Next Article in Journal
Poly ADP-Ribosylation in a Plant Pathogenic Oomycete Phytophthora infestans: A Key Controller of Growth and Host Plant Colonisation
Next Article in Special Issue
Exploring the Diversity and Ecological Dynamics of Palm Leaf Spotting Fungi—A Case Study on Ornamental Palms in Portugal
Previous Article in Journal
Ophiostomatalean Fungi (Ascomycota, Ophiostomatales) Associated with Three Beetles from Pinus sylvestris var. mongolica in Heilongjiang, China
Previous Article in Special Issue
New Species of Diaporthales (Ascomycota) from Diseased Leaves in Fujian Province, China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Phylogenetics and Estimation of Evolutionary Divergence and Biogeography of the Family Cordycipitaceae (Ascomycota, Hypocreales)

1
State Key Laboratory of Ecological Pest Control for Fujian and Taiwan Crops, College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
Department of Biological Sciences, University of Illinois, Chicago, IL 60607, USA
3
XiangYa School of Public Health, Central South University, Changsha 410013, China
4
Bureau of Fujian Junzifeng National Nature Reserve, Sanming 365200, China
5
Bureau of Fujian Longqishan National Nature Reserve, Sanming 353300, China
6
Guangxi Institute of Botany, Chinese Academy of Sciences, Guilin 541006, China
7
College of Plant Protection, Gansu Agricultural University, Lanzhou 730070, China
8
College of Life Science and Technology, Xinjiang University, Urumqi 830046, China
9
Putian Institute of Agricultural Sciences, Putian 351106, China
*
Authors to whom correspondence should be addressed.
J. Fungi 2025, 11(1), 28; https://doi.org/10.3390/jof11010028
Submission received: 5 December 2024 / Revised: 30 December 2024 / Accepted: 31 December 2024 / Published: 2 January 2025
(This article belongs to the Special Issue Diversity of Microscopic Fungi)

Abstract

The Cordycipitaceae family of insecticidal fungi is widely distributed in nature, is the most complex in the order Hypocreales (Ascomycota), with members displaying a diversity of morphological characteristics and insect host ranges. Based on Bayesian evolutionary analysis of five genomic loci(the small subunit of ribosomal RNA (SSU) gene, the large subunit of ribosomal RNA (LSU) gene, the translation elongation factor 1-α (tef1-α) gene, the largest subunit of RNA polymerase II (rpb1), and the second largest subunit of RNA polymerase II (rpb2), we inferred the divergence times for members of the Cordycipitaceae, improving the internal phylogeny of this fungal family. Molecular clock analyses indicate that the ancestor of Akanthomyces sensu lato occurred in the Paleogene period (34.57 Mya, 95% HPD: 31.41–37.67 Mya), and that most species appeared in the Neogene period. The historical biogeography of Akanthomyces sensu lato was reconstructed using reconstructing ancestral state in phylogenies (RASP) analysis, indicating that it most likely originated in Asia. Combined morphological characterization and phylogenetic analyses were used to identify and taxonomically place five species within Cordycipitaceae. These include the following: (i) two new species, namely Akanthomyces baishanensis sp. nov. and Samsoniella sanmingense sp. nov., (ii) a new record species isolated from infected Lepidopteran host, Blackwellomyces lateris, (iii) a new record species in the genus Niveomyces, with sporothrix-like asexual morphs, namely N. multisynnematus, isolated from dipteran insects (flies), and (iv) a known species of the (hyper-) mycoparasite, Liangia sinensis, isolated from the fungus Ophiocordyceps globiceps (Ophiocordycipitaceae) growing on a dipteran host. Our data provide a significant addition to the diversity, ecology, and evolutionary aspects of the Cordycipitaceae.

1. Introduction

The Cordycipitaceae family of parasitic fungi is one of the most complex and diverse taxa in the order Hypocreales (Ascomycota). These fungi are well known pathogens of a wide range of insects and are often morphologically characterized by pale to brightly colored stromata with entirely or partly immersed or superficial perithecia [1,2]. In addition, three types of ascospores have been described for these fungi, namely disarticulating, intact, and bola [3]. The taxonomy of the family Cordycipitaceae is continually being updated with the recognition and incorporation of new genera, e.g., Arachnidicola [4], Bhushaniella [5], Corniculantispora [4], Jenniferia [6], Pseudoniveomyces [7], and Niveomyces [7], leading to revisions to phylogenetic classification. More than 100 species have been described thus far, which display diverse morphological characteristics, insect host ranges, and trophic levels, e.g., leaf litter, bark, decaying logs, plant stems, and soil, that match host environmental niches, including those found underground. Hosts for these fungi range across most insect orders (e.g., Hemiptera, Hymenoptera, Lepidoptera, Coleoptera, Diptera, and Orthoptera) and even across Arthropoda to spiders and mites [2,8,9]. Some species of Cordycipitaceae are highly prized, with significant economic value, and are harvested for use in (traditional) medicinal and health-related products. Metabolites from these fungi, e.g., cordycepin and other compounds from Cordyceps militaris, have been shown to possess a range of antiviral, antibacterial, antioxidant, antiproliferative, and/or immunomodulatory pharmacological activities [10,11,12]. In addition to medicinal value, some species have been commercialized for use in pest control applications relevant to agriculture, forestry, and human health, e.g., species within the Beauveria, Metarhizium, Isaria, and Cordyceps genera [13,14,15,16].
Samsoniella is a genus of invertebratepathogenic fungi within the Cordycipitaceae. Sexual morphs of Samsoniella are known for their bright red–orange stromata and longitudinal ditch on the side of the fertile part [2,17]. However, in some instances, members assigned to the genus are similar to Akanthomyces sensu lato (s.l.) speciesin micro-morphological characteristics [18]. Species within Samsoniella mainly parasitize Lepidoptera larvae or pupae (butterflies and moths) in soil or leaf litter, and can be developed into biological control agents against a variety of pests; however, their fruiting bodies are also highly prized as having important (traditional) medicinal value, especially in Asian cultures [19]. To clarify the phylogenetic diversity of Isaria-like species, Mongkolsamrit et al., based on molecular phylogenetic analysis of five different loci (ITS, 28S rDNA, tef1-α, rpb1, and rpb2), assigned Samsoniella to a group of members possessing Cordyceps-like sexual morphs and Isaria-like asexual morphs [17]. Subsequently, recessive intraspecific diversity among different isolates and genotypes of Isaria-like species has been characterized, leading to revisions in the systematic positions of many Isaria-like species within the Cordycipitaceae family [2,20]. For example, Paecilomyces hepiali (previously classified within Isaria-like species) has been transferred into Samsoniella, and renamed S. hepiali [2]. In addition, nine new species within Samsoniella, namely S. alpina, S. antleroides, S. cardinalis, S. cristata, S. lanmaoa, S. kunmingensis, S. ramosa, S. tortricidae, and S. yunnanensis, were described. New species of Samsoniella continue to be found in forest habitats and karst ecological environments in different provinces of China [9,21].
The genus Akanthomyces was established by Lebert in 1858, with Akanthomyces aculeatus as the type species. Kepler et al. [22] conducted a molecular phylogenetic study of Cordycipitaceae using multi-gene sequence data and revising the systematic position of some taxa of the family (such as transferring Isaria species into Cordyceps), and suggested that nine genera should be included in Cordycipitaceae. Moreover, they found that some species of the genus Akanthomyces and Cordyceps could not be included in the family, with a new genus, Hevansia (Luangsaard, Hywel-Jones and Spatafora) established to accommodate excluded species. Recently, based on multi-locus phylogenetic analysis of LSU, tef1-α, rpb1, and rpb2 sequences, Khonsanit et al. [4] proposed that Akanthomyces s.l. should consist of four monophyletic groups, including Akanthomyces, Arachnidicola, Lecanicillium, and Kanoksria. To accommodate Akanthomyces species that exhibit Lecanicillium-like asexual morphs, it is recommended to resurrect the Lecanicillium genus.
The genus Liangia often displays Lecanicillium-like asexual characteristics. It was isolated by Yu et al. and currently contains only one species, Liangia sinensis [2]. Recently, the genus Niveomyces (Cordycipitaceae, Hypocreales) was isolated by Araújo, J. P. M. and de Bekker, C. [23] with N. coronatus as the type species. Members of the Niveomyces directly produce multiple synnemata on host tissue or subiculum, and the host is usually covered with a white to cream-colored mycelium [7]. The asexual morph is characterized by hyaline, smooth oval to cylindrical conidia with rounded ends, and scattered, denticulate conidiogenous cells arising directly from the hyphae or from synnemata [7,23]. Currently, Niveomyces consists of six species: N. albus, N. coronatus, N. formicidarum, N. hirsutellae, N. insectorum, and N. multisynnematus.
Despite their ubiquity, important aspects of the species diversity, taxonomic status, and phylogenetic relationships within Cordycipitaceae remain to be clarified. During an exploration aimed at delineating the diversity and geographical distribution of entomopathogenic fungi in China, a series of intriguing specimens were collected in the Fujian and Jilin Provinces, China. These isolates were characterized via molecular sequencing of five genomic loci, and phylogenetic reconstrcution was used to clarify their taxonomic placement within Cordycipitaceae. With these data, combined with morphological characterization, we report the description of two new species, two new record species, and one known species, which are illustrated and described in detail. Concurrently, we utilized Paleoophiocordyceps coccophagus (G. H. Sung, Poinar and Spatafora) as a fossil calibration for molecular clock analysis to infer the divergence times of members of Cordycipitaceae, increasing our understanding of the phylogeny, origin, and evolutionary history of this family.

