compound microscope (Nikon Corporation, Tokyo, Japan), equipped with a Canon Axiocam 506 color digital camera (Hanover, Germany). Indian ink was used to determine the presence of the mucilaginous sheath of ascospores. Lactoglycerol and nail polish were used to prepare the permanent slides for future studies. Measurements were obtained using NIS-Elements version 5.10 imaging software when capturing photographs. Photo plates were prepared using Adobe Photoshop CS6 Extended version 10.0 software (Adobe Systems, San Jose, CA, USA).
Single ascospore isolation was conducted, and germinated spores were processed by following the methods described in Senanayake et al. [61]. Pure cultures were grown in potato dextrose agar (PDA) medium at room temperature (24–28 °C). Culture characteristics, such as color, density, shape, elevation, surface, edge, consistency, and margin, were observed after three weeks. Type specimens were deposited at room temperature (24–28 °C) in the Herbarium of Fungi, Shenzhen University, Shenzhen, China. Living cultures were deposited in the Culture Collection of Microbial Shenzhen University (MBSZU), Shenzhen University, Shenzhen, China. The new taxa were registered in Index Fungorum numbers (https://www.indexfungorum.org/names/Names.asp, accessed on 20 September 2025).

2.2. DNA Extraction, PCR Amplification, and Sequencing

The scraped fungal mycelia (grown on PDA for 4 weeks at 24–28 °C) were used for the DNA extraction (for Astrosphaeriella bambusae, Caryospora pruni, and Pseudoastrosphaeriella zingiberacearum). Initially, axenic mycelium (50–100 mg) was crushed to a fine powder using glass beads (acid-washed, 212–300 µm, Norcross, GA 30071, USA). The extraction process was conducted using a DNA extraction kit (E.Z.N.A. Tissue DNA Kit, D3396-02, Omega Biotek, Inc., Norcross, GA 30071, USA) following the manufacturer’s protocol with various chemical solutions such as BL Buffer, HBC Buffer, DNA Wash Buffer, Elution Buffer, and OB Protease Solution. Some fungal species did not germinate (Caryospora quercus, Fissuroma caryotae, and Neoastrosphaeriella aquatica species), and thus, their DNA extraction was performed using fruiting bodies. The E.Z.N.A. Forensic DNA Kit-D3591-01 (Omega Biotek, Inc., Norcross, GA 30071, USA) was used for their DNA extraction. Polymerase chain reactions (PCR) were conducted to amplify regions of the small nuclear ribosomal subunit rDNA (SSU), large nuclear ribosomal subunit rDNA (LSU), and translation elongation factor 1-alpha gene (tef1-α) genes, using the primer pairs as mentioned in Table 1. The total volume of the PCR reaction was 25 µL containing 12.5 µL 2X PCR MasterMix (TIANGEN Co., Beijing, China), 9.5 µL double-distilled water, 1 µL genomic DNA, and 1 µL of each forward and reverse primer (stock of 10 pM). Thermal cycle programs for LSU, SSU, and tef1-α genes were followed as mentioned in Tennakoon et al. [56]. PCR products were detected by NanoDrop One (Thermo Fisher Scientific, Waltham, MA, USA) and 1% agarose gels, and then sequenced by Beijing Liuhe BGI Genomics Co., Ltd., Beijing, China, using the same primers used for PCR amplification. The generated sequences were deposited in GenBank, and accession numbers were obtained (Table 2).
Table 1. Forward and reverse primer information of LSU, SSU, and tef1-α gene regions.
Table 1. Forward and reverse primer information of LSU, SSU, and tef1-α gene regions.
Locus Primers Reference
LSUForward: LR0R GTACCCGCTGAACTTAAGC[62]
Reverse: LR5 ATCCTGAGGGAAACTTC
SSUForward: NS1 GTAGTCATATGCTTGTCTC[63]
Reverse: NS4 CTTCCGTCAATTCCTTTAAG
tef1-αForward: EF1-983F GCYCCYGGHCAYCGTGAYTTYAT[64]
Reverse: EF1-2218R ATGACACCRACRGCRACRGTYTG

2.3. Phylogenetic Analyses

Based on the corresponding Sanger sequencing chromatograms, sequences were initially checked with BioEdit v 7.0.5.3 [65]. Ambiguous regions from the ends of raw sequencing fragments were manually trimmed and assembled into consensus sequences using SeqMan Pro Version 7.1.0 (DNASTAR, Inc., Madison, WI, USA). Consensus sequences were used for BLAST searches in GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The BLAST search results and sequences from the latest publications were used to obtain sequence data for the phylogenetic analyses [59,60,66]. Individual gene regions were aligned using MAFFT v.7 (http://mafft.cbrc.jp/alignment/server/, accessed on 1 September 2025) and trimmed to remove ambiguous bases using TrimAl 1.2 [67,68]. Aligned sequences were combined using BioEdit v.7.2.5 [65].
Two phylogenetic analyses were conducted, such as Maximum Likelihood (ML) and Bayesian Inference (BI). Maximum Likelihood analysis was performed via the online portal CIPRES Science Gateway v. 3.3 [69], with RAxML-HPC v.8 on XSEDE (8.2.12) tool, using default settings but following the adjustments: the GTRGAMMA nucleotide substitution model and 1000 rapid bootstrap replicates. Bayesian inference analysis was performed using MrBayes 3.2.1 [70]. Six simultaneous Markov chains were run for 3,000,000 generations, with trees sampled every 100th generation (GTR + I + G substitution model), until it was stopped when the standard deviation of split frequencies between the two simultaneous runs dropped below 0.01. The first 20% of generated trees were discarded as burn-in, and the rest (80%) were used to calculate the posterior probability. The evolutionary model of nucleotide substitution for both ML and BI analyses was selected independently for each locus using MrModeltest 2.3 [71]. Phylogenetic trees were visualized with FigTree v.1.4.0 [72]. Trees were edited using Microsoft PowerPoint (Microsoft, 2010) and Adobe Illustrator® CS6 v.26.0 (Adobe Systems, San Jose, CA, USA). The newly generated sequences were submitted to GenBank (https://ncbi.nlm.nih.gov, accessed on 10 September 2025). The final alignment was submitted to TreeBASE, submission ID:32279 (http://www.treebase.org/, accessed on 10 September 2025).

2.4. Geographical Distribution and Host Associations

In this study, we gathered and documented the geographical distribution and host occurrence data of 165 species from the families Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae. The data contained 29 species in Aigialaceae, which are included within five genera (Aigialus, Fissuroma, Neoastrosphaeriella, Posidoniomyces, and Rimora); 126 species in Astrosphaeriellaceae, which are included within 10 genera (Aquatospora, Astrosphaeriella, Astrosphaeriellopsis, Caryospora, Javaria, Mycopepon, Pithomyces, Pteridiospora, Quercicola, and Xenoastrosphaeriella); and 10 species in Pseudoastrosphaeriellaceae, which are included within three genera (Carinispora, Pseudoastrosphaeriella, and Pseudoastrosphaeriellopsis). The required data were sourced from Species Fungorum (https://www.speciesfungorum.org, accessed on 20 September 2025), MycoBank (https://www.mycobank.org/), reputable journal publications, authoritative books, the U.S. National Fungus Collections Fungus-Host Database [73], and the Catalogue of Life Checklist (https://www.catalogueoflife.org/, accessed on 20 September 2025). All the collected data were listed with appropriate references (Table 3). In total, 154 publications were reviewed to compile data for 164 species, accessed via Google Scholar and Research Gate. The nomenclatural validity of the taxa was confirmed using MycoBank (https://www.mycobank.org/, accessed on 25 September 2025). We included only taxa that were validly published, morphologically described, and assigned to one of the above families with clearly indicated host and/or locality data. Records with ambiguous identifications, unverified host information, or duplicate entries were excluded. Publications and records from 1800 to 2025 were considered. However, we noted that many species remain unverified by molecular data, and their identification and phylogenetic affinities require clarification through combined morphological and multi-gene phylogenetic analyses. Consequently, the distribution patterns may show slight variations. The online tool SankeyMATIC by Steve Bogart (www.sankeymatic.com, accessed on 27 September 2025) was used to visualize the species distribution through plant host families. The MapChart program (https://www.mapchart.net/index.html, accessed on 30 September 2025) was used to construct the distribution map.
Table 2. GenBank and culture collection accession numbers of species included in the phylogenetic study. The newly generated sequences are shown in bold. Unavailable sequences are indicated as “-”.
Table 2. GenBank and culture collection accession numbers of species included in the phylogenetic study. The newly generated sequences are shown in bold. Unavailable sequences are indicated as “-”.
TaxonStrain/Voucher NumberGenBank Accession NumbersReference
LSUSSUtef1-α
Aigialus grandisMFLUCC 15-1281MN420684MN420694-[74]
A. parvusBCC 32558GU479779GU479743GU479843[75]
Astrosphaeriella bakerianaCBS 115556GU301801-GU349015[76]
As. bambusaeMFLUCC 13-0230KT955461-KT955424[58]
As. bambusaeMBSZU 25-061PX225037PX225048PX226738this study
As. fusisporaMFLUCC 10-0555KT955462KT955443KT955425[58]
As. lophiostomopsisHKUCC 2984GU205215GU205232-[77]
As. neofusisporaMFLUCC 11-0161KT955463KT955444KT955426[58]
As. neostellataCX003MN629351MN629353MN635787[78]
As. neostellataMFLUCC 11-0625KT955464--[58]
As. stellataMFLUCC10-0555JN846723JN846733-[79]
As. thailandicaMFLUCC 11-0191KT955465KT955445KT955427[58]
As. thysanolaenaeMFLUCC 11-0186KT955466KT955446KT955428[58]
Astrosphaeriellopsis caryotaeMFLUCC 13-0830MF588990MF588980-[59]
Carinispora nypaeBCC 36316-GU479749GU479849[75]
C. aquaticaMFLUCC 11-0008MH057847MH057850-[80]
C. aquaticaHKAS 112608OP377899OP377986-[81]
C. aquaticaMFLUCC 18-1030MT627666MT864295MT954394[60]
C. minimataxon:492516EU196550EU196551-[82]
C. pruniMBSZU 25-055PX225040PX225051PX226741this study
C. pruniMBSZU 25-056PX225041PX225052PX226742this study
C. pruniMBSZU 25-057PX225042PX225053PX226743this study
C. quercusMFLU 18-2151MK347979MK347869-[83]
C. quercusMFLUCC 17-2342MN913681MT864311-[60]
C. quercusMFLUCC 17-2323MN913683MT864309-[60]
C. quercusSZU25-042PX225043PX225054-this study
C. quercusSZU25-043PX225044PX225055-this study
C. submersaMFLUCC 18-1283NG_073802MN913720-[60]
C. submersaMFLUCC 18-1409MN913719--[60]
Delitschia chaetomioidesSMH 3253.2GU390656-GU327753[84]
D. winteriAFTOL-ID 1599DQ678077DQ678026DQ677922[85]
Fissuroma calamiMFLUCC 13-0836MF588993MF588983MF588975[59]
F. caryotaeMFLU 17-1253MF588996MF588986MF588979[59]
F. caryotaeSNT12MN712335MN699322MN744228[86]
F. caryotaeSZU25-040PX225038PX225049PX226739this study
F. maculansMFLUCC 10-0886JN846724JN846734-[79]
F. neoaggregatumMFLUCC 10-0554KT955470KT955450KT955432[58]
F. palmaeMFLU 19-0820MN712336-MN744229[86]
F. taiwanenseFU30861MG189605MG189607MG252072[87]
F. taiwanenseFU30862MG189606MG189608MG252073[87]
F. thailandicumMFLUCC 11-0189KT955472KT955452KT955434[58]
F. wallichiaeMFLUCC 15-0315MN726235 MN726247 MN953045[88]
Neoastrosphaeriella aquaticaMFLUCC 18-0209MK138829MK138789MK132866[89]
N. aquaticaSNT240MN712338-MN744231[86]
N. aquaticaSNT190MN712337MN699323MN744230[86]
N. aquaticaSZU25-047PX225039PX225050PX226740this study
N. krabiensisMFLUCC 11-0025JN846729JN846739-[79]
N. krabiensisMFLUCC 11-0022JN846727JN846735-[79]
N. phoenicisMFLUCC 18-1477MN712339MN699324MN744232[86]
N. sribooniensisMFLUCC 13-0834MF588997MF588987MF588977[59]
Pithomyces caryotaeMFLUCC 13-0828MF588999MF588989MF588978[59]
P. licualaeMFLUCC 17-2031MF588995MF588985 [59]
Pseudoastrosphaeriella africanaMFLUCC 11-0176KT955474KT955454KT955436[58]
P. aquaticaMFLUCC 18-0984MN913742MT864336MT954400[60]
P. aquaticaMFLUCC 18-0991MN325076-MT954401[89]
P. aquaticaKUMCC 19-0096MN913746MT627731-[60]
P. bambusaeMFLUCC 10-0885MN913695--[60]
P. bambusaeKUMCC 19-0091MN913698-MT954365[60]
P. bambusaeKUMCC 19-0093MN913699MT864301MT954363[60]
P. bambusaeKUMCC 19-0095MN913700-MT954364[60]
P. bambusaeMFLUCC 11-0205KT955475KT955455KT955437[58]
P. longicollaMFLUCC 11-0171KT955476-KT955438[58]
P. thailandensisMFLUCC 14-0038KT955479KT955458KT955441[58]
P. thailandensisMFLUCC 11-0144KT955478KT955457KT955440[58]
P. thailandensisMFLUCC 10-0553KT955477KT955456KT955439[58]
P. zingiberacearumMBSZU 25-058PX225045PX225056PX226744this study
P. zingiberacearumMBSZU 25-059PX225046PX225057PX226745this study
P. zingiberacearumMBSZU 25-060PX225047PX225058PX226746this study
Pseudoastrosphaeriellopsis kaverianaPUFD33MG947595MG947598MG968955[58]
Pteridiospora bambusaeMFLU 10-0071MG831565MG831566MG833012[90]
Pt. chiangraiensisMFLUCC 11-0162KT955480KT955459KT955442[58]
Pt. javanicaMFLUCC 11-0195KJ742941KT955460KJ739606[58]
Pt. javanicaMFLUCC 11-0159KJ742940KJ739607KJ739605[91]
Quercicola fusiformisMFUCC 18-0479MK348009MK347898MK360085[83]
Q. guttulosporaMFUCC 18-0481MK348010MK347899MK360086[83]
Xenoastrosphaeriella aquaticaDLUCC 1525MZ420753MZ420755MZ442701[92]
X. tornataMFLUCC 11-0196KT955467KT955447KT955429[58]
X. trochusKUMCC 18-0194MT659668MT659669MT653597[93]

3. Results

3.1. Phylogenetic Analyses

The final combined gene (LSU, SSU, and tef1-α) data contained 78 strains (3268 characters with gaps), including newly added strains (SZU25-040 to SZU25-050). Delitschia chaetomioides (SMH 3253.2) and D. winteri (AFTOL-ID 1599) were used as outgroup taxa. Maximum Likelihood (ML) and Bayesian Inference (BI) analyses yielded congruent topologies, providing robust support to the inferred evolutionary relationships (Figure 2). The Bayesian analysis has resulted in 30,000 trees after 3,000,000 generations. Bootstrap support values for ML higher than 70% and BYPP greater than 0.90 are given above each branch, respectively (Figure 2). The overall topology of phylogenetic trees was concurred with previous studies [59,60,66]. Some other phylogenetic output data are mentioned in the Supplementary File S1.
Phylogenetic results indicate that isolate (SZU25-040) clusters with Fissuroma taxa, and makes a close phylogenetic relationship with F. caryotae isolates (MFLUCC 17-1253 and SNT 12); the isolate (SZU25-047) groups with Neoastrosphaeriella aquatica isolates (SNT 190, SNT 240, and MFLUCC 18-0209) in a well-supported clade (87% ML, 1.00 BYPP). Three isolates (MBSZU 25-055, MBSZU 25-056, and MBSZU 25-057) cluster together and make a sister lineage to Caryospora submersa isolates (MFLUCC 18-1283 and MFLUCC 18-1409); another two isolates (SZU25-042 and SZU25-043) also cluster with Caryospora species, but close to C. quercus isolates (MFLUCC 17-2323, MFLUCC 17-2342, and MFLU 18-2151). The isolate, MBSZU 25-061, groups with Astrosphaeriella bambusae (MFLUCC 13-0230) with robust statistical support (83% ML, 0.99 BYPP). In addition, another three isolates (MBSZU 25-058, MBSZU 25-059, and MBSZU 25-060) make a sister lineage with Pseudoastrosphaeriella aquatica isolates (MFLUCC 18-0984, MFLUCC 18-0991, and KUMCC 19-0096) with high statistical support (80% ML, 1.00 BYPP).