2. Materials and Methods

2.1. Sampling, Fungal Isolation, and Morphology

Entomopathogenic fungi were surveyed in Fujian and Jilin Province, China. Purification of single spore colonies of putative new species was isolated as described [7]. Images of the fresh specimens were captured using a Canon (Tokyo, Japan) EOS 6D Mark II camera. Briefly, fungal cultures were isolated from fresh conidia or mycelia of insect cadavers using sterile needles and staking onto potato dextrose agar (PDA). Plates were incubated at 25 °C and 60% relative humidity (RH) for 5–14 d. Nine fungal specimens were isolated in total.
Purified fungal cultures were transferred to PDA plates and incubated for 14 d. A digital camera was used to take photos of the colonies for measurement of colony diameters. A lactophenol cotton blue solution was used as the medium for microscope observation, and the fresh structure of the pure cultures was put into the solution for microphotography [2]. The micro-morphological structure of the purified isolates was observed using a Nikon Ni-U compound microscope and via scanning electron microscopy (SEM, Nikon Ni-U; HITACHI SU3500, Tokyo, Japan). Measurements on images were performed using Digimizer 5.4.4 software. All cultures were stored in 10% sterilized glycerin and sterile water at 4 °C for future studies. The dried specimens and living cultures were deposited in the Herbarium Mycologicum Academiae Sinicae, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China (HMAS), and the China General Microbiological Culture Collection Center (CGMCC).

2.2. DNA Extraction and PCR Amplification

Total genomic DNA was extracted from fungal colonies grown on PDA plates using the Fungal DNA Mini Kit (OMEGA–D3390, Feiyang Biological Engineering Corporation, Guangzhou, China) following the manufacturer’s recommendations. Nucleotide sequences were obtained from five genomic loci, including the small and large subunits of nuclear encoded ribosomal DNA genes (SSU and LSU), the translation elongation factor 1α (tef1-α), and the largest and second largest subunits of RNA polymerase II (rpb1 and rpb2). The following primer sets were utilized to amplify various genetic markers via polymerase chain reaction (PCR): nrSSU-CoF/nrSSU-CoR for SSU [24], LR0R/LR5 for LSU [25,26], EF1α-EF/EF1α-ER for tef1-α [27], RPB1-Ac/RPB1-Cr for rpb1 [28,29], and fRPB2-5F/fRPB2-7cR for rpb2 [30], as previously described [1]. Primer sequences and annealing temperatures of different primers were noted in Table 1. Polymerase chain reaction (PCR) was performed in 25 μL volumes consisting of 12.5 µL of 2 × Rapid Taq Master Mix (Vazyme, Nanjing, China), 1 µL of each forward and reverse primer (10 µM) (Sangon, Shanghai, China), 1 µL of genomic DNA, and 9.5 µL of sterilized distilled water. The PCR amplicons were sent to Tsingke Biotech Co., Ltd. (Fuzhou, China) for purification and Sanger sequencing. New sequences generated in this study have been deposited in GenBank (www.ncbi.nlm.nih.gov/genbank/, accessed on 8 January 2024).

2.3. Sequence Alignment and Phylogenetic Analyses

Reference sequences for the phylogenetic analysis were downloaded from NCBI (National Center for Biotechnology Information), based on BLAST search results in NCBI and in conjunction with the relevant literature (Table 2) [2,7,23,31,32,33]. Each locus was individually aligned using the MAFFT v.7.11 online tool, followed by trimming the consensus sequences from the different primers in MEGA 7.0 software. The concatenated aligned dataset was used for multi-locus phylogenetic analysis using maximum likelihood (ML) and Bayesian inference (BI) methods. The ML was run on IQtree 1.6.8 [34], available on the Phylosuite software v1.2.3 (https://dongzhang0725.github.io/, accessed on 3 September 2024), with the model being automatically selected and bootstrap iterations set to 1000.BI analysis was performed with MrBayes 3.2.6 [35], and the best evolutionary model was decided under the Akaike Information Criterion (AIC) via PartitionFinder2, in which the first 1/4 of the trees were discarded as burn-in trees, and four parallel Markov Chain Monte Carlo chains sampled every 100 steps for 2,000,000 generations, until the average standard deviation reached 0.01. The phylogenetic trees were visualized using the Interactive Tree of Life (iTOL, https://itol.embl.de, accessed on 6 July 2024) online tool [36], and edited with Adobe Illustrator CS 6.0 (Adobe Systems Inc., San Jose, CA, USA).

2.4. Divergence Time Estimation

Based on the SSU, LSU, tef-1α, rpb1, and rpb2 concatenated sequence dataset derived from 119 specimens, the divergence times of Akanthomyces s.l. and other members of the Cordycipitaceae species were inferred, as described [37,38]. Each partition was divided by MrModeltest v 2.3, and the GTR + G + I substitution model was selected as the best-fit model. A relaxed clock log normal model was used for BEAST [39,40,41]. In divergence time estimation, a fungal parasite P. cocophagus from a Cretaceous period (99–105 Mya) scale insect was used as the fossil calibration, and the fossil node calibration was calibrated using the gamma prior distribution [37,42]. The XML (Extensible Markup Language) file generated by BEAUti (version 2) was then executed in BEAST. A relaxed clock log normal model was used for BEAST. Four independent MCMC chains of 100 million generations were conducted and logging parameters were sampled every 10,000 generations. The resulting log file was checked for convergence using the program Tracer v.1.6 (http://tree.bio.ed.ac.uk/software/tracer/, accessed on 19 August 2024; ESS ≥ 200 was considered convergence). When ESS ≥ 200, a maximum clade tree was created in TreeAnnotator v. 2.6.7, where the first 10% of trees were discarded as burn-in trees. The final tree was edited using the tvBOT online program (https://www.chiplot.online/tvbot.html, accessed on 30 October 2024) [43].