3.2. Taxonomy

3.2.1. Aigialaceae Suetrong, Sakay., E.B.G. Jones, Kohlm., Volkm.-Kohlm. & C.L. Schoch, Stud. Mycol. 64: 166 (2009)

Fissuroma Jian K. Liu, Phookamsak, E.B.G. Jones & K.D. Hyde, Fungal Diversity 51(1): 145 (2011)
This genus was introduced by Liu et al. [79] and typified by Fissuroma maculans, which was previously known as Metasphaeria maculans [94]. Fissuroma currently consists of 16 species, most of which have been recorded from terrestrial habitats [58,59,66,87]. Species have diverse morphological traits, such as ascomata with slit-like ostioles, trabeculate pseudoparaphyses, and fusiform, hyaline, 1-septate ascospores [79,88]. The asexual morph has been identified as coelomycetous, pleurophomopsis-like with globose to subglobose conidiomata, phialidic conidiogenous cells, and hyaline, globose, or oblong conidia [58,79,95,96]. The host specificity of Fissuroma species has yet to be investigated since they have been reported from various host species (e.g., Arenga pinnata, Bambusa spp., Borassus flabellifer, Calamus andamanicus, Calamus conirostris, Calamus rotang, Caryota urens, Wallichia sp.) [58,59,66,73,79,87,95].
Fissuroma caryotae Wanas., E.B.G. Jones & K.D. Hyde, Mycological Progress 17(5): 579 (2018)
Index Fungorum number: IF554088; Facesoffungi number: FoF 03608; Figure 3
Saprobic on dead stem of Arenga undulatifolia (Arecaceae). Sexual morph: Ascomata 270–400 × 230–350 μm ( x ¯ = 320 × 280 μm, n = 6), immersed or semi-immersed, appear as numerous, black or dark brown, raised, dome-shaped structures on host surface, solitary or clustered, hemispherical, flattened at the base, glabrous with rough walls, uni-loculate, carbonaceous, ostiolate. Ostioles central, with carbonaceous, slit-like opening. Peridium 15–42 μm wide ( x ¯ = 28 μm, n = 10), carbonaceous, black, of unequal thickness, poorly developed at the base, thick at sides towards the apex, composed of several layers of brown to dark brown cells, inner layer composed of several layers of hyaline, textura angularis cells, thick-walled. Hamathecium comprising 1–2.5 μm wide ( x ¯ = 1.9 μm, n = 10), septate, filiform, numerous, trabeculate pseudoparaphyses, embedded in a hyaline gelatinous matrix. Asci 100–170 × 12–15 μm ( x ¯ = 130 × 13.8 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical to obclavate, apically rounded, short pedicellate, with an ocular chamber. Ascospores 37–48 × 6.4–9 μm ( x ¯ = 41 × 7 μm, n = 30), overlapping, 1–2-seriate, hyaline, fusiform with acute ends, 1-septate, constricted at the septum, straight or slightly curved, asymmetrical, smooth-walled, with a thin mucilaginous sheath. Asexual morph: Undetermined.
Known hosts: Arenga undulatifolia, Calamus sp., and Caryota urens [59].
Known distribution: China and Thailand [59].
Material examined: China, Guangdong Province, Shenzhen, on dead stem of Arenga undulatifolia (Arecaceae), 15 January 2025, D.S. Tennakoon, DGSP040 (SZU25-040, new host record).
Notes: Fissuroma caryotae was introduced by Wanasinghe et al. [59] from a trunk of Caryota urens in China. The morphological characteristics of our collection (SZU25-040) strongly tally with the type of F. caryotae (MFLU 17-1253) in having immersed or semi-immersed, hemispherical, carbonaceous ascomata, trabeculate pseudoparaphyses, cylindrical to obclavate asci, and hyaline, fusiform, 1-septate ascospores with a thin mucilaginous sheath [59]. In addition, they share overlapping dimensions of asci (100–170 × 12–15 μm vs. 120–150 × 14–18 μm) and ascospores (37–48 × 6.4–9 μm vs. 40–50 × 7–9 μm). According to the phylogenetic analyses, our collection groups with F. caryotae isolates (MFLU 17-1253 and MFLUCC 16-1383) in a well-supported clade (93% ML, 0.98 BYPP). Thus, we identify our collection as a new host record of F. caryotae from Arenga undulatifolia in China.

3.2.2. Astrosphaeriellaceae Phookamsak & K.D. Hyde, Fungal Diversity 74: 161 (2015)

Astrosphaeriella Syd. & P. Syd., Annls Mycol. 11(3): 260 (1913)
Astrosphaeriella has a cosmopolitan distribution worldwide and is mostly reported from bamboos, palms, and grass species [58,60,66,95,97]. The typical morphological characteristics of Astrosphaeriella are conical to mammiform, carbonaceous ascomata, fissitunicate, cylindrical asci, and hyaline to brown, fusiform ascospores [58,93]. The asexual morph is coelomycetous and has phialidic, cylindrical to ampulliform conidiogenous cells and hyaline, globose to subglobose, aseptate conidia [58,95]. To date, 55 Astrosphaeriella species have been accepted [98].
Astrosphaeriella bambusae Phookamsak & K.D. Hyde, Fungal Diversity: 165 (2015)
Index Fungorum number: IF551633; Facesoffungi number: FoF 01223; Figure 4
Saprobic on dead stem of Metroxylon sagu (Arecaceae). Sexual morph: Ascomata 250–500 × 300–610 μm ( x ¯ = 350 × 460 μm, n = 6), semi-immersed, erumpent through host surface, appear as numerous, black, raised, cone-like structures on host surface, solitary or clustered, mammiform to conical, flattened at the base, dark brown to black, uni-loculate, carbonaceous, with indistinct ostioles. Peridium 12–20 μm wide ( x ¯ = 16 μm, n = 10), carbonaceous, black, of unequal thickness, poorly developed at the base, fragile, composed of several layers of brown to dark brown cells, thick-walled. Hamathecium comprising 1–2 μm wide ( x ¯ = 1.6 μm, n = 10), septate, branched, filiform, numerous, trabeculate pseudoparaphyses, embedded in a hyaline gelatinous matrix. Asci 120–200 × 9–13 μm ( x ¯ = 152 × 10 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical, short pedicellate, apically rounded, with an ocular chamber. Ascospores 32–40 × 5–6.4 μm ( x ¯ = 35 × 5 μm, n = 30), overlapping, 1–2-seriate, hyaline when immature, pale brown at maturity, fusiform with acute ends, 1-septate, constricted at the septum, smooth-walled, without a mucilaginous sheath. Asexual morph: Undetermined.
Culture characteristics: Ascospores germinate on PDA within 8 h at 24 °C. Colonies on PDA reaching 10 mm diameter after 15 days at 24 °C. Colonies dense, circular, raised, surface with hyphae growing, rough-surface, fairly fluffy, with entire edge, margin well-defined. Colony from above: dark gray to dark brown at the center, and the margin; colony from below: dark brown to black at the center, and the margin.
Known hosts: Bamboo sp. and Metroxylon sagu [58,66]
Known distribution: China and Thailand [58,66]
Material examined: China, Guangdong Province, Shenzhen, on dead stem of Metroxylon sagu (Arecaceae), 12 January 2025, D.S. Tennakoon, DVIP004 (SZU25-041, new host record), living culture (MBSZU 25-061)
Notes: Due to morphological characteristics (e.g., semi-immersed to erumpent, mammiform to conical ascomata, trabeculate pseudoparaphyses, cylindrical, short pedicellate, apically rounded asci, and hyaline, 1-septate, fusiform ascospores) largely overlapping with Astrosphaeriella bambusae (MFLUCC 13-0230), we report our collection (MBSZU 25-061) as a new host record of A. bambusae from the dead stem of Metroxylon sagu in China. In particular, our collection shares overlapping dimensions of ascomata (250–500 × 300–610 μm vs. 360–600 × 380–660 μm), asci (120–200 × 9–13 μm vs. 130–180 × 10–12 μm), and ascospores (32–40 × 5–6.4 μm vs. 34–39 × 5–6 μm) with the type of Astrosphaeriella bambusae (MFLUCC 13-0230). Multi-gene phylogeny also indicates that our collection groups with A. bambusae (MFLUCC 13-0230) with a robust statistical support (83% ML, 0.99 BYPP). However, our collection differs from the Astrosphaeriella bambusae (MFLUCC 13-0230) by lacking a mucilaginous sheath. This is the first Astrosphaeriella bambusae species occurrence on Metroxylon sagu (Arecaceae).
Caryospora De Not., Mém. R. Accad. Sci. Torino, Ser. 2 16: 463 (1857)
Caryospora was established by De Notaris [99] with C. putaminum as the type species. The taxonomic placement of Caryospora has been controversial for a long time. Initially, this was placed in Phaeophragmiae, based on the terminal septa and subsequently transferred to Zopfiaceae [100,101,102]. Ariyawansa et al. [80] transferred this genus to a new fungal family, Caryosporaceae, based on in-depth morphology and phylogeny evidence. However, this genus has been placed in Astrosphaeriellaceae in recent studies [8,60,83,103]. Caryospora species have been recorded from both terrestrial and freshwater habitats and characterized by obclavate asci with ellipsoidal to biconic ascospores [60,104]. To date, 12 Caryospora species have been accepted [98].
Caryospora aquatica H. Zhang, K.D. Hyde & Ariyawansa, Fungal Diversity 75: 54 (2015), comb. nov.
Index Fungorum number: IF551418; Facesoffungi number: FoF 00958
Basionym: Caryospora minima Jeffers, Mycologia 32(4): 561 (1940)
Holotype: Berlin, Maryland, USA, putrescent putamina of Amygdalus persica, August 1938, BPI 71132.
Description: see Jeffers (1940)
Caryospora minima was introduced by Jeffers (1940) from MD, USA. Subsequently, Cai and Hyde [82] provided LSU and SSU sequence data (EU196550 and EU196551) for this species without any strain number/code, morphological description, herbarium details, or illustrations. In our multigene phylogenetic study, Caryospora minima strain (taxon:492516) was clustered with C. aquatica isolates (MFLUCC 11-0008, MFLUCC 18-1030, and HKAS 112608) in a well-supported clade (81% ML, 0.95 BYPP). The morphological characteristics of the type of Caryospora minima (BPI 71132) tally well with the type of C. aquatica (MFLUCC 11-0008) with overlapping characteristics and dimensions, such as hemispherical or conical ascomata (450–750 μm vs. 400–700 μm diam.), cylindrical clavate asci (160–190 × 60–80 μm vs. 150–180 × 35–50 μm), and 1-septete ascospores (44–52 × 20–27 μm vs. 40–50 × 20–30 μm) [80,100]. Thus, based on strong phylogenetic and morphological characteristics similarities, we treat Caryospora minima as a synonym of C. aquatica in this study.
Caryospora pruni Tennakoon & S. Hongsanan, sp. nov.
Index Fungorum number: IF904313; Facesoffungi number: FoF 18109; Figure 5
Etymology: The specific epithet “pruni” was given after the host genus.
Holotype: SZU25-044
Saprobic on decaying fruit pericarp of Prunus persica (Rosaceae). Sexual morph: Ascomata 350–650 × 400–500 μm ( x ¯ = 490 × 350 μm, n = 6), superficial, appear as numerous, black, raised, cone-like structures on host surface, solitary or clustered, conical, flattened at the base, dark brown to black, uni-loculate, carbonaceous, ostiolate. Ostiole central, apapillate, carbonaceous, not prominent. Peridium 18–40 μm wide ( x ¯ = 26 μm, n = 10), carbonaceous, black, poorly developed at the base, fragile, composed of several layers of brown to dark brown cells, thick-walled. Hamathecium comprising 1–2 μm wide ( x ¯ = 1.5 μm, n = 10), septate, branched, filiform, numerous, trabeculate pseudoparaphyses. Asci 95–120 × 33–50 μm ( x ¯ = 108 × 41 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindric-clavate, short pedicellate, apically rounded with an ocular chamber. Ascospores 45–56 × 20–30 μm ( x ¯ = 51 × 26 μm, n = 30), overlapping, 1–2-seriate, hyaline when immature, pale brown to dark brown at maturity, ellipsoidal, diamond-shaped, apex pointed, 1-septate, distinctly constricted at the septum, mostly with a dark band around the septum, walls thickened at both ends, symmetrical or asymmetrical, straight or slightly curved, guttulate, present polar germ pores, surrounded by a gelatinous mucilaginous sheath when immature (5–8 μm wide). Asexual morph: Undetermined.
Culture characteristics: Ascospores germinated on PDA within 8 h at 24 °C. Colonies on PDA reached 21 mm in diameter after 12 days at 24 °C. Colonies dense, circular, raised, surface with hyphae growing, smooth-surface, fairly fluffy, with entire edge, margin well-defined. Colony from above: dark gray to dark brown at the center, gray at the margin; colony from below: dark brown to black at the center, pale brown at the margin.
Material examined: China, Guangdong Province, Shenzhen, on decaying fruit pericarp of Prunus persica (Rosaceae), 17 January 2025, D.S. Tennakoon, SZ3 (SZU25-044, holotype), ex-type living culture (MBSZU 25-055); ibid. 18 January 2025, DPSZ3B, DPSZ3 (SZU25-045, SZU25-046, isotypes), living cultures (MBSZU 25-056, MBSZU 25-057).
Notes: The morphological characteristics of our collection resemble generic concept of Caryospora in having conical, uni-loculate, carbonaceous ascomata, cylindric-clavate, short pedicellate asci, and ellipsoidal, diamond-shaped ascospores [60,80,83,104]. Multi-gene phylogeny revealed that our isolates (MBSZU 25-055, MBSZU 25-056, and MBSZU 25-057) form an independent lineage sister to Caryospora submersa isolates (MFLUCC 18-1283 and MFLUCC 18-1409) with 96% ML and 1.00 BYPP support. However, our collection can be distinguished from C. submersa, which has broadly cylindrical to clavate asci and pale brown to dark brown, diamond-shaped ascospores with polar germ pores, whereas C. submersa has obclavate asci and narrowly fusiform, hyaline, thin-walled ascospores [60]. Thus, we introduce our collection as a new species, Caryospora pruni from Prunus persica in China.
Caryospora quercus Jayasiri, E.B.G. Jones & K.D. Hyde, Mycosphere 10(1): 34 (2019)
Index Fungorum number: IF555535; Facesoffungi number: FoF 05236; Figure 6
Saprobic on dead stem of Citrus maxima (Rutaceae). Sexual morph: Ascomata 250–400 × 300–520 μm ( x ¯ = 290 × 450 μm, n = 6), semi-immersed, erumpent, appear as black dots, solitary or clustered, conical, flattened at the base, dark brown to black, uni-loculate, carbonaceous, ostiolate. Ostiole central and filled with periphyses. Peridium 10–15 μm wide ( x ¯ = 13 μm, n = 10), carbonaceous, black, poorly developed at the base, fragile, two-layered, outer layer strongly carbonized, composed of several layers of brown to dark brown cells, inner layer composed of several layers of hyaline cells, thick-walled. Hamathecium comprising 1–2 μm wide ( x ¯ = 1.5 μm, n = 10), septate, branched, filiform, numerous, trabeculate pseudoparaphyses. Asci 90–200 × 25–38 μm ( x ¯ = 145 × 32 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindric-clavate, short pedicellate, apically rounded with an ocular chamber. Ascospores 40–50 × 16–30 μm ( x ¯ = 46 × 22 μm, n = 30), overlapping, 1–2-seriate, hyaline when immature, pale brown to dark brown at maturity, ellipsoidal, diamond-shaped, apex pointed, 1-septate, distinctly constricted at the septum, mostly with a dark band around the septum, walls thickened at both ends, symmetrical or asymmetrical, guttulate, present polar germ pores, surrounded by a gelatinous mucilaginous sheath (5–8 μm wide). Asexual morph: Undetermined.
Known hosts: Citrus maxima and Quercus sp. (Jayasiri et al., 2019 [83]; Dong et al., 2020 [60]; this study)
Known distribution: China and Thailand (Jayasiri et al., 2019 [83]; Dong et al., 2020 [60]; this study)
Material examined: China, Guangdong Province, Shenzhen, on dead stem of Citus maxima (Rutaceae), 12 January 2025, D.S. Tennakoon, WD002 (SZU25-042, new host record), ibid. 15 January 2025, DST5 (SZU25-043).
Notes: According to the multi-gene phylogeny (LSU, SSU, and tef1-α), our collection (SZU25-042 and SZU25-043) clustered with Caryospora quercus isolates (MFLUCC 17-2323, MFLUCC 17-2342, and MFLU 18–2151) in a well-supported clade (75% ML, 1.00 BYPP). Morphological characteristics also indicate that our collection resembles C. quercus in having conical, dark brown to black, uni-loculate, carbonaceous ascomata, cylindric-clavate, short pedicellate asci, and ellipsoidal, diamond-shaped, 1-septate ascospores with gelatinous mucilaginous sheath [60,83,93]. In addition, our collection has overlapping dimensions of ascomata (250–400 × 300–520 μm vs. 300–420 × 450–483 μm), asci (90–200 × 25–38 μm vs. 110 –147 × 30–35 μm), and ascospores (40–50 × 16–30 μm vs. 41–54 × 18–28 μm) as well [83]. Based on the robust morphology and phylogeny support, we identify our collection as C. quercus. Caryospora quercus was initially introduced by Jayasiri et al. [83] from decaying fruit pericarp of Quercus sp. (Fagaceae) in Thailand. Thus, we introduce our collection as a new host record of C. quercus from Citrus maxima in China.
Neoastrosphaeriella Jian K. Liu, E.B.G. Jones & K.D. Hyde, Fungal Diversity 51(1): 148 (2011)
Liu et al. [79] introduced Neoastrosphaeriella to accommodate N. krabiensis as the type species, which was collected from a dead petiole of Metroxylon sagu. The species of Neoastrosphaeriella have been recorded from both terrestrial and freshwater habitats [59,79,86,89,105]. In particular, most have been reported from Thailand (N. aquatica, N. krabiensis, N. phoenicis, and N. sribooniensis). Neoastrosphaeriella species are characterized by immersed to semi-immersed ascomata with slit-like ostioles, fissitunicate, obclavate asci, and brown, verrucose ascospores [79]. To date, there are five Neoastrosphaeriella species, such as N. alankrithabeejae, N. aquatica, N. krabiensis, N. phoenicis, and N. sribooniensis [98].
Neoastrosphaeriella aquatica D.F. Bao, Z.L. Luo, K.D. Hyde & Hong Y. Su, Phytotaxa 391(3): 201 (2019)
Index Fungorum number: IF555357; Facesoffungi number: FoF 04910; Figure 7
Saprobic on dead stem of Phoenix paludosa (Arecaceae). Sexual morph: Ascomata 210–520 × 200–350 μm ( x ¯ = 341 × 230 μm, n = 6), semi-immersed, appear as numerous, black or dark brown, raised, dome-shaped structures on host surface, solitary or clustered, hemispherical with wedged sides, flattened at the base, glabrous with rough walls, uni-loculate, carbonaceous, ostiolate. Ostioles central, with carbonaceous, slit-like opening. Peridium 16–28 μm wide ( x ¯ = 23 μm, n = 10), carbonaceous, black, of unequal thickness, poorly developed at the base, thick at sides towards the apex, composed of several layers of brown to dark brown cells, inner layer composed of several layers of hyaline, textura angularis cells, thick-walled. Hamathecium comprising 1–2 μm wide ( x ¯ = 1.6 μm, n = 10), septate, filiform, numerous, cellular pseudoparaphyses, embedded in a hyaline gelatinous matrix. Asci 80–100 × 12–16 μm ( x ¯ = 92 × 14 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical to obclavate, apically rounded, with a short furcate pedicel, with an ocular chamber. Ascospores 30–40 × 5–7 μm ( x ¯ = 33 × 6 μm, n = 30), overlapping, 1–2-seriate, hyaline, fusiform with acute ends, 1-septate, constricted at the septum, straight or slightly curved, asymmetrical, smooth-walled, guttulate, with a distinct mucilaginous sheath. Asexual morph: Undetermined.
Known hosts: decaying submerged wood of unknown host, and Phoenix paludosa [89].
Known distribution: China and Thailand [89]
Material examined: China, Guangdong Province, Shenzhen, on dead stem of Phoenix paludosa (Arecaceae), 20 January 2025, D.S. Tennakoon, DPC044 (SZU25-047, new host record).
Notes: In this study, our phylogenetic analyses indicate that our collection (SZU25-047) groups with Neoastrosphaeriella aquatica isolates (MFLUCC 18–0209, MFLUCC 18-1531, HKAS 105481) in a well-supported clade (87% ML, 1.00 BYPP). The morphological characteristics also tally well with the type of N. aquatica in having semi-immersed, solitary or clustered, hemispherical ascomata with slit-like ostioles, cylindrical to obclavate asci, and hyaline, fusiform, 1-septate ascospores [89]. Their overlapping dimensions of ascomata (210–520 × 200–350 μm vs. 250–400 × 160–250 μm), asci (80–100 × 12–16 μm vs. 84–112 × 14–19 μm), and ascospores (30–40 × 5–7 μm vs. 31–37 × 5–8 μm) also indicate that they are the same species. Therefore, based on both morphology and phylogeny support, we report our collection as a new host record of N. aquatica from China.