2.5. Inferring Historical Biogeography

We used the Reconstruct Ancestral State in Phylogenies (RASPv.4.3) software package to infer the historical biogeography of Akanthomyces sensu lato, by reconstructing the ancestral geographical distribution on the phylogenetic tree [44,45]. In the reconstruction work, the Bayesian Binary Markov chain Monte Carlo (BBM) method provided in RASP (version 4.3) was used for analysis with 10 million generations [46]. The first 10% of trees were discarded as burn-in trees and the other parameters remained the default settings. Statistically, the geographic distributions of Akanthomyces s.l. were identified in five areas: (A) Asia, (B) North America, (C) South America, (D) Europe, and (E) Africa.

3. Results

3.1. Phylogenetic Analyses

The molecular analyses and morphological comparisons presented herein indicate that the Fujian and Jilin Province specimens collected belong to Cordycipitaceae and group within the Liangia, Niveomyces, and Samsoniella genera. Two new species (Akanthomyces baishanensis sp. nov. and Samsoniella sanmingense sp. nov.), two new record species (Blackwellomyces lateris and Niveomyces multisynnematus) and one known species (Liangia sinensis) are described, and their phylogenetic placements determined below (Table 2, Figure 1).
Phylogenetic analyses were based on the concatenated nucleotide sequence dataset derived from the SSU, LSU, tef–1α, rpb1, and rpb2 gene loci, and were examined across 29 taxa representing 235 sequences within Cordycipitaceae, which included Trichoderma (T. deliquescens ATCC 208838 and T. stercorarium ATCC 62321) as the outgroup as detailed in the Materials and Methods section (Table 2, Figure 1). The combined dataset consisted of 4473 characters (i.e., SSU: 1–1002 bp, LSU: 1003–1734 bp, tef1-α: 1735–2768 bp, rpb1: 2769–3455 bp, and rpb2: 3456–4473 bp), 2593 of whichwere constant, and 2450 distinct patterns, 355 singleton sites, and 1525 parsimony-informative sites were identified. The best substitution model for BI analysis included SYM + I + G4 for SSU, SYM + G4 for rpb2,and GTR+F+I+G4 for LSU, tef1-α, and rpb1, resulting in an average standard deviation of split frequencies = 0.007254. For ML and BI phylogenetic analyses, the inferred topologies were largely consistent across most branches, with Ak. baishanensis, B. lateris, L. sinensis, N. multisynnematus, and S. sanmingense found to be distributed within distinct clades with strong support.

3.2. Dating and Evolutionary Analyses of Akanthomyces s.l. in Cordycipitaceae

To explore the evolution, origin, and evolutionary history of the internal systematics of Akanthomyces s.l., all species of Akanthomyces s.l. and other members of Cordycipitaceae were selected for study based on previous phylogenetic research. These analyses confirmed that the Cordycipitaceae diverged from the early Cretaceous period [37,38] (Figure 2). These analyses further indicate that the divergence time estimate shows that most species within Akanthomyces s.l. appeared later than other genera of Cordycipitaceae, with a mean stem age of 34.57 Mya (95% highest posterior density (HPD) of 31.41–37.67 Mya, 1.0 PP), and a mean crown age of 29.32 Mya (95% HPD of 26.68–31.97 Mya, 1.0 PP), and that in Cordycipitaceae, the initial diversification of Akanthomyces s.l. occurred during the Paleogene period (Figure 2, Table 3). The subsequent divergence of most species within Akanthomyces s.l. occurred mainly during the Neogene period.

3.3. The Historical Biogeography of Akanthomyces s.l.

Historical biogeographic scenarios for Akanthomyces s.l. were inferred using RASP, as detailed in the Methods section (Figure 3). The results of BBM analysis indicate that Akanthomyces s.l. has a complex biogeographical history, with at least 13 dispersal events and four vicariance events determining the current distribution of the genus. This analysis supports the finding that Asia has the highest probability of being the ancestral area of Akanthomyces s.l., with 31 species currently found in Asia, three in North America, four each in South America and Europe, and one in Africa, suggesting that Asia is still the center of Akanthomyces s.l. diversification.

3.4. Taxonomy

3.4.1. Akanthomyces baishanensis sp. nov., Pu, H.L. and Qiu, J.Z., Figure 4c

MycoBank Number: MB852386
Etymology: Named after the location where the type specimen was found, Baishan City, Jilin Province.
Figure 4. Akanthomyces baishanensis (HMAS 298137). (a,b) Fungus on adult moth. (ce) Close-up of stromata. (f) Perithecia. (g,h) Ascus. (i,j) Ascus tip. (k,l) Part of asci showing ascospores. (m) Upper and reverse view of colony after incubation for 14 days on PDA. (ns) Conidiogenous cells (conidiophores and phialides). (tw) Conidia. Scale bars: (f,g) 100 µm; (hl,nu) 10 µm; (vw) 5 µm.
Figure 4. Akanthomyces baishanensis (HMAS 298137). (a,b) Fungus on adult moth. (ce) Close-up of stromata. (f) Perithecia. (g,h) Ascus. (i,j) Ascus tip. (k,l) Part of asci showing ascospores. (m) Upper and reverse view of colony after incubation for 14 days on PDA. (ns) Conidiogenous cells (conidiophores and phialides). (tw) Conidia. Scale bars: (f,g) 100 µm; (hl,nu) 10 µm; (vw) 5 µm.
Jof 11 00028 g004
Holotype: China, Jilin Province, Baishan City, 127°56′57.6″ E, 42°32′28.7″ N, on adult moth (Noctuidae, Lepidoptera), 4 September 2023, holotype HMAS 298137; ex-holotype living culture CGMCC3.25673.
Description: Adult moth attached to a plant stem partially covered by white to cream mycelium. Stromata arising from host body and wing veins, non-stipitate. Perithecia superficial, orange to light brown, growing directly from mycelium that covers the host body, ovoid, 573–658 × 293–479 µm. Asci cylindrical and hyaline, up to 150–229 × 4.2–5.0 μm, with a hemispheric apical cap of 3.7–4.7 × 3.8–4.4 µm. Ascospores hyaline, filiform, and multiseptate, 5.3–13.9 × 1.3–1.5 μm. Asexual morph not observed.
Culture characteristics: Colonies on PDA slow growing, up to 19–22 mm diameter in 14 days at 25 °C, growth rate 1.4–1.6 mm/day, white and cottony, growing in a circular pattern with entire margins, and closely appressed to the agar surface, reverse pale yellow, and turns white outward. Conidiophores mononematous hyaline and smooth-walled. Phialides hyaline, smooth, and consisting of a cylindrical, slightly inflated base, tapering to a thin neck, 8.7–26.5 × 1.7–2.7 μm, mean = 17 × 2.3 μm. Conidia in chains, smooth, hyaline, and fusiform to ellipsoidal, exists at the apex of phialides, 3.8–5.3 × 2.4–3.6 μm, mean ± SD = 4.7 ± 0.4 × 3.0 ± 0.3 μm, L/W ratio = 1.6, n = 30.
Material examined: China, Jilin Province, Baishan City, 127°56′57.6″ E, 42°32′28.7″ N, on adult moth (Noctuidae, Lepidoptera), 4 September 2023, paratype HMAS 298138; ex-paratype living culture CGMCC3.25674.
Notes: Akanthomyces baishanensis was easily identified as belonging to Akanthomyces based on the phylogenetic analyses. The new species Ak. baishanensis forms an independent clade and was phylogenetically distinct from Ak. phariformis, with strong support value (100% ML/1 PP, Figure 1). The nucleotide comparison of LSU sequences of Ak. phariformis revealed 6 bp (6/811 bp, 0.7%) nucleotide differences. The nucleotide comparison of tef1-α sequences of Ak. phariformis revealed 18 bp (18/900 bp, 2.0%) nucleotide differences. The nucleotide comparison of rpb2 sequences of Ak. phariformis revealed 22 bp (22/822 bp, 2.7%) nucleotide differences. In morphology, this species differs from Ak. phariformis by producing crowded superficial perithecia at the host body and wing veins, while Ak. phariformis produces perithecia at the apex of synnemata. The perithecia of Ak. baishanensis are longer and wider than those of Ak. phariformis (573–658 × 293–479 vs. 360–550 × 200–260 μm). Ecologically, Ak. baishanensis is found in northern China (temperate), while Ak. phariformis is found in northern Thailand (tropical). In addition, we observed the conidia and reproductive structures of Ak. baishanensis on PDA, while Ak. phariformis has not been described thus far. Therefore, we describe this fungus as a new species.