3.2.3. Pseudoastrosphaeriellaceae Phookamsak & K.D. Hyde, Fungal Diversity: 181 (2015)

Pseudoastrosphaeriella Phookamsak, Z.L. Luo & K.D. Hyde, Fungal Diversity: 182 (2015)
Phookamsak et al. [58] introduced Pseudoastrosphaeriella to accommodate astrosphaeriella-like species in Pseudoastrosphaeriellaceae. Pseudoastrosphaeriella was typified by P. thailandensis, which was collected from a dead stem of bamboo in Thailand. The morphology of Pseudoastrosphaeriella species differs from Astrosphaeriella by ascomata characteristics, such as immersed, hemispherical or dome-shaped with short to long necks, whereas Astrosphaeriella has erumpent, raised, conical ascomata and has a star-like or rounded flange with small papilla [58]. Currently, seven Pseudoastrosphaeriella species have been accepted, such as P. aequatoriensis, P. africana, P. aquatica, P. bambusae, P. longicolla, P. papillate, and P. thailandensis [98].
Pseudoastrosphaeriella zingiberacearum Tennakoon & S. Hongsanan, sp. nov.
Index Fungorum number: IF904314; Facesoffungi number: FoF 18110; Figure 8
Etymology. The specific epithet zingiberacearum was given after the host family, Zingiberaceae.
Holotype: SZU25-048
Saprobic on dead stem of Hedychium coronarium (Zingiberaceae). Sexual morph: Ascomata 400–600 × 800–1300 μm ( x ¯ = 520 × 980 μm, n = 6) (excluding neck), immersed in host epidermis, erumpent through host surface, appear as numerous, black or dark brown, raised, dome-shaped structures on host surface, solitary or clustered, uni-loculate, carbonaceous, depressed conical or lageniform, flattened at the base, ostiolate. Necks 100–200 × 5–10 μm ( x ¯ = 125 × 8 μm, n = 4), dark brown or black, central, cylindrical, oblique, fragile, carbonaceous. Peridium 14–38 μm wide ( x ¯ = 26 μm, n = 10), carbonaceous, black, of unequal thickness, poorly developed at the base, thick at sides towards the apex, composed of several layers of brown to dark brown cells, comprising host cells plus fungal tissue at outside, inner layer composed of several layers of pale brown or hyaline, textura angularis cells, thick-walled. Hamathecium comprising 1–2.6 μm wide ( x ¯ = 1.8 μm, n = 10), septate, filiform, numerous, trabeculate pseudoparaphyses, anastomosing at the apex, embedded in a hyaline gelatinous matrix. Asci 150–172 × 11–14 μm ( x ¯ = 160 × 12 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical to clavate, apically rounded, with a short furcate pedicel, with an ocular chamber. Ascospores 46–57 × 5–7 μm ( x ¯ = 52 × 6 μm, n = 30), overlapping, 1–2-seriate, initially hyaline, pale brown to brown when mature, broadly fusiform with acute or rounded ends, 1–6-septate, constricted at the middle septum, straight or slightly curved, asymmetrical, slightly swollen above middle septum, rough-walled with minute striations, guttulate. Asexual morph: Undetermined.
Material examined: China, Jiangxi Province, Nanchang, on dead stem of Hedychium coronarium (Zingiberaceae), 20 January 2024, D.S. Tennakoon, DDP007 (SZU25-048, holotype), ex-type living culture (MBSZU 25-058); ibid. 29 January 2025, DP007-ITB, DP007-ITC (SZU25-049, SZU25-050, isotypes), living cultures (MBSZU 25-059, MBSZU 25-060).
Notes: In our phylogenetic analysis, our collection (MBSZU 25-058, MBSZU 25-059, and MBSZU 25-060) nested with Pseudoastrosphaeriella isolates and formed a sister lineage with P. aquatica with 80% ML and 1.00 BYPP statistical support (Figure 2). The morphological characteristics of our collection resemble Pseudoastrosphaeriella in having hemispherical ascomata, cylindrical to clavate, apically rounded asci, and reddish brown ascospores, with minute striations [58,60]. Our collection can be distinguished from P. aquatica in having larger ascomata (400–600 × 800–1300 μm vs. 250–350 × 280–320 μm), short neck (100–200 × 5–10 μm vs. 450–500 × 100–110 μm), narrow asci (150–172 × 11–14 μm vs. 145–260 × 19–25 μm), and broadly fusiform, 1–6-septate ascospores with striations (46–57 × 5–7 μm vs. 40–48 × 8–10.5 μm), whereas P. aquatica has 3-septate ascospores with prominent guttules and lacking striations [60]. In addition, we compared our collection (MBSZU 25-058) with P. aquatica (MFLUCC 18-0984) based on base pair differences, and there are 39 base pair differences (4.67%) across 834 nucleotides in the tef1-α gene region. Thus, due to these phylogenetic and morphological distinctions, we have introduced our collection as a novel species, Pseudoastrosphaeriella zingiberacearum, collected from Hedychium coronarium in China.

3.3. Geographical Distribution and Their Host Occurrences of Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae Species

This study documents 164 species across Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae, representing 18 genera, along with their host associations and geographical distributions (Table 3). Based on the data collected, it appears that the members of Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae have mostly been collected from China (46 records) and Thailand (41 records). This could be attributed to the well-documented fungal collections, coupled with the presence of specialized research institutions and proper identification techniques (e.g., morphology coupled with multi-gene phylogenetic analyses, fungal evolution analyses, Genealogical Concordance Phylogenetic Species Recognition (GCPSR) analysis to distinguish the cryptic species) in these countries. Apart from these main countries, significant records exist from India (22 records), the United States (12 records), Brunei (11 records), Australia (9 records), Indonesia and Japan (8 records), Ecuador (7 records), Papua New Guinea (6 records), Cuba and Philippines (5 records), while other have less than five species records from 28 countries (e.g., Brazil, France, Italy, Malaysia, Nicaragua, Pakistan, Peru, Poland, South Africa, Sri Lanka, Sweden, Tanzania, Venezuela, Vietnam, etc.) (Figure 9).
A key finding reveals that Arecaceae (58 records) and Poaceae (48 records) represent the predominant host families for these fungal taxa (Figure 10). This raises an exciting ecological question: Are these species host-specific to either the Arecaceae or Poaceae families? (Figure 10 and Figure 11). In addition, these species produce carbonaceous fruiting bodies, raising questions about potential relationships between their nutritional or evolutionary adaptations and their Arecaceae/Poaceae hosts. In particular, these interactions are critical for understanding biodiversity, ecosystem functioning, and the evolutionary adaptations of these fungi to their environments. However, this could be answered with a comprehensive study with multiple taxon samplings. The geographical distribution and host occurrences of each family are discussed in the following section.

3.3.1. Aigialaceae

In total, 29 Aigialaceae species in five genera (Aigialus, Fissuroma, Neoastrosphaeriella, Posidoniomyces, and Rimora) are listed with their geographical distributions and host occurrences (Table 3). According to the collected data, Aigialaceae species have been reported from subtropical, tropical, and temperate countries worldwide (e.g., Australia, Brunei, China, Croatia, Ecuador, India, Japan, Thailand, Papua New Guinea, the Philippines, and the United States). Of them, the highest number of species records has been reported from Thailand (12 records), and this is followed by India (7 records), China (5 records), and the United States (3 records), while other countries have single records (Table 3). It is worth noting that the majority of Aigialaceae species have been recorded from Asia. Some species exhibit extensive distribution throughout multiple countries; for instance, Fissuroma fissuristomum has been reported in Australia, Brunei, China, Ecuador, and Papua New Guinea [73,106,107]. The lower number of species recorded may indicate that fewer taxonomic investigations have been conducted in those countries.
When considering the host occurrences of Aigialaceae species, most of the species have been recorded from Arecaceae host species (12 records), such as Arenga pinnata, Borassus flabellifer, Calamus andamanicus, C. conirostris, C. rotang, Caryota urens, Metroxylon sagu, and Phoenix paludosa (Table 3). In addition, some others have been reported from Poaceae hosts (7 records; Bambusa spp. and Phyllostachys reticulata) and Rhizophoraceae host species (6 records; Rhizophora apiculata, R. mangle, and R. mucronata). In particular, the occurrence of Rhizophoraceae host species is interesting since they have been collected from submerged root parts (e.g., Aigialus grandis, A. mangrovis, A. parvus, A. rhizophorae, and A. striatisporus). Other species’ host occurrence has been limited to single host families, such as Lythraceae, Posidoniaceae, Theaceae, Verbenaceae, and Zingiberaceae (Table 3).

3.3.2. Astrosphaeriellaceae

In total, 126 Astrosphaeriellaceae species in 10 genera (Aquatospora, Astrosphaeriella, Astrosphaeriellopsis, Caryospora, Javaria, Mycopepon, Pithomyces, Pteridiospora, Quercicola, and Xenoastrosphaeriella) are listed with their geographical distributions and host occurrences (Table 3). Our summarized data suggests that Astrosphaeriellaceae species exhibit a cosmopolitan distribution, given their presence on numerous continents (e.g., Asia, Africa, Australia, Europe, North America, and South America). Of them, the majority of species records have been reported from Asian countries, such as Brunei, China, India, Indonesia, Japan, the Philippines, and Thailand (Table 3). The highest number of species have been collected from China (42 records), and this is followed by Thailand (24 records), India (14 records), the United States (9 records), Indonesia (8 records), Australia and Japan (7 records), Brunei (6 records), Cuba, Ecuador and Papua New Guinea (5 records), Nicaragua, Philippines, Poland, Sierra Leone, Tanzania, and South Africa (3 records) and other have less than two species records (e.g., Austria, Brazil, Costa Rica, France, Ghana, Italy, Malaysia, Mexico, Myanmar, New Zealand, Pakistan, Peru, Seychelles, Singapore, Sri Lanka, Sweden, the United Kingdom, and Vietnam). Some species, like Astrosphaeriella stellata, are widely distributed (e.g., Australia, China, India, Japan, Papua New Guinea, the Philippines, and Vietnam). In addition, Astrosphaeriella vesuvius has been reported from eight countries, including Australia, Brunei, Indonesia, Thailand, Malaysia, Papua New Guinea, and Sri Lanka. The substantial number of species records from China, India, and Thailand may result from extensive taxonomic sampling and in-depth studies conducted in these countries over the last two decades [58,59,60,83,90,105,108,109,110].
The host associations of Astrosphaeriellaceae species are particularly noteworthy, with documented occurrences across 37 different plant families (Table 3). Of them, highest numbers of species records have been reported from Arecaceae (41 records) and followed by Poaceae (36 records), Fagaceae (13 records), Lythraceae (4 records), Apocynaceae, Moraceae, Myrtaceae, and Rosaceae (3 records), Anacardiaceae, Lauraceae, Musaceae, Oleaceae, Proteaceae (2 records), and others have single occurrences (e.g., Acoraceae, Altingiaceae, Annonaceae, Bromeliaceae, Cannaceae, Juglandaceae, Juncaceae, Liliaceae, Malvaceae, Sapindaceae) (Table 3). The most frequently recorded Arecaceae hosts include Archontophoenix alexandrae, Arenga undulatifolia, Calamus spp., Cocos nucifera, Daemonorops margaritae, Eleiodoxa conferta, Licuala longicalycata, Livistona spp., Nothofagus spp., Oncosperma spp., and Sabal palmetto (Table 3). The most commonly reported Poaceae hosts are Bambusa spp., Miscanthus spp., Melocalamus compactiflorus, Phyllostachys spp., and Saccharum officinarum [73]. Several species, including Pithomyces cupaniae, exhibit broad host ranges in multiple plant families such as Anacardiaceae, Anisophylleaceae, Apocynaceae, Fabaceae, Lauraceae, Oleaceae, and Sapindaceae [73,111,112]. Furthermore, both Pithomyces graminicola (associated with Anacardiaceae, Cannaceae, Fabaceae, Lauraceae, Poaceae, and Strelitziaceae) and P. obscuriseptatus (associated with Acoraceae, Arecaceae, Butomaceae, Cyperaceae, Juncaceae, and Typhaceae) exhibit extensive host ranges [73,110,113,114,115,116]. Another interesting fact is that some Astrosphaeriellaceae species have been collected from soil as well. Beyond their plant associations, some Astrosphaeriellaceae species (e.g., P. longiclavisporus and P. pallidus) have been collected from soil habitats in China [117].