3.4.2. Samsoniella sanmingense sp. nov., Pu, H.L. and Qiu, J.Z. Figure 5

MycoBank Number: MB852399
Etymology: Named after the location where the type specimen was found, Sanming City, Fujian Province.
Figure 5. Samsoniella sanmingense (HMAS 352694). (a,b) Larva of Lepidoptera infected by S. sanmingense. (c) Close-up of synnemata. (d) Upper and reverse view of colony after incubation for 14 days on PDA. (el) Conidiogenous cells (conidiophores and phialides). (mq) Conidia. Scale bars: (em,o) 10 µm; (n,p,q) 5 µm.
Figure 5. Samsoniella sanmingense (HMAS 352694). (a,b) Larva of Lepidoptera infected by S. sanmingense. (c) Close-up of synnemata. (d) Upper and reverse view of colony after incubation for 14 days on PDA. (el) Conidiogenous cells (conidiophores and phialides). (mq) Conidia. Scale bars: (em,o) 10 µm; (n,p,q) 5 µm.
Jof 11 00028 g005
Holotype: China, Fujian Province, Sanming City, Mingxi County, Xiafang Town, Zhushe Village, 117°1′59.6″ E,26°33′53.6″ N, on the larvae of Lepidoptera buried in soil, 26 April 2023, holotype HMAS 352694; ex-holotype living culture CGMCC3.25662.
Description: Host covered by white to cream-colored and cottony mycelium. Conidiophores produced on prostrate aerial hyphae, smooth-walled, with a single phialide or whorls of two to five phialides, or Verticillium-like from hyphae directly, 4.9–10.9 × 2.4–3.1 μm, mean = 6.7 × 2.7 μm. Phialides smooth-walled, with a cylindrical basal portion, tapering gradually or abruptly toward the apex into a distinct neck, 4.5–11.4 × 1.9–2.6 μm, mean = 7.1 × 2.2 μm. Conidia in chains, hyaline, oblong, elliptical, or fusiform, 2.4–3.7 × 1.8–2.6 μm, mean ± SD = 3.1 ± 0.3 × 2.2 ± 0.2 μm, L/W ratio = 1.4, n = 30. Sexual morph not observed.
Culture characteristics: Colonies on PDA moderately fast-growing, 32–34 mm diameter in 14 days at 25 °C, growth rate 2.3–2.4 mm/day, white and cottony, floccose, consisting of a basal felt with high mycelium density, and reverse pale yellow.
Material examined: Fujian Province, Sanming City, Junzifeng National Nature Reserve, 117°2′1.4″ E, 26°33′53.6″ N, on the pupae of Lepidoptera clinging to fallen leaves, 26 April 2023, paratype HMAS 352693; ex-paratype living culture CGMCC3.25661.
Notes: Based on the sequences of the characterized SSU, LSU, tef–1α, rpb1, and rpb2 genes, phylogenetic analyses revealed the isolate as belonging to the Samsoniella genus. However, S. sanmingense formed a separate subclade distinct from the other species within Samsoniella, with moderate 98% ML bootstrap support and 1 posterior probability (Figure 1).The pairwise dissimilarities of tef1-α sequences show 14 bp difference within 924 bp between S. sanmingense and S. tiankengensis. Our morphological studies show that S. sanmingense has different phialides and conidial strcutures from S. tiankengensis. The conidia of S. sanmingense are larger than those of S. tiankengensis (2.4–3.7 × 1.8–2.6 µm vs. 2.3–2.8 × 1.6–1.8 µm), and the phialides are also broader than those of S. tiankengensis (4.5–11.4 × 1.9–2.6 µm vs. 5.4–10.4 × 1.3–2.2 µm). Therefore, we describe this fungus as a new species.

3.4.3. Blackwellomyces lateris Xiao, Y.P.; Wen, T.C.; Hyde, K.D. Fungal Diversity 2019, 96, 1–242 [47]; Figure 6

Description: See Hyde et al. [47]. Host covered by white to cream-colored and cottony mycelium. Conidiophores usually arising from aerial hyphae, with a single phialide or whorls of two to four phialides, 7.0–29.1 × 1.8–2.6, mean = 12.5 × 2.4 μm. Phialides 7.9–26.3 × 1.8–3.4 μm, mean = 12.7 × 2.6 μm, smooth-walled, swollen at the base or slightly flask-shaped, and then tapering to a thin neck. Conidial arrangement Evlachovaea-like. Conidia smooth and hyaline, oblong-elliptical, 3.9–6.1 × 2.0–2.5 μm, mean ± SD =4.5 ± 0.4 × 2.3 ± 0.1 μm, L/W ratio = 2.0, n = 30. Sexual morph not observed.
Figure 6. Blackwellomyces lateris (HMAS 352953). (a) Larvae of Lepidoptera infected by B. lateris. (b,c) Close-up of specimen. (d) Upper and reverse view of colony after incubation for 14 days on PDA. (ej) Conidiogenous cells (conidiophores and phialides). (km) Conidia. Scale bars: (em) 10 µm.
Figure 6. Blackwellomyces lateris (HMAS 352953). (a) Larvae of Lepidoptera infected by B. lateris. (b,c) Close-up of specimen. (d) Upper and reverse view of colony after incubation for 14 days on PDA. (ej) Conidiogenous cells (conidiophores and phialides). (km) Conidia. Scale bars: (em) 10 µm.
Jof 11 00028 g006
Culture characteristics: Colonies on PDA moderately fast-growing, 24 mm diameter in 14 days at 25 °C, growth rate 1.7 mm/day, white mycelium, cottony with low mycelium density, and producing yellowish–brown pigment diffusing in the medium.
Material examined: China, Fujian Province, Sanming City, Mingxi County, Xiayang Township, 117°27′33″ E, 26°20′46″ N, on the larvae of Lepidoptera buried in soil, 30 August 2023, paratype HMAS 352953;ex-paratype living culture CGMCC3.27468.
Notes: Blackwellomyces lateris was originally described in Lepidoptera larvae in Thailand, Chiang Mai Province [47]. The strain identified as B. lateris (CGMCC3.27468) in the present study was also isolated from Lepidoptera larvae. Phylogenetic analysis showed that strain CGMCC3.27468 formed a branch sister to B. lateris (MFLU 18-0663/MRC170617) with relatively strong statistical support (100% ML/1 PP, Figure 1). CGMCC3.25363 was similar to the latter in SSU (with 99.90% sequence identity), LSU (99.87%), tef1-α (100%), rpb1 (99.70%), and rpb2 (99.91%) sequences. Therefore, we identified this fungus as B. lateris, marking the first record of B. lateris in China.