3.3.3. Pseudoastrosphaeriellaceae

In total, 10 Pseudoastrosphaeriellaceae species in three genera (Carinispora, Pseudoastrosphaeriella, and Pseudoastrosphaeriellopsis) are listed with their geographical distributions and host occurrences (Table 3). Current records indicate Pseudoastrosphaeriellaceae species have been mostly collected from Thailand (5 records) and Brunei (4 records), with single occurrences reported from Australia, Ecuador, India, Malaysia, Philippines, and Tanzania [58,73,118,119]. Reported species have been mainly associated with Arecaceae hosts (Arenga undulatifolia, Avicennia marina, Calamus spp., Daemonorops spp., Licuala longicalycata, Nypa fruticans, Oncosperma tigillarium, and Phytelephas spp.) and Poaceae hosts (Bambusa spp. and Phragmites australis) (Table 3).
Table 3. Host association and geographical distribution of reported Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae species.
Table 3. Host association and geographical distribution of reported Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae species.
SpeciesHostFamilyLocalityReferences
Aigialus grandisRhizophora mangle, Rhizophora mucronata, Sonneratia acidaLythraceae, RhizophoraceaeThe United States, India[120,121,122]
Aigialus mangrovisRhizophora mucronataRhizophoraceaeIndia[121,123]
Aigialus parvusAvicennia alba, Rhizophora mangle, Sonneratia acidaLythraceae, RhizophoraceaeThe United States[121,122]
Aigialus rhizophoraeRhizophora mucronataRhizophoraceaeIndia[121,123]
Aigialus striatisporusRhizophora apiculataRhizophoraceaeThailand[73]
Fissuroma aggregatumPhyllostachys reticulataPoaceaeJapan[95,124,125,126,127]
Fissuroma arengaeArenga pinnataArecaceaeThailand[88]
Fissuroma bambusaeBambusa spp.PoaceaeThailand[58]
Fissuroma bambusicolaBambusa spp.PoaceaeChina[128]
Fissuroma calamiCalamus rotangArecaceaeThailand[59]
Fissuroma caryotaeArenga undulatifolia Caryota urensArecaceaeChina[59], this study
Fissuroma chinenseBambusa spp.PoaceaeChina[66]
Fissuroma fissuristomumBambusa spp. Calamus conirostris, Licuala sp., Mauritia flexuosaArecaceae, PoaceaeAustralia, Brunei, China, Ecuador, Papua New Guinea[73,107,129]
Fissuroma kavachabeejaeCalamus andamanicusArecaceaeIndia[105]
Fissuroma maculansArenga spp.ArecaceaePhilippines[79,130]
Fissuroma microsporumBorassus flabelliferArecaceaeIndia[105]
Fissuroma neoaggregatumBambusa spp.PoaceaeThailand[58]
Fissuroma palmaeArenga pinnataArecaceaeThailand[86]
Fissuroma taiwanenseHedychium coronariumZingiberaceaeChina[87])
Fissuroma thailandicumBambusa spp.PoaceaeThailand[58]
Fissuroma wallichiaeWallichia sp.TheaceaeThailand[88]
Neoastrosphaeriella alankrithabeejaeCalamus andamanicusArecaceaeIndia[105]
Neoastrosphaeriella aquaticaPhoenix paludosaArecaceaeChina, Thailand[89], this study
Neoastrosphaeriella krabiensisMetroxylon saguArecaceaeThailand[79]
Neoastrosphaeriella phoenicisPhoenix paludosaArecaceaeThailand[86]
Neoastrosphaeriella sribooniensisCalamus rotangArecaceaeThailand[59]
Posidoniomyces atricolorPosidonia oceanicaPosidoniaceaeCroatia[131]
Rimora mangroveiAvicennia officinalis, Rhizophora mangleRhizophoraceae, VerbenaceaeThe United States, India[73,121,122]
Aquatospora cylindricaUnknown host-Thailand[60]
Astrosphaeriella angustisporaEleiodoxa conferta, Licuala spp.ArecaceaeBrunei[119,132,133]
Astrosphaeriella aosimensisLivistona subglobosaArecaceaeJapan[134,135]
Astrosphaeriella applanataAlnus sp., Carpinus sp., Quercus spp.-Poland, Sweden, the United Kingdom,[73,109,136]
Astrosphaeriella aquaticaLicuala longicalycata, Livistona spp.ArecaceaeEcuador, Papua New Guinea, Thailand[73,119,133,137]
Astrosphaeriella asianaAegiceras corniculatum, Sonneratia albaLythraceae, PrimulaceaeThailand[119,138]
Astrosphaeriella australiensisCalamus spp.ArecaceaeAustralia[119]
Astrosphaeriella bambusaeBambusa spp., Metroxylon saguArecaceae, PoaceaeChina, Thailand[58], this study
Astrosphaeriella bambusellaBambusa spp.PoaceaeIndonesia[126,139]
Astrosphaeriella callicarpaUnknown host-Indonesia[140]
Astrosphaeriella daemonoropisDaemonorops margaritaeArecaceaeChina[115,129]
Astrosphaeriella erumpensUnknown hostArecaceaeCuba[141]
Astrosphaeriella exorrhizaIriartea sp.ArecaceaeVenezuela[119,142]
Astrosphaeriella floridanaSabal palmettoArecaceaeThe United States, Thailand[133,143]
Astrosphaeriella frondicolaCalamus spp., Daemonorops spp., Laccospadix australasica, Oraniopsis appendiculataArecaceaeAustralia, Brunei, China[73,115,119,144]
Astrosphaeriella fuscomaculansPhyllostachys nigraPoaceaeJapan[73,125,126]
Astrosphaeriella fusisporaBambusa spinosa, Phyllostachys bambusoides, Pleioblastus pubescensPoaceaeJapan, Philippines[73,125,126,130,145]
Astrosphaeriella gaofengensisBambusa spp.PoaceaeChina[66]
Astrosphaeriella immersaArchontophoenix alexandraeArecaceaeChina[115,129]
Astrosphaeriella lageniformisCocos nuciferaArecaceaeChina[73,146]
Astrosphaeriella lenticularisGeonoma sp.ArecaceaeBrunei, Ecuador[73,119]
Astrosphaeriella linguiformisBambusa spp.PoaceaeChina[147]
Astrosphaeriella livistonicolaLivistona chinensisArecaceaeChina, Thailand[73,115,129,133]
Astrosphaeriella longisporaUnknown host-Costa Rica[148]
Astrosphaeriella lophiostomopsisArenga undulatifoliaArecaceaeBrunei, Thailand[119,133]
Astrosphaeriella macrosporaMiscanthus spp.PoaceaeChina[149]
Astrosphaeriella malayensisDaemonorops sp., Licuala longicalycataArecaceaeMalaysia, Papua New Guinea, Thailand[119,129,133]
Astrosphaeriella maquilingianaCalamus spp., Iriartea sp.ArecaceaeAustralia, Ecuador, Philippines[73,119]
Astrosphaeriella mauritiaeMauritia flexuosaArecaceaeEcuador[119]
Astrosphaeriella minimaBambusa spp.PoaceaeChina, Indonesia[140,150]
Astrosphaeriella minoensisLicuala ramsayi, Phyllostachys reticulata, Sasa kurilensisArecaceae, PoaceaeAustralia, Japan[119,142,150]
Astrosphaeriella neofusisporaBambusa spp.PoaceaeThailand[58]
Astrosphaeriella neostellataBambusa spp.PoaceaeThailand[58]
Astrosphaeriella nipicolaNipa sp.ArecaceaeIndonesia[119]
Astrosphaeriella nypaeBambusa spp., Nypa fruticans, Phoenix hanceanaArecaceae, PoaceaeBrunei, China[73,115,119]
Astrosphaeriella pallidipolarisUnknown host-China[149]
Astrosphaeriella papuanaBambusa spp.PoaceaePapua New Guinea[126,150]
Astrosphaeriella piceaUnknown host--[151]
Astrosphaeriella pinicolaPinus spp.PinaceaeAustria[152]
Astrosphaeriella polymorphaUlmus spp.UlmaceaeThe United States[153]
Astrosphaeriella roseobrunneaBambusa spp.PoaceaeChina[66]
Astrosphaeriella seychellensisUnknown host-Seychelles[154]
Astrosphaeriella splendidaArundinaria hindsii, Astrocaryum sp., Iriartea sp., Jessenia bataua, Mauritia flexuosaArecaceae, PoaceaeChina, Ecuador[73,107,119]
Astrosphaeriella stellataBambusa spp., Calamus spp., Dendrocalamus spp., Phyllostachys heterocycla, Thysanolaena maximaArecaceae, PoaceaeAustralia, China, India, Japan, Papua New Guinea, Philippines, Vietnam[107,115,119,127,150,155,156,157]
Astrosphaeriella striasporaValota insularisPoaceaeVenezuela[119]
Astrosphaeriella sundarbanensisSonneratia apetalaLythraceaeIndia[73]
Astrosphaeriella thailandensisUnknown host-Thailand[158]
Astrosphaeriella thailandicaBambusa spp.PoaceaeThailand[58]
Astrosphaeriella thysanolaenaeThysanolaena maximaPoaceaeThailand[58]
Astrosphaeriella trochusBambusa spp., Phragmites spp., Phyllostachys spp.PoaceaeChina, Indonesia, South Africa[73,107,119]
Astrosphaeriella uberinaUnknown hostArecaceaeFrance, Nicaragua[73,119]
Astrosphaeriella uniseptataMiliusa tectonaAnnonaceaeIndia[159]
Astrosphaeriella vaginataBactris baculiferaArecaceaeMexico[160]
Astrosphaeriella venezuelensisBambusa spp.PoaceaeVenezuela[126]
Astrosphaeriella vesuviusCalamus spp., Daemonorops oxycarpus, Korthalsia sp., Licuala sp.ArecaceaeAustralia, Brunei, Indonesia, Thailand, Malaysia, Papua New Guinea, Sri Lanka[73,119]
Astrosphaeriella yunnanensisBambusa spp.PoaceaeChina[161]
Astrosphaeriellopsis bakerianaLivistona sinensisArecaceaeSingapore[162]
Astrosphaeriellopsis caryotaeCaryota sp.ArecaceaeThailand[59]
Caryospora aquaticaUnknown host-Thailand[80]
Caryospora australiensisUnknown host-Australia[163]
Caryospora coffeaeCoffea sp.RubiaceaeVenezuela[164]
Caryospora daweiensisMelocalamus compactiflorusPoaceaeChina[165]
Caryospora langloisiiArundinaria sp., Grewia asiaticaMalvaceae, PoaceaeIndia, The United States[126,166,167,168]
Caryospora masoniiEugenia caryophyllusMyrtaceaeTanzania[169]
Caryospora minimaAmygdalus persica, Prunus persicaRosaceaeThe United States[168]
Caryospora obclavataUnknown host- [104]
Caryospora phyllostachydisPhyllostachys bambusoidesPoaceaeJapan[135]
Caryospora pruniPrunus persicaRosaceaeChinathis study
Caryospora quercusCitus maxima, Quercus sp.Fagaceae, RutaceaeChina, Thailand[60,83], this study
Caryospora submersaUnknown host-Thailand[60]
Javaria samuelsiiNothofagus sp.Arecaceae, NothofagaceaeBrazil, New Zealand[170,171]
Javaria shimekiiUnknown host-Nicaragua[143]
Mycopepon bambusaeBabmbusa spp.PoaceaeChina[172]
Mycopepon fusoidisporusBabmbusa spp.PoaceaeChina[172]
Mycopepon smithiiUnknown host-Nicaragua[170]
Pithomyces africanusBorassus spp., Ficus spp., Hyphaene thebaica, Musa balbisiana, Ophiopogon japonicus, Trachelospermum jasminoidesApocynaceae, Arecaceae, Asparagaceae, Moraceae, MusaceaeChina, Ghana, Sierra Leone[73,110,111]
Pithomyces alabamensisQuercus spp.FagaceaeThe United States[173]
Pithomyces arecastriArecastrum romanzoffianumArecaceaeChina[174]
Pithomyces bulbilusEucalyptus spp.MyrtaceaeIndia[175]
Pithomyces caryotaeCaryota sp.ArecaceaeThailand[59]
Pithomyces cateniformisWisteria sinensisFabaceaeChina[110]
Pithomyces cinnamomeusUnknown host-Cuba[176]
Pithomyces clavisporopsisLilium amoenumLiliaceaeChina[110]
Pithomyces clavisporusUnknown host-The United States[177]
Pithomyces cupaniaeActinodaphne angustifolia, Albizia ferruginea, Anisophyllea laurina, Carpodinus hirsuta, Clitandra sp., Cupania guatemalensis, Funtumia africana, Jasminum dichotomum, Millettia pallens, Sorindeia juglandifoliaAnacardiaceae, Anisophylleaceae, Apocynaceae, Fabaceae, Lauraceae, Oleaceae, SapindaceaeCosta Rica, Myanmar, Sierra Leone[73,111,178]
Pithomyces dimorphosporusUnknown host-Brazil[179]
Pithomyces divaricatusCasearia tomentosaSalicaceaeIndia[180]
Pithomyces djbhatiiUnknown hostArecaceaeIndia[73]
Pithomyces elaeidicolaElaeis guineensis, Phoenix canariensis, Trachycarpus spp.ArecaceaeChina, Sierra Leone, Tanzania[73,110,111,181]
Pithomyces ellipticusLagerstroemia speciosa, Trachycarpus fortuneiArecaceae, LythraceaeChina[73,110]
Pithomyces ellisiiButea monosperma, Eucalyptus sp.Fabaceae, MyrtaceaeIndia[182]
Pithomyces flavusOncosperma sp.ArecaceaeSri Lanka[73,111]
Pithomyces gladioliGladiolus communisIridaceaeChina[73,110]
Pithomyces graminicolaArachis hypogaea, Canna spp., Dendrocalamus sp., Mangifera indica, Panicum spp., Persea americana, Phyllostachys spp., Ravenala spp., Saccharum spp., Sporobolus fertilisAnacardiaceae, Cannaceae, Fabaceae, Lauraceae, Poaceae, StrelitziaceaeChina, Fiji, India, South Africa[73,110,111,112,113,114,115]
Pithomyces helminthosporioidesFicus elasticaMoraceaeChina[73,110]
Pithomyces hyalosporusUnknown host-India[159]
Pithomyces leprosusFaurea salignaProteaceaeTanzania[183]
Pithomyces licualaeLicuala sp.ArecaceaeChina[59]
Pithomyces longiclavisporusSoil-China[117]
Pithomyces longipesBambusa ventricosaPoaceaeChina[174]
Pithomyces musaeMusa wilsoniiMusaceaeChina[73]
Pithomyces nigerBambusa spp.PoaceaeCuba[184]
Pithomyces obpyriformisLagerstroemia speciosaLythraceaeChina[174]
Pithomyces obscuriseptatusAcorus calamus, Butomus umbellatus, Carex spp., Cyperus fuscus, Eleocharis spp., Juncus spp., Sparganium spp.Acoraceae, Arecaceae, Butomaceae, Cyperaceae, Juncaceae, TyphaceaePeru, Poland[73,116]
Pithomyces pallidusSoil-China[117]
Pithomyces prolatusPithecellobium cubenseFabaceaeCuba[185]
Pithomyces pulvinatusFicus microcarpa, Phoenix sp., Setaria pumilaArecaceae, Fabaceae, Moraceae, PoaceaeChina, Indonesia, Pakistan, Poland[73,109,110,186]
Pithomyces quadratusCrataegus sp.RosaceaeThe United States[187]
Pithomyces saccharicolaSaccharum officinarumPoaceaeChina[174]
Pithomyces sivaramaprasadiiUnknown host-India[188]
Pithomyces subramanianiiUnknown host-India[73]
Pithomyces sumiderensisUnknown host-Cuba[176]
Pithomyces taiwanensisArecastrum romanzoffianumArecaceaeChina[73,110,189]
Pithomyces trachelospermiTrachelospermum jasminoidesApocynaceaeChina[174]
Pithomyces valparadisiacusCalopsis spp., Leucadendron sp., Puya chilensis, Puya coerulea, Rhodocoma capensisBromeliaceae, Proteaceae, RestionaceaeChile, South Africa[73,190,191]
Pithomyces variegataeBauhinia variegataFabaceaeChina[174]
Pteridiospora bambusaeBambusa sp.PoaceaeChina[90]
Pteridiospora chiangraiensisBambusa sp.PoaceaeThailand[58]
Pteridiospora chochrjakoviiQuercus pedunculifloraFagaceaeAzerbaijan[73]
Pteridiospora javanicaBambusa sp.PoaceaeIndonesia, Thailand[91,126]
Pteridiospora munkiiPhoenix sylvestrisArecaceaeIndia[121]
Pteridiospora spinosisporaFraxinus pennsylvanica, Liquidambar styracifluaAltingiaceae, OleaceaeThe United States[192]
Quercicola fusiformisQuercus sp.FagaceaeThailand[83]
Quercicola guttulospora-FagaceaeThailand[83]
Xenoastrosphaeriella aquaticaUnknown host-China[193]
Xenoastrosphaeriella tornataBambusa sp.PoaceaeThailand[58,194]
Carinispora nypaeLicuala longicalycata, Nypa fruticansArecaceaeBrunei, Thailand[97,133,195]
Carinispora velatisporaOncosperma tigillariumArecaceaeBrunei[137]
Pseudoastrosphaeriella aequatoriensisPhytelephas sp.ArecaceaeEcuador[73,119]
Pseudoastrosphaeriella africanaArenga undulatifolia, Calamus spp., Daemonorops sp., Phragmites australisArecaceae, PoaceaeAustralia, Brunei, Malaysia, Philippines, Tanzania[119,142]
Pseudoastrosphaeriella aquaticaUnknown host-Thailand[60]
Pseudoastrosphaeriella bambusaeBambusa spp.PoaceaeThailand[58]
Pseudoastrosphaeriella longicollaBambusa spp.PoaceaeThailand[58]
Pseudoastrosphaeriella papillataBambusa spp.PoaceaeBrunei[119]
Pseudoastrosphaeriella thailandensisBambusa spp.PoaceaeThailand[119]
Pseudoastrosphaeriellopsis kaverianaAvicennia marinaArecaceaeIndia[58]
Pseudoastrosphaeriella zingiberacearumHedychium coronariumZingiberaceaeChinathis study