3.4.4. Liangia sinensis, Yu, H.; Wang, Y.B.; Wang, Y.; Fan, Q.; Yang, Z.L. Fungal Diversity 2020, 103, 1–46 [2]; Figure 7

Description: Lecanicillium-like. Strains isolated from the stromata (i.e., hyper-parasitic) of Ophiocordyceps globiceps (Ophiocordycipitaceae, Hypocreales) infecting a fly (Diptera). Hyphae hyaline, septate, branched, smooth-walled, and 1.4–1.9 µm wide. Phialides lanceolate, occurring directly from the prostrate hyphae, solitary, and gradually attenuated toward the apex, 13.8–30.6 × 1.1–1.8 μm, mean = 21.5 × 1.4 μm. Two conidia types, hyaline, smooth-walled, with macro- and microconidia, aseptate, both existing alone or in pairs at the apex of phialides. Macroconidia oblong–oval to fusiform, 7.2–11.1 × 1.2–1.7 µm, mean ± SD = 8.7 ± 1.0 ×1.5 ± 0.1 μm, L/W ratio = 5.8, n = 30. Microconidia oval to oblong, 3.2–5.5 × 1.1–1.9 μm, mean ± SD = 4.4 ± 0.5 ×1.4 ± 0.2 μm, L/W ratio = 3.1, n = 30. Sexual morph not observed.
Figure 7. Liangia sinensis (HMAS 352686). (ac) Stromata of Ophiocordyceps globiceps arising from fly (Muscidae, Diptera) clinging to decaying wood, from which L. muscidarum was isolated. (d) Upper and reverse view of colony after incubation for 14 days on PDA. (ek) Conidiogenous cells (conidiophores and phialides). (ln) Conidia. Scale bars: (en) 10 µm.
Figure 7. Liangia sinensis (HMAS 352686). (ac) Stromata of Ophiocordyceps globiceps arising from fly (Muscidae, Diptera) clinging to decaying wood, from which L. muscidarum was isolated. (d) Upper and reverse view of colony after incubation for 14 days on PDA. (ek) Conidiogenous cells (conidiophores and phialides). (ln) Conidia. Scale bars: (en) 10 µm.
Jof 11 00028 g007
Culture characteristics: Colonies on PDA slow-growing, 21–25 mm in diameter after 14 days at 25 °C, growth rate 1.5–1.8 mm/day, white and cottony, consisting of a basal felt, with slightly raised mycelial density at the centre.
Material examined: China, Jilin Province, Baishan City, 127°59′44.3″ E, 42°33′48.8″ N, on Ophiocordyceps globiceps on fly (Muscidae, Diptera) clinging to decaying wood, 2 September 2023, paratype HMAS 352686; ex-paratype living culture CGMCC3.25667.Ibid., paratype HMAS 298129; ex-paratype living culture CGMCC3.27196.
Notes: Wang et al. reported Liangia sinensis isolated from the entomopathogenic fungus Beauveria yunnanensis as the type species of the genus Liangia [2]. At present, the sexual morph of this genus has not been determined. Phylogenetic analysis of five genes showed that two strains (CGMCC3.25667 and CGMCC3.27196) tightly cluster with L. sinensis in the combined phylogenetic tree (Figure 1). Strain characteristics were very closely linked to L. sinensis, which also shows two types of conidia (macroconidia: 7.2–11.1 × 1.2–1.7 µm vs. 4.5–9.3 × 1.2–1.9 µm; microconidia: 3.2–5.5 × 1.1–1.9 μm vs. 1.8–3.3 × 1.1–1.8 µm) and a phialide (13.8–30.6 × 1.1–1.8 μm vs. 16.7–59.0 × 0.7–1.6 μm). Additionally, CGMCC3.25667 and CGMCC3.27196 were highly similar to L. sinensis in SSU (with 100% sequence identity), LSU (99.63%), tef–1α (99.89%), rpb1 (99.56%), and rpb2 (99.79%) sequences. Notably, isolates CGMCC3.27196 and CGMCC3.27197 were found parasitizing the stromata of Beauveria yunnanensis associated with Lepidoptera pupa, whereas Liangia sinensis (YFCC 3103 and YFCC 3104) was found on an Ophiocordyceps globiceps-infected dipteran host. The results of our study show that the L. sinensis can be isolated from different hosts.

3.4.5. Niveomyces multisynnematus Tasanathai, Noisripoom and Kobmoo, Fungal Systematics and Evolution 2023, 12, 91–110 [7]; Figure 8

Description: White and cottony mycelium forming on the stromata (i.e., hyper-parasitic) of Ophiocordyceps sp. (Ophiocordycipitaceae, Hypocreales), with multiple protuberances on the surface of the apex of the stromata. Synnemata simple, indeterminate, cylindrical, curved, 2–3 mm long, and 25–60 µm wide. Hyphae septate, hyaline, smooth-walled, irregularly branched, and 1.8–2.6 µm wide. Conidiogenous cells arising directly from the hyphae cylindrical, sometimes capitate, and bearing an irregularly geniculate rachis, 8.3–44.3 × 1.0–2.2 µm, mean = 27.4 × 1.5 μm. Conidia hyaline, aseptate, smooth-walled, oblong to fusiform with rounded ends and an apiculus, exists on the denticles of conidiogenous cells, 3.0–5.3 × 1.4–2.2 μm, mean ± SD = 4.6 ± 0.5 ×2.0 ± 0.2 μm, L/W ratio = 2.3, n = 50. Sexual morph not observed.
Figure 8. Niveomyces multisynnematus (HMAS 352684). (a) N. multisynnematus growing on Ophiocordyceps sp. (b,c) Close-up of synnemata. (dh) Conidiogenous cells. (i,j) Conidia. (k) Upper and reverse view of colony after incubation for 14 days on PDA.Scale bars: (dj) 10 µm.
Figure 8. Niveomyces multisynnematus (HMAS 352684). (a) N. multisynnematus growing on Ophiocordyceps sp. (b,c) Close-up of synnemata. (dh) Conidiogenous cells. (i,j) Conidia. (k) Upper and reverse view of colony after incubation for 14 days on PDA.Scale bars: (dj) 10 µm.
Jof 11 00028 g008
Culture characteristics: Colonies on PDA slow-growing, 18–23 mm in diameter after 14 days at 25 °C, growth rate 1.3–1.6 mm/day, white and cottony, medium density, slightly raised, consisting of a basal felt, and the reverse colony gradually shifted from white to light yellow over time.
Material examined: China, Jilin Province, Baishan City, 127°59′59.3″ E, 42°33′58.1″ N, on Ophiocordyceps sp. on fly (Muscidae, Diptera)clinging to decaying wood, 2 September 2023, paratype HMAS 352685; ex-paratype living culture CGMCC3.25670.Ibid., paratype HMAS 352684; ex-paratype living culture CGMCC3.25672.
Notes: Niveomyces multisynnematus was originally found on leafhoppers (Hemiptera) on the underside of leaves in Thailand. Our multi-locus phylogenetic analyses indicate that strains CGMCC3.25670 and CGMCC3.25672fall within Niveomyces, clustering tightly with N.multisynnematus with strong support (100% ML/1 PP, Figure 1). Notably, the strains characterized herein form multiple synnemata on the stromata of Ophiocordyceps sp. (parasitizing a fly), whereas N. multisynnematus produces synnemata at various locations on Ophiocordyceps aff. flavida. Morphologically, our strains were highly similar to N.multisynnematus, including the conidia and conidiogenous cells (3.0–5.3 × 1.4–2.2 µm vs. 2.0–5.0 × 1.0–1.5 µm; 8.3–44.3 × 1.0–2.2 µm vs. 20–50 × 1 µm). Additionally, the two isolates characterized herein were highly similar to N.multisynnematus in SSU (with 99.89% sequence identity), LSU (100%), tef–1α (99.31%), rpb1 (100%), and rpb2 (100%) sequences. Therefore, we identify our isolates as N. multisynnematus, marking the first record of N. multisynnematus in China.