4. Discussion

The families Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae are notable within the order Pleosporales, as they all possess carbonaceous ascomata and trabeculate pseudoparaphyses [58,93,196]. Of them, Aigialaceae was established by Suetrong et al. [75] to include three genera, Aigialus, Ascocratera, and Rimora, which were collected from mangrove habitats. Liu et al. [79] added Fissuroma and Neoastrosphaeriella to Aigialaceae from terrestrial habitats. Subsequently, Posidoniomyces was accommodated to the family from Mediterranean seagrass [197]. Thus, currently 29 species belonging to six genera are accepted in Aigialaceae [93,98,103]. Fissuroma is the most diverse genus in the family with 16 species, and all other genera have fewer than six species (Aigialus: 5 species, Neoastrosphaeriella: 5 species, Ascocratera: 1 species, Posidoniomyces: 1 species, Rimora: 1 species). Genera within the Aigialaceae family have been observed in diverse environments, including freshwater, mangrove, marine, and terrestrial ecosystems [58,59,60,66]. Aigialaceae species have carbonaceous, conical to hemispherical ascomata with slit-like opening, trabeculate pseudoparaphyses, cylindrical or cylindrical-clavate asci, and hyaline to brown, ellipsoidal to fusiform, septate to muriform ascospores with a sheath or gelatinous appendages around the apical cells [58,75,87,102]. In this study, we have revealed two new host records, Fissuroma caryotae and Neoastrosphaeriella aquatica from Hedychium coronarium (Zingiberaceae) and Phoenix paludosa (Arecaceae), respectively.
Phookamsak et al. [58] established Astrosphaeriellaceae to include two genera, such as Astrosphaeriella and Pteridiospora. The species have carbonaceous, conical ascomata, trabeculate pseudoparaphyses, bitunicate asci, and fusiform or obclavate ascospores. The asexual morph can be either coelomycetous or hyphomycetous [59,93]. The phylogenetic affinity of Astrosphaeriellopsis and Pithomyces in Astrosphaeriellaceae was discussed by Wanasinghe et al. [59] based on LSU, SSU, and tef1-α sequences. In addition, many novel Astrosphaeriellaceae genera were discovered in recent studies. For instance, four genera, such as Mycopepon [172], Quercicola, Xenoastrosphaeriella [83], and Aquatospora [60], were established in just three years. The phylogenetic placement of Javaria is still not well-resolved since it is lacking molecular data, but it has been placed in Astrosphaeriellaceae in recent outlines [103]. In addition, the taxonomic placement of the Caryospora has been controversial. This was placed in Caryosporaceae based on C. aquatica and C. minima, but later transferred to Astrosphaeriellaceae due to the similarity of carbonaceous ascostromata and trabeculate pseudoparaphyses [80,83]. The affinity of Caryospora to Astrosphaeriellaceae was followed by a recent outline of Wijayawardene et al. [103] as well. Therefore, currently 10 genera are accepted in Astrosphaeriellaceae [60,103]. Of them, some genera are highly diverse (e.g., Astrosphaeriella: 55 species, Pithomyces: 41 species), while others have a few numbers of species (Caryospora: 12 species, Pteridiospora: 6 species, Mycopepon: 4 species, Astrosphaeriellopsis: 2 species, Javaria: 2 species, Quercicola: 2 species, Xenoastrosphaeriella: 2 species, Aquatospora: 1 species). In this study, we introduce a new species, Caryospora pruni, from the decaying fruit pericarp of Prunus persica (Rosaceae), and two new host records, Astrosphaeriella bambusae and Caryospora quercus from Hedychium coronarium (Zingiberaceae) and Citus maxima (Rutaceae), respectively.
Pseudoastrosphaeriellaceae consists of three genera, such as Carinispora, Pseudoastrosphaeriella, and Pseudoastrosphaeriellopsis, which have hemispherical to lenticular ascostromata, trabeculate pseudoparaphyses, and brown, fusiform to obclavate ascospores with striations or longitudinal ridges [58,93,118,198]. Pseudoastrosphaeriella is the most diverse genus in the family, with seven species, and others have fewer species (Carinispora: 2 species and Pseudoastrosphaeriellopsis: 1 species). The asexual morph has been recorded as coelomycetous with pycnidial, conical, or hemispherical to globose conidiomata, phialidic, cylindric-clavate or ampulliform conidiogenous cells, and hyaline, globose to subglobose, or oblong, aseptate conidia [58]. The type genus is Pseudoastrosphaeriella, which was previously placed in Astrosphaeriella sensu lato. In this study, we introduce a new species, Pseudoastrosphaeriella zingiberacearum, from the dead stem of Hedychium coronarium in China. Interestingly, this is the first Pseudoastrosphaeriellaceae species reported from the host family, Zingiberaceae.
The new species and host records from Guangdong and Jiangxi Provinces extend the known distributions of Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae within humid subtropical regions of China. Their occurrence on diverse hosts, Arecaceae, Zingiberaceae, and Rutaceae, suggests these families are not restricted to mangrove or aquatic habitats, but can adapt to terrestrial plant litter environments. This supports the idea that subtropical forests act as biodiversity hotspots for pleosporalean fungi, where microclimatic conditions such as high humidity, seasonal rainfall, and decaying organic matter availability provide suitable niches. Biogeographically, the occurrence of these fungi in subtropical regions of China indicates possible hotspots of fungal diversity within humid subtropical ecosystems. The simultaneous presence of these fungal families in plant litter may result from similar ecological preferences, such as high humidity, nutrient-rich decaying substrates, and stable microhabitats, which together facilitate their coexistence.
Future studies with broader geographic sampling, the use of multi-gene (e.g., ITS, rpb2), environmental, or metabarcoding analyses would improve the understanding of fungal diversity and ecological interactions of these families. Since the host specificity of these proposed taxa remains unconfirmed, it could be validated through expanded sampling. Incorporating metagenomics and high-throughput sequencing would also allow for the detection of non-cultivable species, enabling a comprehensive assessment of fungal communities in plant litter and other substrates.

5. Conclusions

The morphological characteristics of the new species (Caryospora pruni and Pseudoastrosphaeriella zingiberacearum), which are introduced in this study, tally well with their respective generic concepts and can be distinguished from related species in their morphology and DNA molecular data. The new host records (Astrosphaeriella bambusae, Caryospora quercus, Fissuroma caryotae, and Neoastrosphaeriella aquatica) also provide similar morphological characteristics to their type species, and multi-gene phylogeny analyses also offer evidence for their placements. These discoveries significantly expand our understanding of fungal biodiversity across diverse hosts, substrates, and habitats, which is crucial for ecological research and conservation efforts. Future collections are required to understand the circumscription of some Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae genera, which have single species, such as Ascocratera, Aquatospora, Posidoniomyces, Pseudoastrosphaeriellopsis, and Rimora. Although some genera are highly diverse with numerous species, most of them lack molecular data. For instance, Pithomyces comprises 41 species, but molecular data are available for only 7 of them. Similarly, Astrosphaeriella includes 55 species, with molecular data available for only 13 species [93,98]. In addition, some genera (e.g., Javaria) are still lacking molecular data, and thus, new collections are needed to clarify their phylogenetic affinities.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof11120834/s1, File S1: Phylogenetic analyses data.

Author Contributions

Conceptualization, D.S.T., N.I.d.S. and S.H.; methodology, D.S.T. and N.I.d.S.; software, D.S.T. and N.I.d.S.; validation, N.I.d.S., S.H. and N.X.; formal analysis, D.S.T. and N.I.d.S.; investigation, D.S.T., N.I.d.S., S.H. and N.X.; resources, D.S.T., S.H. and N.X.; data curation, D.S.T. and N.I.d.S.; writing—original draft preparation, D.S.T., N.I.d.S., S.H. and N.X.; writing—review and editing, D.S.T., N.I.d.S., S.H. and N.X.; supervision, S.H. and N.X.; project administration, S.H. and N.X.; funding acquisition, S.H. and N.X. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (Grant No. 32400012), Natural Science Foundation of Guangdong Province (2024B1515020034), National Key R&D Program of China (2021YFA0910800), and Shenzhen University 2035 Program for Excellent Research (Grant No. 2024C006).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All sequence data are available in NCBI GenBank with the accession numbers given in the manuscript.

Acknowledgments

We would like to thank Shaun Pennycook (Manaaki Whenua Landcare Research, New Zealand) for his guidance on the fungal nomenclature.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hawksworth, D.L. The fungal dimension of biodiversity—Magnitude, significance, and conservation. Mycol. Res. 1991, 95, 641–655. [Google Scholar] [CrossRef]
  2. Hammond, P.M. Species inventory. In Global Biodiversity: Status of the Earth’s Living Resources; Groombridge, B., Ed.; Chapman and Hall: London, UK, 1992; pp. 17–39. [Google Scholar]
  3. Rossman, A.Y. Strategy for an all-taxa inventory of fungal biodiversity. In Biodiversity and Terrestrial Ecosystems; Peng, C.I., Chou, C.H., Eds.; Academia Sinica Monograph Series No. 14; Institute of Botany: Taipei, Taiwan, 1994; pp. 169–194. [Google Scholar]
  4. May, R.M. The dimensions of life on earth. In Nature and Human Society: The Quest for a Sustainable World; Raven, P.H., Williams, T., Eds.; National Academy Press: Washington, DC, USA, 2000; pp. 30–45. [Google Scholar]
  5. Blackwell, M. The Fungi: 1, 2, 3…5.1 million species? Am. J. Bot. 2011, 98, 426–438. [Google Scholar] [CrossRef] [PubMed]
  6. Hawksworth, D.L.; Lücking, R. Fungal diversity revisited: 2.2 to 3.8 million species. Microbiol. Spectr. 2017, 5, 1–17. [Google Scholar] [CrossRef] [PubMed]
  7. Wu, B.; Hussain, M.; Zhang, W.; Stadler, M.; Liu, X.; Xiang, M. Current insights into fungal species diversity and perspective on naming the environmental DNA sequences of fungi. Mycology 2019, 10, 127–140. [Google Scholar] [CrossRef] [PubMed]
  8. Hyde, K.D.; Saleh, A.; Aumentado, H.D.R.; Boekhout, T.; Bera, I.; Khyaju, S.; Bhunjun, C.S.; Chethana, K.T.; Phukhamsakda, C.; Doilom, M.; et al. Fungal numbers: Global needs for a realistic assessment. Fungal Divers. 2024, 128, 191–225. [Google Scholar] [CrossRef]
  9. Hammond, P.M. The current magnitude of biodiversity. In Global Biodiversity Assessment; Heywood, V., Ed.; Cambridge University Press: Cambridge, UK, 1995; pp. 113–138. [Google Scholar]
  10. Cannon, P.F. Diversity of the Phyllachoraceae with special reference to the tropics. In Biodiversity of Tropical Microfungi; Hyde, K.D., Ed.; Hong Kong University Press: Hong Kong, 1997; pp. 255–278. [Google Scholar]
  11. Arnold, A.E.; Maynard, Z.; Gilbert, G.S.; Coley, P.D.; Kursar, T.A. Are tropical fungal endophytes hyperdiverse? Ecol. Lett. 2000, 3, 267–274. [Google Scholar] [CrossRef]
  12. Hawksworth, D.L. The magnitude of fungal diversity: The 1.5 million species estimate revisited. Mycol. Res. 2001, 105, 1422–1432. [Google Scholar] [CrossRef]
  13. Brien, H.E.; Parrent, J.L.; Jackson, J.A.; Moncalvo, J.M.; Vilgalys, R. Fungal community analysis by large-scale sequencing of environmental samples. Appl. Environ. Microb. 2005, 71, 5544–5550. [Google Scholar] [CrossRef]
  14. Schmit, J.P.; Mueller, G.M. An estimate of the lower limit of global fungal diversity. Biodivers. Conserv. 2007, 16, 99–111. [Google Scholar] [CrossRef]
  15. Hawksworth, D.L. Global species numbers of fungi: Are tropical studies and molecular approaches contributing to a more robust estimate? Biodivers. Conserv. 2012, 21, 2425–2433. [Google Scholar] [CrossRef]
  16. Baldrian, P.; Větrovský, T.; Lepinay, C.; Kohout, P. High-throughput sequencing view on the magnitude of global fungal diversity. Fungal Divers. 2022, 114, 539–547. [Google Scholar] [CrossRef]
  17. Baldrian, P.; Kohout, P.; Větrovský, T. Global fungal diversity estimated from high-throughput sequencing. In Evolution of Fungi and Fungal-Like Organisms; Springer International Publishing: Cham, Switzerland, 2023; pp. 227–238. [Google Scholar] [CrossRef]
  18. Djemiel, C.; Dequiedt, S.; Horrigue, W.; Bailly, A.; Lelièvre, M.; Tripied, J.; Guilland, C.; Perrin, S.; Comment, G.; Saby, N.P.; et al. Unraveling biogeographical patterns and environmental drivers of soil fungal diversity at the French national scale. Soil 2024, 10, 251–273. [Google Scholar] [CrossRef]
  19. Martin, G.W. The numbers of fungi. Proc. Iowa Acad. Sci. 1951, 58, 175–178. [Google Scholar]
  20. Bisby, G.R.; Ainsworth, G.C. The numbers of fungi. Br. Mycol. Soc. 1943, 26, 16–19. [Google Scholar] [CrossRef]
  21. Pascoe, I. History of Systematic Mycology in Australia; Short, P.S., Ed.; Australian Systematic Botany Society: South Yarra, Australia, 1990; pp. 259–264. [Google Scholar]
  22. Smith, D.; Waller, J.M. Culture collections of microorganisms: Their importance in tropical plant pathology. Fitopatol. Bras. 1992, 17, 1–8. [Google Scholar]
  23. Hywel-Jones, N. A systematic survey of insect fungi from natural tropical forest in Thailand. In Aspects of Tropical Mycology; Isaac, S., Frankland, J.C., Watling, R., Whalley, A.J.S., Eds.; Cambridge University Press: Cambridge, UK, 1993; pp. 300–301. [Google Scholar]
  24. Dreyfuss, M.M.; Chapela, I.H. Potential of fungi in the discovery of novel, low-molecular weight pharmaceuticals. In The Discovery of Natural Products with Therapeutic Potential; Gullo, V., Ed.; Butterworth Heinemann: London, UK, 1994; pp. 49–80. [Google Scholar]
  25. Shivas, R.G.; Hyde, K.D. Biodiversity of plant pathogenic fungi in the tropics. In Biodiversity of Tropical Microfungi; Hyde, K.D., Ed.; Hong Kong University Press: Hong Kong, 1997; pp. 47–56. [Google Scholar]
  26. Guzman, G. Inventorying the fungi of Mexico. Biodivers. Conserv. 1998, 7, 369–384. [Google Scholar] [CrossRef]
  27. Fröhlich, J.; Hyde, K.D.; Guest, D.I. Fungi associated with leaf spots of palms in north Queensland, Australia. Mycol. Res. 1997, 101, 721–732. [Google Scholar] [CrossRef]
  28. Aptroot, A. Lichenized and saprobic fungal biodiversity of a single Elaeocarpus tree in Papua New Guinea, with the report of 200 species of ascomycetes associated with one tree. Fungal Divers. 2001, 6, 1–11. [Google Scholar]
  29. de Meeûs, T.; Renaud, F. Parasites within the new phylogeny of eukaryotes. Trends Parasitol. 2002, 18, 247–251. [Google Scholar] [CrossRef]
  30. Crous, P.W.; Rong, I.H.; Wood, A.; Lee, S.; Glen, H.; Botha, W.; Slippers, B.; de Beer, W.Z.; Wingfield, M.J.; Hawksworth, D.L. How many species of fungi are there at the tip of Africa? Stud. Mycol. 2006, 55, 13–33. [Google Scholar] [CrossRef]
  31. Dai, Y.C.; Zhuang, J.Y. Numbers of fungal species hitherto known in China. Mycosystema 2010, 29, 625–628. [Google Scholar]
  32. Mora, C.; Tittensor, D.P.; Adl, S.; Simpson, A.G.B.; Worm, B. How many species are there on Earth and in the ocean? PLoS Biol. 2011, 9, e1001127. [Google Scholar] [CrossRef]
  33. Niskanen, T.; Lücking, R.; Dahlberg, A.; Gaya, E.; Laura, M.S.; Mikryukov, V.; Liimatainen, K.; Druzhinina, I.; Westrip, J.R.S.M.; Mueller, G.M.; et al. Pushing the frontiers of biodiversity research: Unveiling the global diversity, distribution, and conservation of fungi. Annu. Rev. Environ. 2023, 48, 49–176. [Google Scholar] [CrossRef]
  34. Dai, Y.C.; Cui, B.K.; Si, J.; He, S.H.; Hyde, K.D.; Yuan, H.S.; Liu, X.Y.; Zhou, L.W. Dynamics of the worldwide number of fungi with emphasis on fungal diversity in China. Mycol. Prog. 2015, 14, 62. [Google Scholar] [CrossRef]
  35. Feng, B.; Yang, Z. Studies on diversity of higher fungi in Yunnan, southwestern China: A review. Plant Divers. 2018, 40, 165–171. [Google Scholar] [CrossRef] [PubMed]
  36. Wang, C.; Ma, L.; Zuo, X.; Ye, X.; Wang, R.; Huang, Z.; Liu, G.; Cornelissen, J.H. Plant diversity has stronger linkage with soil fungal diversity than with bacterial diversity across grasslands of northern China. Glob. Ecol. Biogeogr. 2022, 31, 886–900. [Google Scholar] [CrossRef]
  37. Cai, J.; Yu, W.B.; Zhang, T.; Wang, H.; Li, D.Z. China’s biodiversity hotspots revisited: A treasure chest for plants. PhytoKeys 2019, 130, 1–24. [Google Scholar] [CrossRef]
  38. Liu, S.L.; Zhao, P.; Cai, L.; Shen, S.; Wei, H.W.; Na, Q.; Han, M.; Wei, R.; Ge, Y.; Ma, H.; et al. Catalogue of fungi in China 1. New taxa of plant-inhabiting fungi. Mycology 2025, 16, 1–58. [Google Scholar] [CrossRef]
  39. Shen, D. Microbial diversity and application of microbial products for agricultural purposes in China. Agric. Ecosyst. Environ. 1997, 62, 237–245. [Google Scholar] [CrossRef]
  40. Ping, Z.; Zhiling, D.; Huijun, G.; Biyun, L. Influence of Land Use on Numbers and Diversity of Soil Microorganisms in Gaoligong Mountains. Acta Bot. Yunnan. 1999, 2, 84–89. [Google Scholar]
  41. Dequn, Z.; Hyde, K.D.; Vrijmoed, L.L.P. Resources and diversity of bambusicolous fungi in China. Guizhou Sci. 2000, 18, 62–70. [Google Scholar]
  42. Cai, L.; Tsui, C.K.M.; Zhang, K.Q.; Hyde, K.D. Aquatic fungi from lake Fuxian, Yunnan, China. Fungal Divers. 2002, 9, 57–70. [Google Scholar]
  43. Li, L.F.; Li, T.; Zhao, Z.W. Differences of arbuscular mycorrhizal fungal diversity and community between a cultivated land, an old field, and a never-cultivated field in a hot and arid ecosystem of southwest China. Mycorrhiza 2007, 17, 655–665. [Google Scholar] [CrossRef] [PubMed]
  44. Huang, W.Y.; Cai, Y.Z.; Hyde, K.D.; Corke, H.; Sun, M. Biodiversity of endophytic fungi associated with 29 traditional Chinese medicinal plants. Fungal Divers. 2008, 33, 61–75. [Google Scholar]
  45. Zhang, Z.F.; Liu, F.; Zhou, X.; Liu, X.Z.; Liu, S.J.; Cai, L. Culturable mycobiota from Karst caves in China, with descriptions of 20 new species. Persoonia Mol. Phylogeny Evol. Fungi 2017, 39, 1–31. [Google Scholar] [CrossRef]
  46. Redhead, S.A.; Bo, L. New species and new records of Tricholomataceae (Agaricales) from China. Can. J. Bot. 1982, 60, 1479–1486. [Google Scholar] [CrossRef]
  47. Shiao, M.S.; Lin, L.J.; Yeh, S.F.; Chou, C.S. Two new triterpenes of the fungus Ganoderma lucidum. J. Nat. Prod. 1987, 50, 886–890. [Google Scholar] [CrossRef]
  48. Wei, S.X.; Zhuang, J.Y. Additions to the graminicolous rust fungi of China. Mycosystema 1989, 2, 217–221. [Google Scholar]
  49. Zang, M.; Petersen, R.H. Endophallus, a new genus in the Phallaceae from China. Mycologia 1989, 81, 486–489. [Google Scholar] [CrossRef]
  50. Dai, Y.C.; Yang, Z.L.; Cui, B.K.; Yu, C.J.; Zhou, L.W. Species diversity and utilization of medicinal mushrooms and fungi in China. Int. J. Med. Mushrooms 2009, 11, 287–302. [Google Scholar] [CrossRef]
  51. Cui, B.K.; Li, H.J.; Ji, X.; Zhou, J.L.; Song, J.; Si, J.; Yang, Z.L.; Dai, Y.C. Species diversity, taxonomy and phylogeny of Polyporaceae (Basidiomycota) in China. Fungal Divers. 2019, 97, 137–392. [Google Scholar] [CrossRef]
  52. Zhao, R.; Chen, K.Y.; Mao, L.J.; Zhang, C.L. Eleven new species of Trichoderma (Hypocreaceae, Hypocreales) from China. Mycology 2025, 16, 180–209. [Google Scholar] [CrossRef] [PubMed]
  53. Dong, W.; Chen, J.; Liao, X.; Chen, X.; Huang, L.; Huang, J.; Huang, R.; Zhong, S.; Zhang, X. Biodiversity, distribution and functional differences of fungi in four species of corals from the South China sea, elucidated by high-throughput sequencing Technology. J. Fungi 2024, 10, 452. [Google Scholar] [CrossRef] [PubMed]
  54. Wang, Y.; Bai, Q.; Meng, F.; Dong, W.; Fan, H.; Zhu, X.; Duan, Y.; Chen, L. High-Throughput Sequence Analysis of Microbial Communities of Soybean in Northeast China. Agronomy 2025, 15, 436. [Google Scholar] [CrossRef]
  55. Yan, Q.; Wang, P.; Liu, Z.; Yu, Y.; Tan, X.; Huang, X.; Wen, J.; Zhang, W. High-Throughput sequencing uncovers fungal community succession during Morchella sextelata development. J. Fungi 2025, 11, 364. [Google Scholar] [CrossRef]
  56. Tennakoon, D.S.; Thambugala, K.M.; de Silva, N.I.; Song, H.Y.; Suwannarach, N.; Chen, F.S.; Hu, D.M. An overview of Melanommataceae (Pleosporales, Dothideomycetes): Current insight into the host associations and geographical distribution with some interesting novel additions from plant litter. MycoKeys 2024, 106, 43–96. [Google Scholar] [CrossRef]
  57. Hongsanan, S.; Khuna, S.; Manawasinghe, I.S.; Tibpromma, S.; Chethana, K.W.T.; Xie, N.; Bagacay, J.F.E.; Calabon, M.S.; Chen, C.; Doilom, M. Mycosphere Notes 521-571: A special edition of fungal biodiversity to celebrate Kevin, D. Hyde’s 70th birthday and his exceptional contributions to Mycology. Mycosphere 2025, 16, 2002–2180. [Google Scholar] [CrossRef]
  58. Phookamsak, R.; Norphanphoun, C.; Tanaka, K.; Dai, D.Q.; Luo, Z.L.; Liu, J.K.; Su, H.Y.; Bhat, D.J.; Bahkali, A.H.; Mortimer, P.E.; et al. Towards a natural classification of Astrosphaeriella-like species; introducing Astrosphaeriellaceae and Pseudoastrosphaeriellaceae fam. nov. and Astrosphaeriellopsis, gen. nov. Fungal Divers. 2015, 74, 143–197. [Google Scholar] [CrossRef]
  59. Wanasinghe, D.N.; Jeewon, R.; Jones, E.B.G.; Boonmee, S.; Kaewchai, S.; Manawasinghe, I.S.; Lumyong, S.; Hyde, K.D. Novel palmicolous taxa within Pleosporales: Multigene phylogeny and taxonomic circumscription. Mycol. Prog. 2018, 17, 571–590. [Google Scholar] [CrossRef]
  60. Dong, W.; Wang, B.; Hyde, K.D.; McKenzie, E.H.C.; Raja, H.A.; Tanaka, K.; Abdel-Wahab, M.A.; Abdel-Aziz, F.A.; Doilom, M.; Phookamsak, R.; et al. Freshwater Dothideomycetes. Fungal Divers. 2020, 105, 319–575. [Google Scholar] [CrossRef]
  61. Senanayake, I.C.; Rathnayaka, A.R.; Marasinghe, D.S.; Calabon, M.S.; Gentekaki, E.; Lee, H.B.; Hurdeal, V.G.; Pem, D.; Dissanayake, L.S.; Wijesinghe, S.N.; et al. Morphological approaches in studying fungi: Collection, examination, isolation, sporulation and preservation. Mycosphere 2020, 11, 2678–2754. [Google Scholar] [CrossRef]
  62. Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. Res. 1990, 172, 4238–4246. [Google Scholar] [CrossRef] [PubMed]
  63. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar] [CrossRef]
  64. Rehner, S.A.; Buckley, E. A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 2005, 97, 84–98. [Google Scholar] [CrossRef] [PubMed]
  65. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  66. Habib, K.; Li, W.H.; Ren, Y.L.; Liu, L.L.; Lu, C.T.; Zhang, Q.F.; Yao, Z.Q.; Luo, X.Y.; Zhou, X.; Zeng, W.Y.; et al. Exploration of ascomycetous fungi revealing novel taxa in Southwestern China. Mycosphere 2025, 16, 1412–1529. [Google Scholar] [CrossRef]
  67. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  68. Capella-Gutiérrez, S.; Silla-Martínez, J.M.; Gabaldón, T. TrimAl: A tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 2009, 25, 1972–1973. [Google Scholar] [CrossRef]
  69. Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for Inference of Large Phylogenetic Trees. In Proceedings of the SC10 Workshop on Gateway Computing Environments (GCE10), New Orleans, LA, USA, 14 November 2010. [Google Scholar] [CrossRef]
  70. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
  71. Nylander, J.A.A. MrModeltest2 v. 2.3 (Program for Selecting DNA Substitution Models Using PAUP*); Evolutionary Biology Centre: Uppsala, Sweden, 2008. [Google Scholar]
  72. Rambaut, A. FigTree, version 1.4.0; Institute of Evolutionary Biology, University of Edinburgh: Edinburgh, UK, 2012. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 10 August 2025).
  73. Farr, D.F.; Rossman, A.Y. Fungal Databases, Systematic Mycology and Microbiology Laboratory. ARS, USDA. 2025. Available online: https://fungi.ars.usda.gov/ (accessed on 1 August 2025).
  74. Dayarathne, M.C.; Jones, E.B.G.; Maharachchikumbura, S.S.N.; Devadatha, B.; Sarma, V.V.; Khongphinitbunjong, K.; Chomnunti, P.; Hyde, K.D. Morpho-molecular characterization of microfungi associated with marine based habitats. Mycosphere 2020, 11, 1–188. [Google Scholar] [CrossRef]
  75. Suetrong, S.; Schoch, C.L.; Spatafora, J.W.; Kohlmeyer, J.; Volkmann-Kohlmeyer, B.; Sakayaroj, J.; Phongpaichit, S.; Tanaka, K.; Hirayama, K.; Jones, E.B.G. Molecular systematics of the marine Dothideomycetes. Stud. Mycol. 2009, 64, 155–173. [Google Scholar] [CrossRef]