4. Discussion

4.1. Taxonomy and Phylogeny of Cordycipitaceae

Species within the Cordycipitaceae are widely distributed and include a stunning variety of entomopathogenic fungi that have significant ecological impacts as well as economic value, which has led to increased attention towards their taxonomic placement and identification. With the study of entomopathogenic fungi entering the genomic era, molecular methods have been applied to the systematics and evolutionary biology of Cordycipitaceae, and the classification of this family has undergone a major shift from polyphyletic to monophyletic [1,3,22].
Our data indicate that the fungal specimens collected belong to Cordycipitaceae, and group within the Liangia, Niveomyces, and Samsoniella genera. In total, two new species (Akanthomyces baishanensis sp. nov. and Samsoniella sanmingense sp. nov.), two new record species (Blackwellomyces lateris and Niveomyces multisynnematus) and one known species (Liangia sinensis) are described.
Samsoniella was assigned by Mongkolsamrit et al. in 2018 for the species S. inthanonensis (the type species) and two other species, S. alboaurantia and S. aurantia [17]. Samsoniella has a wide geographical distribution, with 38 names currently recorded in the Index Fungorum (http://www.indexfungorum.org/; accessed 1 September 2024). In China, the majority of Samsoniella species are found in warm and humid climates, such as the Yunnan and Guizhou provinces [2,48]. In Yunnan, based on multiple gene sequences (SSU, LSU, tef-1α, rpb1, and rpb2), Wang et al. found Samsoniella species to be important for economic, medical, and ecological values, i.e., S. alpina, S. antleroides, S. cardinalis, S. cristata, S. lanmaoa, S. kunmingensis, S. ramosa, S. tortricidae, and S. yunnanensis [2]. In Guizhou, Chen et al. [20] isolated S. hymenopterorum, S. coleopterorum, and S. lepidopterorum from Hymenoptera larvae, Coleopteran larvae, and Lepidoptera pupae, respectively [48]. S. pupicola was then identified in several Isaria farinosa strains [20]. Recently, it has been reported that some Samsoniella members (S. formicae, S. erucae, and S. neoupicola) appear in unique karst ecological environments. Subsequently, Chen et al. discovered S. duyunensis and S. vallis, which provided new insights into the diversity and ecological adaptability of Samsoniella species in different habitats [49]. Here, we report a new species, S. sanmingense sp. nov., isolated from the pupae of Lepidoptera. S. sanmingense can be distinguished from S. tiankengensis by a combination of broader phialides and bigger oblong to fusiform conidia, and can also be distinguished from other known species of the genus by the morphology of their colonies, as well as by phylogenetic, morphological, and ecological features. It is worth mentioning that we also isolated B. lateris from Lepidoptera larvae for the first time in China, which is the first time that an asexual morph of this genus has been found. The tropical coastal climate of Fujian province, located on the southeastern coast of China, proves to have a rich diversity that merits further exploration of entomopathogenic fungi [50,51].
Akanthomyces, Samsoniella, and other genera with Isaria-like or Lecanicillium-like morphs have similar morphs characteristics, so it is often difficult to distinguish these species using only morphological characteristics [17]. Due to the difficulty of distinguishing species based solely on morphological characteristics, Chen et al. [49] suggested that modern identification of the Akanthomyces genus can utilize any two of three proscribed loci (e.g., ITS, LSU, and/or rpb2) in phylogenetic analysis to differentiate and interpret these closely related species. Subsequently, Khonsanitet al. [4] conducted a comprehensive phylogenetic and morphological examination of the species within Akanthomyces, and reclassified these species into four genera based on the type of substrate or the taxonomic group of the host. Currently, 13 species are classified within Akanthomyces, all of which are exclusively associated with moth infections. Here, we have used a combined SSU, LSU, tef1-α, rpb1, and rpb2 sequence dataset to support the identification of a new species that has been named Ak. baishanensis. Ak. baishanensis was found on adult moths in Northeast China. Ak. baishanensis forms an independent clade distinct from Ak. phariformis, Ak. bannaensis, and Ak. taiwanicus, with strong support value. Khonsanit et al. [4] described Ak. phariformis based on specimens collected in Tak Province, Thailand, describing the sexual morph characteristics of this species, including ovoid perithecia and filiform ascospores. Compared to Ak. phariformis, Ak. baishanensis has larger perithecia. When compared to Ak. taiwanicus, Ak. baishanensis exhibits longer phialides and wider conidia. According to the morphological description of Zhanget al. [52], Ak. bannaensis was found in adults of Dudusa sphingiformis on the underside of the leaves of angiosperms, with wider phialides and larger ellipsoidal or obovoid conidia. In contrast, the presence of this family has not been reported in Northeast China, and its occurrence in this area may be related to the impact of global warming on the distribution patterns of fungi.
Among these species, two are particularly striking and eye-catching. During the exploration of entomopathogenic fungi in Jilin Province, we discovered a new specimen with Sporothrix-like asexual morphs, and this genus has been reported for the first time in China. Niveomyces belongs to a relatively specialized lineage within Cordycipitaceae that has evolved as specialized mycoparasites. Scattered and denticulate conidiogenous cells are typical of the Niveomyces species, andare observed in all members of this genus as well as in the species we have described [7,23]. The genus Liangia was assigned to Cordycipitaceae with Liangia sinensis as the type species, and currently the genus includes only a single species. Wang et al. only observed the asexual morph of Liangia. In this study, we isolated a known species Liangia sinensis from Ophiocordyceps globiceps parasitizing a Diptera host [2]. Interestingly, we found that L. sinensis and N. multisynnematus derived from dead insects infected with Ophiocordyceps sp., indicating a strong parasitic relationship. Meanwhile, our results further support the hypothesis that Liangia sinensis may be a hyper-parasitic fungus of Beauveria yunnanensis [2]. Jilin Province, located in Northeast China, has a temperate continental climate and abundant resources [53]. However, thus far, the diversity of Cordycipitaceae in this region has not yet been reported. Biogeographically, most species within the Akanthomyces, Liangia, and Niveomyces are primarily distributed in tropical and subtropical regions, whereas the three species reported here have mainly been collected in temperate continental climates. These reports, along with our own findings, may indicate that Cordycipitaceae species are more widely distributed than previously recognized. This provides new insights into the diversity and ecological adaptability of these species in different habitats.