  76. Schoch, C.L.; Crous, P.W.; Groenewald, J.Z.; Boehm, E.W.A.; Burgess, T.I.; De Gruyter, J.; De Hoog, G.S.; Dixon, L.J.; Grube, M.; Gueidan, C.; et al. A class-wide phylogenetic assessment of Dothideomycetes. Stud. Mycol. 2009, 64, 1–15. [Google Scholar] [CrossRef]
  77. Hu, F.J.; Fournier, J.; Jeewon, R.; Hyde, K.D. Relationships among Astrosphaeriella, Caryospora and Trematosphaeria. Ph.D. Thesis, The University of Hong Kong, Hong Kong, 2009. [Google Scholar]
  78. Hyde, K.D.; de Silva, N.I.; Jeewon, R.; Bhat, D.J.; Phookamsak, R.; Doilom, M.; Boonmee, S.; Jayawardena, R.S.; Maharachchikumbura, S.S.N.; Senanayake, I.C.; et al. AJOM new records and collections of fungi: 1–100. Asian J. Mycol. 2020, 3, 22–294. [Google Scholar] [CrossRef]
  79. Liu, J.K.; Phookamsak, R.; Jones, E.B.G.; Zhang, Y.; Ko-Ko, T.W.; Hu, H.L.; Boonmee, S.; Doilom, M.; Chukeatirote, E.; Bahkali, A.H.; et al. Astrosphaeriella is polyphyletic, with species in Fissuroma gen. nov., and Neoastrosphaeriella gen. nov. Fungal Divers. 2011, 51, 135–154. [Google Scholar] [CrossRef]
  80. Ariyawansa, H.A.; Hyde, K.D.; Jayasiri, S.C.; Buyck, B.; Chethana, K.W.T.; Dai, D.Q.; Dai, Y.C.; Daranagama, D.A.; Jayawardena, R.S.; Lücking, R. Fungal diversity notes 111–252 taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers. 2015, 75, 27–274. [Google Scholar] [CrossRef]
  81. Yang, J.; Liu, L.L.; Jones, E.G.; Hyde, K.D.; Liu, Z.Y.; Bao, D.F.; Liu, N.G.; Li, W.L.; Shen, H.W.; Yu, X.D.; et al. Freshwater fungi from karst landscapes in China and Thailand. Fungal Divers. 2023, 119, 1–212. [Google Scholar] [CrossRef]
  82. Cai, L.; Hyde, K.D. Ascorhombispora aquatica gen. et sp. nov. from a freshwater habitat in China, and its phylogenetic placement based on molecular data. Cryptogam. Mycol. 2007, 28, 291–300. [Google Scholar]
  83. Jayasiri, S.C.; Hyde, K.D.; Jones, E.B.G.; McKenzie, E.H.C.; Jeewon, R.; Phillips, A.J.L.; Bhat, D.J.; Wanasinghe, D.N.; Liu, J.K.; Lu, Y.Z.; et al. Diversity, morphology and molecular phylogeny of Dothideomycetes on decaying wild seed pods and fruits. Mycosphere 2019, 10, 1–186. [Google Scholar] [CrossRef]
  84. Mugambi, G.K.; Huhndorf, S.M. Molecular phylogenetics of Pleosporales: Melanommataceae and Lophiostomataceae re-circumscribed (Pleosporomycetidae, Dothideomycetes, Ascomycota). Stud. Mycol. 2009, 64, 103–121. [Google Scholar] [CrossRef]
  85. Schoch, C.L.; Shoemaker, R.A.; Seifert, K.A.; Hambleton, S.; Spatafora, J.W.; Crous, P.W. A multigene phylogeny of the Dothideomycetes using four nuclear loci. Mycologia 2006, 98, 1041–1052. [Google Scholar] [CrossRef]
  86. Zhang, S.N.; Hyde, K.D.; Jones, E.B.G.; Cheewangkoon, R.; Liu, J.K. Additions to Fissuroma and Neoastrosphaeriella (Aigialaceae, Pleosporales) from palms. Mycosphere 2020, 11, 269–284. [Google Scholar] [CrossRef]
  87. Tennakoon, D.S.; Phookamsak, R.; Kuo, C.H.; Goh, T.K.; Jeewon, R.; Hyde, K.D. Morphological and phylogenetic evidence reveal Fissuroma taiwanense sp. nov. (Aigialaceae, Pleosporales) from Hedychium coronarium. Phytotaxa 2018, 338, 265–275. [Google Scholar] [CrossRef]
  88. Konta, S.; Hyde, K.D.; Eungwanichayapant, P.D.; Doilom, M.; Tennakoon, D.S.; Senwanna, C.; Boonmee, S. Fissuroma (Aigialaceae: Pleosporales) appears to be hyperdiverse on Arecaceae: Evidence from two new species from southern Thailand. Acta Bot. Bras. 2020, 34, 384–393. [Google Scholar] [CrossRef]
  89. Bao, D.F.; Luo, Z.L.; Jeewon, R.; Nalumpang, S.; Su, H.Y.; Hyde, K.D. Neoastrosphaeriella aquatica sp. nov. (Aigialaceae), a new species from freshwater habitat in Southern Thailand. Phytotaxa 2019, 391, 197. [Google Scholar] [CrossRef]
  90. Hyde, K.D.; Chaiwan, N.; Norphanphoun, C.; Boonmee, S.; Camporesi, E.; Chethana, K.W.T.; Dayarathne, M.C.; de Silva, N.I.; Dissanayake, A.J.; Ekanayaka, A.H.; et al. Mycosphere notes 169–224. Mycosphere 2018, 9, 271–430. [Google Scholar] [CrossRef]
  91. Phookamsak, R.; Liu, J.K.; Manamgoda, D.S.; Wanasinghe, D.N.; Ariyawansa, H.A.; Mortimer, P.E.; Chukeatirote, E.; McKenzie, E.H.C.; Hyde, K.D. Epitypification of two bambusicolous fungi from Thailand. Cryptogam. Mycol. 2014, 35, 239–256. [Google Scholar] [CrossRef]
  92. Bao, D.F.; Hyde, K.D.; McKenzie, E.H.; Jeewon, R.; Su, H.Y.; Nalumpang, S.; Luo, Z.L. Biodiversity of lignicolous freshwater hyphomycetes from China and Thailand and description of sixteen species. J. Fungi 2021, 7, 669. [Google Scholar] [CrossRef] [PubMed]
  93. Hongsanan, S.; Hyde, K.D.; Phookamsak, R.; Wanasinghe, D.N.; McKenzie, E.H.C.; Sarma, V.V.; Lücking, R.; Boonmee, S.; Bhat, J.D.; Liu, N.-G.; et al. Refined families of Dothideomycetes: Orders and families incertae sedis in Dothideomycetes. Fungal Divers. 2020, 105, 17–318. [Google Scholar] [CrossRef]
  94. Rehm, H. Ascomycetes philippinenses—III. Philipp. J. Sci. Sect. C 1913, 8, 391–406. [Google Scholar]
  95. Tanaka, K.; Harada, Y. Bambusicolous fungi in Japan (4): A new combination, Astrosphaeriella aggregata. Mycoscience 2005, 46, 114–118. [Google Scholar] [CrossRef]
  96. Hongsanan, S.; Phookamsak, R.; Bhat, D.J.; Wanasinghe, D.N.; Promputtha, I.; Suwannarach, N.; Sandamali, D.; Lumyong, S.; Xu, J.; Xie, N. Exploring ascomycete diversity in Yunnan, China I: Resolving ambiguous taxa in Phaeothecoidiellaceae and investigating conservation implications of fungi. Front. Cell. Infect. Microbiol. 2023, 13, 1252387. [Google Scholar] [CrossRef]
  97. Zhang, Y.; Crous, P.W.; Schoch, C.L.; Hyde, K.D. Pleosporales. Fungal Divers. 2012, 53, 1–221. [Google Scholar] [CrossRef] [PubMed]
  98. Species Fungorum. 2025. Available online: http://www.indexfungorum.org (accessed on 15 September 2025).
  99. De Notaris. Micromyc Ital. Novi 1855, 9, 7. [Google Scholar]
  100. Jeffers, W.F. Studies on Caryospora putaminum. Mycologia 1940, 32, 550–566. [Google Scholar] [CrossRef]
  101. Lumbsch, H.T.; Huhndorf, S.M. Myconet Volume 14. Part One. Outline of Ascomycota–2009. Fieldiana Life Earth Sci. 2010, 1, 1–60. [Google Scholar] [CrossRef]
  102. Hyde, K.D.; Jones, E.B.G.; Liu, J.K.; Ariyawansa, H.A.; Boehm, E.; Boonmee, S.; Braun, U.; Chomnunti, P.; Crous, P.W.; Dai, D.Q.; et al. Families of Dothideomycetes. Fungal Divers. 2013, 63, 1–313. [Google Scholar] [CrossRef]
  103. Wijayawardene, N.N.; Hyde, K.D.; Dai, D.Q.; Sánchez-García, M.; Goto, B.T.; Saxena, R.K.; Erdoğdu, M.; Selçuk, F.; Rajeshkumar, K.C.; Aptroot, A.; et al. Outline of Fungi and fungus-like taxa—2021. Mycosphere 2022, 13, 53–453. [Google Scholar] [CrossRef]
  104. Raja, H.A.; Shearer, C.A. Freshwater ascomycetes: New and noteworthy species from aquatic habitats in Florida. Mycologia 2008, 100, 467–489. [Google Scholar] [CrossRef]
  105. Niranjan, M.; Sarma, V.V. New Ascomycetous fungi in the family Aigialaceae from Andaman Islands, India. Curr. Res. Environm. Appl. Mycol. 2018, 8, 351–359. [Google Scholar] [CrossRef]
  106. Vitória, N.S.; Cavalcanti, M.A.D.; Bezerra, J.L. Species of Astrosphaeriella and Fissuroma from palms: New records for South America and Brazil. Nova Hedwig. 2016, 102, 129–140. [Google Scholar] [CrossRef]
  107. Zhou, D.Q.; Cai, L.; Hyde, K.D. Astrosphaeriella and Roussoella species on bamboo from Hong Kong and Yunnan, China including a new species of Roussoella. Cryptogam. Mycol. 2003, 24, 191–197. [Google Scholar]
  108. He, S.C.; Hyde, K.D.; Jayawardena, R.S.; Thiyagaraja, V.; Wanasinghe, D.N.; Zhao, Y.W.; Wang, Z.Y.; Cai, T.; Yang, Y.Y.; Al-Otibi, F.; et al. Taxonomic contributions to Pleosporales and Kirschsteiniotheliales from the Xizang Autonomous Region, China. Mycology 2025, 1–38. [Google Scholar] [CrossRef]
  109. Mulenko, W.; Majewski, T.; Ruszkiewicz-Michalska, M. A Preliminary Checklist of Micromycetes in Poland; The Władysław Institute of Botany, Polish Academy of Sciences: Krakow, Poland, 2008; Volume 9, pp. 1–752. [Google Scholar]
  110. Tianyu, Z. Flora Fungorum Sincorum Vol. 31: 26 Genera of Dematiaceous Dictyosporous Hyphomycetes Excluding Alternaria; Science Press: Beijing, China, 2009; Volume 31, pp. 1–231. [Google Scholar]
  111. Ellis, M.B. Dematiaceous Hyphomycetes. I. Mycol. Pap. 1960, 76, 1–36. [Google Scholar]
  112. Thaung, M.M. A list of Hypomycetes (and Agonomycetes) in Burma. Australas. Mycol. 2008, 27, 149–172. [Google Scholar]
  113. Matsushima, T. Matsushima Mycological Memoirs No. 1. Saprophytic microfungi from Taiwan, Part 1. Hyphomycetes; Matsushima Fungus Collection: Kobe, Japan, 1980; p. 82. [Google Scholar]
  114. Thomas, T.V.; Eicker, A.; Robbertse, P.J. Possible role of fungi in negatively affecting fruit-set in avocados. S. Afr. J. Bot. 1994, 60, 251–256. [Google Scholar] [CrossRef][Green Version]
  115. Lu, B.; Hyde, K.D.; Ho, W.H.; Tsui, K.M.; Taylor, J.E.; Wong, K.M.; Yanna, D.; Zhou, D. Checklist of Hong Kong Fungi. Fungal Divers. 2000, 207. Available online: https://www.fungaldiversity.org/fdp/researchseriesbooks/checklist.html (accessed on 1 August 2025).
  116. Czeczuga, B.; Muszynska, E.; Godlewska, A.; Mazalska, B. Aquatic fungi and straminipilous organisms on decomposing fragments of wetland plants. Mycol. Balcan. 2007, 4, 31–44. [Google Scholar]
  117. Liu, H.M.; Zhang, T.Y. Species of Pithomyces (Hyphomycetes) from soil in the warm temperate zone of eastern China. Mycosystema 2007, 26, 484–489. [Google Scholar]
  118. Phookamsak, R.; Hyde, K.D.; Jeewon, R.; Bhat, D.J.; Jones, E.B.G.; Maharachchikumbura, S.S.N.; Raspé, O.; Karunarathna, S.C.; Wanasinghe, D.N.; Hongsanan, S.; et al. Fungal Diversity Notes 929–1035: Taxonomic and Phylogenetic Contributions on Genera and Species of Fungi. Fungal Divers. 2019, 95, 1–273. [Google Scholar] [CrossRef]
  119. Hyde, K.D.; Fröhlich, J. Fungi from palms. XXXVII. The genus Astrosphaeriella, including ten new species. Sydowia 1997, 50, 81–132. [Google Scholar]
  120. Sarma, V.V.; Raghukumar, S. Manglicolous fungi from Chorao mangroves, Goa, West coast of India: Diversity and frequency of occurrence. Nova Hedwig. 2013, 97, 533–542. [Google Scholar] [CrossRef]
  121. Pande, A. Ascomycetes of Peninsular India; Scientific Publishers: Jodhpur, India, 2008; p. 584. [Google Scholar]
  122. Kohlmeyer, J.; Schatz, S. Aigialus gen. nov. (Ascomycetes) with two new marine species from Mangroves. Trans. Brit. Mycol. Soc. 1985, 85, 699–707. [Google Scholar] [CrossRef]
  123. Borse, B.D. New species of Aigialus from India. Trans. Brit. Mycol. Soc. 1987, 88, 424–426. [Google Scholar] [CrossRef]
  124. Hino, I.; Katumoto, K. Illustrationes fungorum bambusicolorum III. Bull. Fac. Agric. Yamaguchi Univ. 1955, 6, 29–68. [Google Scholar]
  125. Hino, I. Species of fungi parasitic on bamboos in Japan. Icon. Fungorum Bambusi 1961, 1–333. [Google Scholar]
  126. Eriksson, O.E.; Yue, J.Z. Bambusicolous pyrenomycetes, an annotated check-list. Myconet 1998, 1, 25–78. [Google Scholar]
  127. Hosoya, T.; Tanaka, K. Ascomycetes and Anamorphic Fungi collected from Yakushima Island, Southern Japan. Bull. Natl. Mus. Nat. Sci. 2007, 33, 47–54. [Google Scholar]
  128. Feng, Y.; Zhang, S.N.; Chen, Y.Y.; Liu, Z.Y. Fissuroma bambucicola sp. nov. (Aigialaceae, Pleosporales) from Bamboo in Guizhou, China. Phytotaxa 2022, 543, 64–72. [Google Scholar] [CrossRef]
  129. Hyde, K.D.; Aptroot, A.; Frohlich, J.; Taylor, J.E. Fungi from palms. XLIII. Lophiostoma and Astrosphaeriella species with slit-like ostioles. Nova Hedwig. 2000, 70, 143–160. [Google Scholar] [CrossRef]
  130. Teodoro, N.G. An Enumeration of Philippine Fungi. Techn. Bull. Dept. Agric. Comm. Manila 1937, 4, 1–585. [Google Scholar]
  131. Vohník, M. Are Lulworthioid fungi dark septate endophytes of the dominant Mediterranean seagrass Posidonia oceanica? Plant Biol. 2022, 24, 127–133. [Google Scholar] [CrossRef]
  132. Pinnoi, A.; Lumyong, S.; Hyde, K.D.; Jones, E.B.G. Biodiversity of fungi on the palm Eleiodoxa conferta in Sirindhorn peat swamp forest, Narathiwat, Thailand. Fungal Divers. 2006, 22, 205–218. [Google Scholar]
  133. Pinruan, U.; Hyde, K.D.; Lumyong, S.; McKenzie, E.H.C.; Jones, E.B.G. Occurrence of fungi on tissues of the peat swamp palm Licuala longicalycata. Fung. Divers. 2007, 25, 157–173. [Google Scholar]
  134. Hino, I.; Katumoto, K. Notes on fungi from western Japan (1). Bull. Fac. Agric. Yamaguchi Univ. 1956, 7, 257–266. [Google Scholar]
  135. Kobayashi, T. Index of Fungi Inhabiting Woody Plants in Japan, Host, Distribution and Literature; Zenkoku-Noson-Kyoiku Kyokai Publishing Co., Ltd.: Tokyo, Japan, 2007; p. 1227. [Google Scholar]
  136. Dennis, R.W.G. British Ascomycetes. J. Cramer Vaduz 1978, 585. [Google Scholar]
  137. Hyde, K.D. Fungi from palms. XII.* Three new intertidal ascomycetes from submerged palm fronds. Sydowia 1994, 46, 257–264. [Google Scholar]
  138. Hyde, K.D. Lophiostoma asiana sp. nov. from Thailand mangroves. Mycotaxon 1995, 55, 283–288. [Google Scholar] [CrossRef]
  139. von Höhnel, F. Fragmente zur Mykologie. XXIV. Mitteilung (Nr. 1189 bis 1214). Sitzungsberichte Kais. Akad. Wiss. Math.-Naturw. Kl. Abt. I 1920, 129, 137–184. [Google Scholar]
  140. Penzig, A.J.O.; Saccardo, P.A. Diagnoses fungorum novorum in insula Java collectorum. Series I. Malpighia 1897, 11, 387–409. [Google Scholar]
  141. Theissen, F. Beiträge zur Systematik der Ascomyzeten. Annales Mycologici. 1916, 14, 401–439. [Google Scholar]
  142. Hawksworth, D.L.; Boise, J.R. Some additional species of Astrosphaeriella, with a key to the members of the genus. Sydowia 1985, 38, 114–124. [Google Scholar]
  143. Barr, M.E. Melanommatales (Loculoascomycetes). N. Am. Flora 1990, 13, 1–129. [Google Scholar]
  144. Loilong, A.; Sakayaroj, J.; Rungjindamai, N.; Choeyklin, R.; Jones, E.B.G. Biodiversity of fungi on the palm Nypa fruticans. In Marine Fungi and Fungal-Like Organisms; Jones, E.B.G., Pang, K.L., Eds.; de Gruyter: Berlin, Germany, 2012; pp. 273–290. [Google Scholar]
  145. Reinking, O.A. Host Index of Diseases of Economic Plants in the Philippines. Philipp. Agric. 1919, 8, 38–54. [Google Scholar]
  146. Yue, J.Z.; Eriksson, O. Studies on Chinese Ascomycetes. 3. Astrosphaeriella lageniformis. Mycotaxon 1986, 27, 93–98. [Google Scholar] [CrossRef]
  147. Chen, C.Y.; Huang, J.W. Astrosphaeriella linguiformis, a new species on bamboo. Mycotaxon 2006, 98, 119–123. [Google Scholar]
  148. Rogers, J.D. Astrosphaeriella longispora, a new tropical species with large ascospores. Sydowia 2003, 55, 355–358. [Google Scholar]
  149. Chen, C.Y.; Hsieh, W.H. Astrosphaeriella from Taiwan, including two new species. Bot. Bull. Acad. Sin. 2004, 45, 171–178. [Google Scholar]
  150. Aptroot, A. Redisposition of some species excluded from Didymosphaeria (Ascomycotina). Nova Hedwig. 1995, 60, 325–379. [Google Scholar] [CrossRef]
  151. Aptroot, A. Additional lichen records from Australia 70. Species of Anisomeridium and Mycomicrothelia, with a note on Arthopyrenia. Australas. Lichenol. 2009, 64, 22–25. [Google Scholar]
  152. Scheinpflug, H. Untersuchungen über die Gattung Didymosphaeria Fuck. und einige verwandte Gattungen. Berichte Schweiz. Bot. Ges. 1958, 68, 325–385. [Google Scholar]
  153. Fairman, C.E. New or rare Pyrenomycetaceae from western New York. Proc. Rochester Acad. Sci. 1905, 4, 215–224. [Google Scholar]
  154. Hyde, K.D.; Goh, T.K. Fungi on submerged wood in the Riviere St Marie-Louis, The Seychelles. S. Afr. J. Bot. 1998, 64, 330–336. [Google Scholar] [CrossRef]
  155. Hsieh, W.H.; Chen, C.Y.; Wang, C.L. Taiwan Ascomycetes. Pyrenomycetes and Loculoascomycetes; China Graphics: Taichung, Taiwan, 2000; p. 244. [Google Scholar]
  156. Wong, M.K.M.; Hyde, K.D. Diversity of fungi on six species of Gramineae and one species of Cyperaceae in Hong Kong. Mycol. Res. 2001, 105, 1485–1491. [Google Scholar] [CrossRef]