4.2. Possible Origin of Akanthomyces Sensu Lato

In recent years, molecular dating methods have been widely applied, leading to significant advancements in estimating fungal divergence times, which can enhance our understanding of evolutionary processes across all taxonomic levels. Based on the concatenated sequence dataset of ITS, LSU, rpb2, tef1–α, and tub2, it has been proposed that the common ancestor of Pseudoplagiostomataceae and Apoharknessiaceae appeared in the Cretaceous period (104.1 Mya, 86.0–129.0 Mya) [54]. Similarly, the common ancestor of the eight branches of Lecanicillium appears to have occurred ~84.36 Mya [38], with the proposed mean stem age of Favolaschia as 49.6 Mya (95% HPD of 36.7–75.7 Mya) [55]. Recently, Mu et al. [56] proposed that the ancestor of Schizoparmaceae appeared during the Upper Cretaceous period, approximately 75.7 Mya (95% HPD: 60.3–91.3 Mya).
Molecular diversity analyses of macrofungi, animals, and plants have been widely applied for biogeographical analyses aimed at identifying likely ancestral origin points. However, the study of the origin and historical distribution of many (filamentous) fungal species has received less attention. Akanthomyces s.l. is an important entomopathogenic fungus with a worldwide distribution and diverse bioactive substances, and here, we used RASP in phylogeny and selected the Statistical Dispersal–Extinction–Cladogenesis (S–DEC) model to reconstruct the historical biogeography of this genus. Using two ribosomal RNA genes (SSU and LSU) and three protein-coding genes (tef1–α, rpb1, and rpb2), we inferred that Akanthomyces s.l. likely originated in Asia between the Oligocene and Eocene periods, with an average stem age of 34.57 Mya (95% highest posterior density of 31.41–37.67 Mya). Asia is inferred to be the most probable ancestral area, with dispersals into Africa, Europe, North America, and South America. We found that the diversity of Akanthomyces s.l. was not directly related to the dramatic extinction event of the Cretaceous–Tertiary period, similar to previous literature reports [57]. This may be due to long-term environmental adaptation and co-evolution with insects, or random changes in temperature and aridification in the Miocene might have caused populations of many organisms to expand and contract [38,58].
Asia is the apparent center of origin for the “Group I” set (13.46 Mya, 95% HPD 11.67–15.31 Mya), which consists of seven species: Arachnidicolaaraneicola, Ar. araneogenum, Ar. bashanensis, Ar. beibeiensis, Ar. kunmingensis, Ar. subaraneicola, and Ar. tiankengensis, from China, four species: Ar. kanyawimiae, Ar. sulphureus, Ar. thailandica, and Ar. waltergamsii from Thailand, and one species: Ar. kanyawimiae, from Japan. The population of the ancestral species in Group I shows a trend of migrating towards small regions (refugia) in East Asia (mainly in central and southwest China), which may be because the Himalayan mountains and Qinghai–Tibet Plateau experienced a series of important geographical events during the Neogene period, resulting in a significant increase in their altitude [59,60].
Asia and South America appear to be the center of origin for the “Group II” set (17.29 Mya, 95% HPD 15.13–19.48 Mya), with dispersal to Europe and North America, resulting in high endemism of Akanthomyces s.l. in the region. Four species, Lecanicillium neocoleopterorum, L. attenuatum, L. pissodis, and L. muscarium, are closely related, suggesting the dispersal route of Asia–Europe–North America. L. lecanii and L. sabanense show significant differences from other taxa in this group, which suggests an Asia–South America dispersal route. One hypothetical mechanism for this dispersal from Asia to South America may be via hurricanes and typhoons that circulate the South Pacific Ocean. The transoceanic or long-distance dispersal (LDD) hypothesis has been proposed to explain biogeographical patterns and the distribution of animals, plants, and fungi, but this mechanism is considered rare [61].
Bayesian binary analysis supported Asia as the center of origin for the “Group III” set (17.91 Mya, 95% HPD 16.18–19.81 Mya), with nine Akanthomyces species found in Southeast Asia, and four species found in China. Ak. xixiuensis, Ak. baishanensis, Ak. Bannaensis, and Ak. taiwanicus are from Guizhou, Jilin, Yunnan, and Taiwan provinces in China, respectively, while Ak. buriramensis, Ak. fusiformis, Ak. laosensis, Ak. niveus, Ak. noctuidarum, Ak. phariformis, Ak. Pseudonoctuidarum, and Ak. pyralidarum are mainly restricted to tropical regions in Southeast Asia. Ak. aculeatus exhibits a continuous distribution in Europe and Ecuador; therefore, we deduced that the occurrence of A. aculeatus in South America may be due to recent human-mediated introductions. In addition, two species, Ak. tuberculatus and Ak. aculeatus, show significant differences in geographical distribution from other taxa in this group. We propose that the increase in tropical forest area associated with the Miocene warming trend may have played a crucial role in facilitating species exchanges between Europe and Asia [56]. These observations strongly support early diversification of Akanthomyces s.l. species in Asia. The characterization of additional species, coupled with fossil evidence, is needed to further support this hypothesis, and additional research on the biogeography of the Cordycipitaceae is warranted. Overall, our data provide a significant addition to the diversity, ecology, and evolutionary aspects of the Cordycipitaceae, and suggest that significant additional discovery awaits.

5. Conclusions

In this study, based on the combination of morphological observations and multi-locus phylogenetic analyses, we identified two new species, two new record species, and one known species of Cordycipitaceae distributed within five different genera from China, viz. Akanthomyces baishanensis sp. nov., Samsoniella sanmingense sp. nov., Blackwellomyces lateris, Niveomyces multisynnematus, and Liangia sinensis. Molecular clock analyses examining divergence times, along with historical biogeographic analyses, suggest that the ancestor of Akanthomyces sensu lato (s.l.) most likely originated in Asia during the Paleogene period, approximately 34.57 Mya. These findings provide valuable help for the classification, diversity, and evolutionary aspects of Cordycipitaceae species.

Author Contributions

Conceptualization, H.P. and J.Q.; methodology, H.P. and J.Y.; software, L.Y. and M.Z.; validation, Y.M., J.S. and Y.L.; formal analysis, C.X. and C.Q. (Chenghao Qiu); investigation, P.L., C.Q. (Chunjin Qiu) and L.L.; resources, Y.H. and X.Y.; data curation, H.L., L.F., N.O.K., X.M., J.Y., Y.L., P.L., L.Y., M.Z., Y.M., C.X., C.Q. (Chunjin Qiu) and J.S.; writing—original draft preparation, H.P., Y.L. and L.L.; writing—review and editing, H.P., N.O.K. and J.Q.; visualization, L.L.; supervision, J.Q.; project administration, J.Q.; funding acquisition, C.Q. (Chunjin Qiu) and J.Q. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 32270029, U1803232, 31670026), the National Key R & D Program of China (No. 2017YFE0122000), a Social Service Team Support Program Project (No. 11899170165), the Science and Technology Innovation Special Fund (Nos. KFB23084, CXZX2019059S, CXZX2019060G) of Fujian Agriculture and Forestry University, a Fujian Provincial Major Science and Technology Project (No. 2022NZ029017), an Investigation and evaluation of biodiversity in the Jiulong River Basin (No. 082·23259-15), the Macrofungal and microbial resource investigation project in Longqishan Nature Reserve (No. SMLH2024(TP)-JL003#), and an Investigation ofmacrofungaldiversity in Junzifeng National Nature Reserve, Fujian Province (No. Min Qianyu Sanming Recruitment 2024-23).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All sequences generated in this study were submitted to the NCBIdatabase.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Sung, G.H.; Hywel-Jones, N.L.; Sung, J.M.; Luangsa-Ard, J.J.; Shrestha, B.; Spatafora, J.W. Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Stud. Mycol. 2007, 57, 5–59. [Google Scholar] [CrossRef] [PubMed]
  2. Wang, Y.B.; Wang, Y.; Fan, Q.; Duan, D.E.; Zhang, G.D.; Dai, R.Q.; Dai, Y.C.; Zeng, W.B.; Chen, Z.H.; Li, D.; et al. Multigene phylogeny of the family Cordycipitaceae (Hypocreales): New taxa and the new systematic position of the Chinese cordycipitoid fungus Paecilomyces hepiali. Fungal Divers. 2020, 103, 1–46. [Google Scholar] [CrossRef]
  3. Dong, Q.Y.; Wang, Y.; Wang, Z.Q.; Tang, D.X.; Zhao, Z.Y.; Wu, H.J.; Yu, H. Morphology and phylogeny reveal five novel species in the genus Cordyceps (Cordycipitaceae, Hypocreales) from Yunnan, China. Front. Microbiol. 2022, 13, 846909. [Google Scholar] [CrossRef] [PubMed]
  4. Khonsanit, A.; Thanakitpipattana, D.; Mongkolsamrit, S.; Kobmoo, N.; Phosrithong, N.; Samson, R.A.; Crous, P.W.; Luangsa-ard, J.J. A phylogenetic assessment of Akanthomyces sensu lato in Cordycipitaceae (Hypocreales, Sordariomycetes): Introduction of new genera, and the resurrection of Lecanicillium. Fungal Syst. Evol. 2024, 14, 271–305. [Google Scholar] [CrossRef]
  5. Mongkolsamrit, S.; Sandargo, B.; Ebada, S.S.; Noisripoom, W.; Jaiyen, S.; Luangsa-ard, J.J.; Stadler, M. Bhushaniella gen. nov. (Cordycipitaceae) on spider eggs sac: A new genus from Thailand and its bioactive secondary metabolites. Mycol. Prog. 2023, 22, 64. [Google Scholar] [CrossRef]
  6. Mongkolsamrit, S.; Noisripoom, W.; Tasanathai, K.; Noppol Kobmoo, N.; Thanakitpipattana, D.; Khonsanit, A.; Petcharad, B.; Baramee Sakolrak, B.; Himaman, W. Comprehensive treatise of Hevansia and three new genera Jenniferia, Parahevansia and Polystromomyces on spiders in Cordycipitaceae from Thailand. MycoKeys 2022, 91, 113–149. [Google Scholar] [CrossRef]
  7. Kobmoo, N.; Tasanathai, K.; Araújo, J.P.M.; Noisripoom, W.; Thanakitpipattana, D.; Mongkolsamrit, S.; Himaman, W.; Houbraken, J.; Luangsa-ard, J.J. New mycoparasitic species in the genera Niveomyces and Pseudoniveomyces gen. nov. (Hypocreales: Cordycipitaceae), with sporothrix-like asexual morphs, from Thailand. Fungal Syst. Evol. 2023, 12, 91–110. [Google Scholar] [CrossRef]
  8. Kuephadungphan, W.; Petcharad, B.; Tasanathai, K.; Thanakitpipattana, D.; Kobmoo, N.; Khonsanit, A.; Samson, R.A.; Luangsa-ard, J.J. Multi–locus phylogeny unmasks hidden species within the specialised spider-parasitic fungus, Gibellula (Hypocreales, Cordycipitaceae) in Thailand. Stud. Mycol. 2022, 101, 245–286. [Google Scholar] [CrossRef] [PubMed]
  9. Wang, Z.; Wang, Y.; Dong, Q.; Fan, Q.; Dao, V.M.; Yu, H. Morphological and phylogenetic characterization reveals five new species of Samsoniella (Cordycipitaceae, Hypocreales). J. Fungi 2022, 8, 747. [Google Scholar] [CrossRef]
  10. Ng, T.B.; Wang, H.X. Pharmacological actions of Cordyceps, a prized folk medicine. J. Pharm. Pharmacol. 2005, 57, 1509–1519. [Google Scholar] [CrossRef] [PubMed]
  11. Zha, L.S.; Huang, S.K.; Xiao, Y.P.; Boonmee, S.; Eungwanichayapant, P.D.; McKenzie, E.H.C.; Kryukov, V.Y.; Liang, W.X.; Hyde, K.D.; Wen, T.-C. An evaluation of common Cordyceps (Ascomycetes) species found in Chinese Markets. Int. J. Med. Mushrooms 2018, 20, 1149–1162. [Google Scholar] [CrossRef]
  12. Marsup, P.; Yeerong, K.; Neimkhum, W.; Sirithunyalug, J.; Anuchapreeda, S.; To-anun, C.; Chaiyana, W. Enhancement of chemical stability and dermal delivery of Cordyceps militaris extracts by nanoemulsion. Nanomaterials 2020, 10, 1565. [Google Scholar] [CrossRef]
  13. Zimmermann, G. Review on safety of the entomopathogenic fungi Beauveria bassiana and Beauveria brongniartii. Biocontrol Sci. Technol. 2007, 17, 553–596. [Google Scholar] [CrossRef]
  14. Rehner, S.A.; Minnis, A.M.; Sung, G.H.; Luangsa-ard, J.J.; Devotto, L.; Humber, R.A. Phylogeny and systematics of the anamorphic, entomopathogenic genus Beauveria. Mycol. 2011, 103, 1055–1073. [Google Scholar] [CrossRef] [PubMed]
  15. Mascarin, G.M.; Kobori, N.N.; Quintela, E.D.; Delalibera, I.J. The virulence of entomopathogenic fungi against Bemisia tabaci biotype B (Hemiptera: Aleyrodidae) and their conidial production using solid substrate fermentation. Biol. Control 2013, 66, 209–218. [Google Scholar] [CrossRef]
  16. Rojas, V.M.A.; Iwanicki, N.S.A.; Alessandro, C.P.; Fatoretto, M.B.; Demétrio, C.G.B.; Delalibera, I. Characterization of Brazilian Cordyceps fumosorosea isolates: Conidial production, tolerance to ultraviolet-B radiation, and elevated temperature. J. Invertebr. Pathol. 2023, 197, 107888. [Google Scholar] [CrossRef]
  17. Mongkolsamrit, S.; Noisripoom, W.; Thanakitpipattana, D.; Wutikhun, T.; Spatafora, J.W.; Luangsa-ard, J.J. Disentangling cryptic species with Isaria-like morphs in Cordycipitaceae. Mycologia 2018, 110, 230–257. [Google Scholar] [CrossRef] [PubMed]
  18. Wang, Y.; Wang, Z.Q.; Luo, R.; Souvanhnachit, S.; Thanarut, C.; Dao, V.M.; Yu, H. Species diversity and major host/substrate associations of the genus Akanthomyces (Hypocreales, Cordycipitaceae). MycoKeys 2024, 101, 113–141. [Google Scholar] [CrossRef]
  19. Liang, Y.J.; Ariyawansa, H.A.; Becker, J.O.; Yang, J.I. The evaluation of egg-parasitic fungi Paraboeremia taiwanensis and Samsoniella sp. for the biological control of Meloidogyne enterolobii on Chinese cabbage. Microorganisms 2020, 8, 828. [Google Scholar] [CrossRef]
  20. Chen, W.H.; Liang, J.D.; Ren, X.X.; Zhao, J.H.; Han, F.Y.; Liang, Z.Q. Cryptic diversity of Isaria-like species in Guizhou, China. Life 2021, 11, 1093. [Google Scholar] [CrossRef] [PubMed]
  21. Chen, W.H.; Liang, J.D.; Ren, X.X.; Zhao, J.H.; Han, F.Y.; Liang, Z.Q. Species diversity of Cordyceps–like fungi in the Tiankeng karst region of China. Microbiol. Spectr. 2022, 5, e0197522. [Google Scholar] [CrossRef]
  22. Kepler, R.M.; Luangsa–ard, J.J.; Hywel–Jones, N.L.; Quandt, C.A.; Sung, G.H.; Rehner, S.A.; Aime, M.C.; Henkel, T.W.; Sanjuan, T.; Zare, R.; et al. A phylogenetically–based nomenclature for Cordycipitaceae (Hypocreales). IMA Fungus 2017, 8, 335–353. [Google Scholar] [CrossRef]
  23. Araújo, J.P.M.; Lebert, B.M.; Vermeulen, S.; Brachmann, A.; Ohm, R.A.; Evans, H.C.; de Bekker, C. Masters of the manipulator: Two new hypocrealean genera, Niveomyces (Cordycipitaceae) and Torrubiellomyces (Ophiocordycipitaceae), parasitic on the zombie ant fungus Ophiocordyceps camponoti-floridani. Persoonia 2022, 49, 171–194. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, Y.B.; Yu, H.; Dai, Y.D.; Wu, C.K.; Zeng, W.B.; Yuan, F.; Liang, Z.Q. Polycephalomyces agaricus, a new hyperparasite of Ophiocordyceps sp. infecting melolonthid larvae in southwestern China. Mycol. Prog. 2015, 14, 70. [Google Scholar] [CrossRef]
  25. Vilgalys, R.; Hester, M. Rapid genetic identifcation and mapping of enzymatically amplifed ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef]
  26. Rehner, S.A.; Samuels, G.J. Taxonomy and phylogeny of gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycol. Res. 1994, 98, 625–634. [Google Scholar] [CrossRef]
  27. Rehner, S.A.; Buckley, E. A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 2005, 97, 84–