  157. Wang, Y.Z.; Aptroot, A.; Hyde, K.D. Revision of the ascomycete genus Amphisphaeria. Fungal Divers. 2004, 168. [Google Scholar]
  158. Ren, J.; Zeng, C.; Jie, C.Y.; Jiang, Y.L.; Hyde, K.D.; Wang, Y. A new Thai species of Astrosphaeriella (Dothideomycetes, Ascomycota) from submerged wood in freshwater. Sydowia 2013, 65, 33–43. [Google Scholar]
  159. Niranjan, M.; Sarma, V.V. New species and new records of Astrosphaeriellaceae from Andaman Islands, India. Kavaka 2020, 54, 38–42. [Google Scholar] [CrossRef]
  160. San Martin, F.E.; Lavin, P.A. Four species and one new variety of the genus Astrosphaeriella (Dothideales, Melanommataceae) in Mexico. Acta Bot. Mex. 1999, 46, 19–27. [Google Scholar] [CrossRef]
  161. Shen, H.W.; Luo, Z.L.; Bao, D.F.; Luan, S.; Bhat, D.J.; Boonmee, S.; Wang, W.P.; Su, X.J.; Li, Y.X.; Al-Otibi, F.; et al. Morphology and phylogeny reveal new species of Pleosporales from plateau lakes in Yunnan Province, China. Mycosphere 2024, 15, 6439–6524. [Google Scholar] [CrossRef]
  162. Saccardo, P.A. 1. Fungi Singaporenses Bakeriani. 2. Fungi Abellinenses novi. Bull. dell’Orto Bot. Regia Univ. Napoli 1918, 6, 39–73. [Google Scholar]
  163. Abdel-Wahab, M.A.; Jones, E.B.G. Three new marine ascomycetes from driftwood in Australia sand dunes. Mycoscience 2000, 41, 379–388. [Google Scholar] [CrossRef]
  164. Dennis, R.W.G. Fungus Flora of Venezuela and Adjacent Countries; Kew Bulletin Additional Series III; Stationery Office Books: Norwich, UK, 1970; pp. 1–531. [Google Scholar]
  165. Zhao, G.C.; Zhao, R.L. The Higher Microfungi from Forests of Yunnan Province; Yunnan Science and Technology Press: Kunming, China, 2012; pp. 1–572. [Google Scholar]
  166. Cash, E.K. A Record of the Fungi Named by J.B. Ellis (Part 1); United States Department of Agriculture: Beltsville, MD, USA, 1952; Volume 2, pp. 1–165. [Google Scholar]
  167. Patel, U.S.; Pandey, A.K.; Rajak, R.C. Additions to fungi of India. Kavaka 1997, 25, 61–65. [Google Scholar]
  168. Barr, M.E. On the Massariaceae in North America. Mycotaxon 1979, 9, 17–37. [Google Scholar] [CrossRef]
  169. Hawksworth, D.L. A new species of Caryospora from Eugenia in East Africa. Trans. Br. Mycol. 1982, 79, 69–74. [Google Scholar] [CrossRef]
  170. Boise, J.R. New and interesting fungi (Loculoascomycetes) from the Amazon. Acta Amaz. 1984, 14, 49–53. [Google Scholar] [CrossRef]
  171. McKenzie, E.H.C.; Buchanan, P.K.; Johnston, P.R. Checklist of fungi on Nothofagus species in New Zealand. New Zealand J. Bot. 2000, 38, 635–720. [Google Scholar] [CrossRef]
  172. Liu, L.L.; Long, Q.D.; Kang, J.C.; Zhang, X.; Hyde, K.D.; Shen, X.C.; Li, Q.R. Morphology, and phylogeny of Mycopepon. Mycosphere 2018, 9, 779–789. [Google Scholar] [CrossRef]
  173. Matsushima, T. Matsushima Mycological Memoirs No. 2; Matsushima Fungus Collection: Kobe, Japan, 1981; p. 68. [Google Scholar]
  174. Guo, Z.X.; Yu, Z.T. Notes on the genus Pithomyces (Hyphomycetes) from China. Mycotaxon 2007, 85, 241–245. [Google Scholar]
  175. Satya, H.N. A new species of Pithomyces with bulbils. Curr. Sci. 1975, 44, 522–523. [Google Scholar]
  176. Holubová-Jechová, V.; Mercado Sierra, A. Studies on Hyphomycetes from Cuba II. Hyphomycetes from the Isla de la Juventud. Česká Mykologie 1984, 38, 96–120. [Google Scholar] [CrossRef]
  177. Morgan-Jones, G. Notes on hyphomycetes. LIV. Concerning Pithomyces clavisporus, a new species, P. graminicola and P. pavgii. Mycotaxon 1987, 30, 29–37. [Google Scholar] [CrossRef]
  178. Last, F.T.; Deighton, F.C. The non-parasitic microflora on the surfaces of living leaves. Trans. Br. Mycol. Soc. 1965, 31, 143–150. [Google Scholar] [CrossRef]
  179. Gusmão, L.F.P.; Monteiro, J.S.; Castañeda Ruíz, R.F. Gonatophragmiopsis verrucosa gen. & sp. nov. and Pithomyces dimorphosporus sp. nov. from Brazil. Mycotaxon 2017, 132, 565–574. [Google Scholar] [CrossRef]
  180. Narayan, P.; Kamal. New foliicolous hyphomycetes from India. Can. J. Bot. 1986, 64, 201–207. [Google Scholar] [CrossRef]
  181. Turner, P.D. Microorganisms associated with oil palm (Elaeis guineensis Jacq.). Phytopathol. Pap. 1971, 14, 1–58. [Google Scholar]
  182. Pande, A.; Rao, V.G. A Compendium Fungi on Legumes from India; Scientific Publishers: Jodhpur, India, 1998; p. 188. [Google Scholar]
  183. Ellis, M.B. More Dematiaceous Hyphomycetes; Commonwealth Mycological Institute: Surrey, UK, 1976; p. 507. [Google Scholar]
  184. Mena Portales, J.; Mercado Sierra, A. Hyphomycetes of Topes-de-Collantes Cuba I. Holoblastic species. Acta Bot. Hung. 1986, 32, 189–206. [Google Scholar]
  185. Holubová-Jechová, V.; Mercado Sierra, A. Studies on Hyphomycetes from Cuba IV. Dematiaceous Hyphomycetes from the Province Pinar del Rio. Česká Mykol. 1986, 4, 142–164. [Google Scholar] [CrossRef]
  186. Ahmad, S.; Iqbal, S.H.; Khalid, A.N. Fungi of Pakistan; Mycological Society of Pakistan. Department of Botany, University of the Punjab: Lahore, Pakistan, 1997; p. 248. [Google Scholar]
  187. Atkinson, G.F. Some fungi from Alabama. Bull. Cornell Univ. Sci. 1897, 3, 1–50. [Google Scholar]
  188. Rao, N.K.; Manoharachary, C. A new Pithomyces species on leaf litter from A. P., India. Trans. Br. Mycol. Soc. 1988, 91, 349–352. [Google Scholar]
  189. Matsushima, T. Matsushima Mycological Memoirs No. 5; Matsushima Fungus Collection: Kobe, Japan, 1987; p. 100. [Google Scholar]
  190. Kirk, P.M. New or interesting microfungi IX. Dematiaceous Hyphomycetes from Esher Common. Trans. Brit. Mycol. Soc. 1983, 80, 449–467. [Google Scholar] [CrossRef]
  191. Lee, S.; Melnik, V.; Taylor, J.E.; Crous, P.W. Diversity of saprobic hyphomycetes on Proteaceae and Restionaceae from South Africa. Fung. Divers. 2004, 17, 91–114. [Google Scholar]
  192. Filer, J.T.H. A new species of Pteridiospora. Mycologia 1969, 61, 167–169. [Google Scholar] [CrossRef]
  193. Luo, Z.L.; Bao, D.F.; Li, L.L.; Luan, S.; Su, H.Y. Xenoastrosphaeriella aquatica sp. nov. from freshwater habitat in Yunnan Province, China. Phytotaxa 2022, 544, 193–200. [Google Scholar] [CrossRef]
  194. Berkeley, M.J.; Curtis, M.A. Exotic fungi from the Schweinitzian Herbarium, principally from Surinam. J. Acad. Nat. Sci. Phila. 1853, 2, 277–294. [Google Scholar]
  195. Hyde, K.D. Fungi from decaying inter-tidal fronds of Nypa fruticans, including three new genera and four new species. Bot. J. Linn. Soc. 1992, 110, 95–110. [Google Scholar] [CrossRef]
  196. Liew, E.C.Y.; Aptroot, A.; Hyde, K.D. Phylogenetic significance of the pseudoparaphyses in Loculoascomycete taxonomy. Mol. Phylogenet. Evol. 2000, 16, 392–402. [Google Scholar] [CrossRef] [PubMed]
  197. Vohník, M.; Borovec, O.; Kolaříková, Z.; Sudová, R.; Réblová, M. Extensive sampling and high-throughput sequencing reveal Posidoniomyces atricolor gen. et sp. nov. (Aigialaceae, Pleosporales) as the dominant root mycobiont of the dominant Mediterranean seagrass Posidonia oceanica. MycoKeys 2019, 55, 59. [Google Scholar] [CrossRef]
  198. Hyde, K.D.; Norphanphoun, C.; Abreu, V.P.; Bazzicalupo, A.; Chethana, K.W.T.; Clericuzio, M.; Dayarathne, M.C.; Dissanayake, A.J.; Ekanayaka, A.H.; He, M.Q.; et al. Fungal diversity notes 603–708: Taxonomic and phylogenetic notes on genera and species. Fungal Divers. 2017, 87, 1–235. [Google Scholar] [CrossRef]
Figure 2. The phylogram generated from Maximum Likelihood analysis based on combined LSU, SSU, and tef1-α sequence data. The tree is rooted with Delitschia chaetomioides (SMH 3253.2) and D. winteri (AFTOL-ID 1599). The new isolates are in red, and ex-type strains are indicated in bold face. The proposed new combination is indicated in purple. Bootstrap support values ≥ 70% from the Maximum Likelihood (ML) and Bayesian posterior probabilities (BYPP) values ≥ 0.95 are given above the nodes, respectively.
Figure 2. The phylogram generated from Maximum Likelihood analysis based on combined LSU, SSU, and tef1-α sequence data. The tree is rooted with Delitschia chaetomioides (SMH 3253.2) and D. winteri (AFTOL-ID 1599). The new isolates are in red, and ex-type strains are indicated in bold face. The proposed new combination is indicated in purple. Bootstrap support values ≥ 70% from the Maximum Likelihood (ML) and Bayesian posterior probabilities (BYPP) values ≥ 0.95 are given above the nodes, respectively.
Jof 11 00834 g002
Figure 3. Fissuroma caryotae (SZU25-040, new host record). (a,b) Appearance of ascomata on host surface. (c) Vertical section of ascoma. (d) Section through peridium. (e) Pseudoparaphyses. (f) Asci. (gk) Ascospores. (l) Ascospore stained in Indian ink showing a mucilaginous sheath. Scale bars: (c) = 100 μm; (d,gl) = 20 μm; (e,f) = 50 μm.
Figure 3. Fissuroma caryotae (SZU25-040, new host record). (a,b) Appearance of ascomata on host surface. (c) Vertical section of ascoma. (d) Section through peridium. (e) Pseudoparaphyses. (f) Asci. (gk) Ascospores. (l) Ascospore stained in Indian ink showing a mucilaginous sheath. Scale bars: (c) = 100 μm; (d,gl) = 20 μm; (e,f) = 50 μm.
Jof 11 00834 g003
Figure 4. Astrosphaeriella bambusae (SZU25-041, new host record). (a,b) Appearance of ascomata on host surface. (c) Vertical section of ascoma. (d) Section through peridium. (e) Pseudoparaphyses. (f) Ascus. (gk) Ascospores. (l) Germinated ascospore. (m) Colony from above (in PDA). (n) Colony from below (in PDA). Scale bars: (c) = 100 μm; (d) = 15 μm; (e,f) = 80 μm; (gl) = 20 μm.
Figure 4. Astrosphaeriella bambusae (SZU25-041, new host record). (a,b) Appearance of ascomata on host surface. (c) Vertical section of ascoma. (d) Section through peridium. (e) Pseudoparaphyses. (f) Ascus. (gk) Ascospores. (l) Germinated ascospore. (m) Colony from above (in PDA). (n) Colony from below (in PDA). Scale bars: (c) = 100 μm; (d) = 15 μm; (e,f) = 80 μm; (gl) = 20 μm.
Jof 11 00834 g004
Figure 5. Caryospora pruni (SZU25-044, holotype). (a) Appearance of ascomata on host surface. (b) Close-up of ascomata. (c,d) Vertical sections of ascomata. (e) Pseudoparaphyses. (f) Ascus. (gp) Ascospores. (q) Germinated ascospore. (r) Colony from above (in PDA). (s) Colony from below (in PDA). Scale bars: (d) = 100 μm; (e,f) = 50 μm; (gq) = 20 μm.
Figure 5. Caryospora pruni (SZU25-044, holotype). (a) Appearance of ascomata on host surface. (b) Close-up of ascomata. (c,d) Vertical sections of ascomata. (e) Pseudoparaphyses. (f) Ascus. (gp) Ascospores. (q) Germinated ascospore. (r) Colony from above (in PDA). (s) Colony from below (in PDA). Scale bars: (d) = 100 μm; (e,f) = 50 μm; (gq) = 20 μm.
Jof 11 00834 g005
Figure 6. Caryospora quercus (SZU25-042, new host record). (a) Appearance of ascomata on host surface. (b) Close-up of ascomata. (c) Vertical section of ascoma. (d) Section through peridium. (e) Section through ostiole (arrows show periphyses). (f) Pseudoparaphyses. (g,h) Asci. (im) Ascospores (arrows show mucilaginous sheath). Scale bars: (c) = 100 μm; 1 (d) = 5 μm; (e,im) = 20 μm; (fh) = 80 μm.
Figure 6. Caryospora quercus (SZU25-042, new host record). (a) Appearance of ascomata on host surface. (b) Close-up of ascomata. (c) Vertical section of ascoma. (d) Section through peridium. (e) Section through ostiole (arrows show periphyses). (f) Pseudoparaphyses. (g,h) Asci. (im) Ascospores (arrows show mucilaginous sheath). Scale bars: (c) = 100 μm; 1 (d) = 5 μm; (e,im) = 20 μm; (fh) = 80 μm.
Jof 11 00834 g006
Figure 7. Neoastrosphaeriella aquatica (SZU25-047, new host record). (a,b) Appearance of ascomata on host surface. (c) Vertical section of ascoma. (d) Section through peridium. (e) Pseudoparaphyses. (f) Asci. (gi) Ascospores. (j) Ascospore stained in Indian ink showing a mucilaginous sheath. Scale bars: (c) = 100 μm; (d) = 20 μm; (e,f) = 30 μm; (gj) = 15 μm.
Figure 7. Neoastrosphaeriella aquatica (SZU25-047, new host record). (a,b) Appearance of ascomata on host surface. (c) Vertical section of ascoma. (d) Section through peridium. (e) Pseudoparaphyses. (f) Asci. (gi) Ascospores. (j) Ascospore stained in Indian ink showing a mucilaginous sheath. Scale bars: (c) = 100 μm; (d) = 20 μm; (e,f) = 30 μm; (gj) = 15 μm.
Jof 11 00834 g007
Figure 8. Pseudoastrosphaeriella zingiberacearum(SZU25-048, holotype). (a) Appearance of ascomata on host surface. (b,d) Vertical section of ascoma. (c) Section through neck. (e) Section through peridium. (f) Pseudoparaphyses. (gj) Asci. (kp) Ascospores. Scale bars: (b,d) = 200 μm; (c,kp) = 60 μm; (e) = 20 μm; (fj) = 70 μm.
Figure 8. Pseudoastrosphaeriella zingiberacearum(SZU25-048, holotype). (a) Appearance of ascomata on host surface. (b,d) Vertical section of ascoma. (c) Section through neck. (e) Section through peridium. (f) Pseudoparaphyses. (gj) Asci. (kp) Ascospores. Scale bars: (b,d) = 200 μm; (c,kp) = 60 μm; (e) = 20 μm; (fj) = 70 μm.
Jof 11 00834 g008
Figure 9. Distribution of so-far reported species in Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae worldwide. Color gradient shows the number of recorded species from lowest (purple) to highest (maroon) and no records (gray).
Figure 9. Distribution of so-far reported species in Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae worldwide. Color gradient shows the number of recorded species from lowest (purple) to highest (maroon) and no records (gray).
Jof 11 00834 g009
Figure 10. The Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae species distribution through plant host families.
Figure 10. The Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae species distribution through plant host families.
Jof 11 00834 g010
Figure 11. Common Arecaceae species that have reported Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae species. (a) Trachycarpus princeps. (b) Cocos nucifera. (c) Livistona chinensis. (d) Chrysalidocarpus lutescens. (e) Archontophoenix alexandrae. (f) Rhapis Excelsa. (g) Sabal palmetto. (h) Areca catechu. (i) Bismarckia nobilis. (j) Borassus flabellifer. (k) Chamaerops humilis. (l,m) Corypha umbraculifera. (n) Caryota obtusa. (o) Nypa fruticans.
Figure 11. Common Arecaceae species that have reported Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae species. (a) Trachycarpus princeps. (b) Cocos nucifera. (c) Livistona chinensis. (d) Chrysalidocarpus lutescens. (e) Archontophoenix alexandrae. (f) Rhapis Excelsa. (g) Sabal palmetto. (h) Areca catechu. (i) Bismarckia nobilis. (j) Borassus flabellifer. (k) Chamaerops humilis. (l,m) Corypha umbraculifera. (n) Caryota obtusa. (o) Nypa fruticans.
Jof 11 00834 g011
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tennakoon, D.S.; de Silva, N.I.; Xie, N.; Hongsanan, S. Global Diversity, Host Associations, and New Insights into Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae. J. Fungi 2025, 11, 834. https://doi.org/10.3390/jof11120834

AMA Style

Tennakoon DS, de Silva NI, Xie N, Hongsanan S. Global Diversity, Host Associations, and New Insights into Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae. Journal of Fungi. 2025; 11(12):834. https://doi.org/10.3390/jof11120834

Chicago/Turabian Style

Tennakoon, Danushka S., Nimali I. de Silva, Ning Xie, and Sinang Hongsanan. 2025. "Global Diversity, Host Associations, and New Insights into Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae" Journal of Fungi 11, no. 12: 834. https://doi.org/10.3390/jof11120834

APA Style

Tennakoon, D. S., de Silva, N. I., Xie, N., & Hongsanan, S. (2025). Global Diversity, Host Associations, and New Insights into Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae. Journal of Fungi, 11(12), 834. https://doi.org/10.3390/jof11120834

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop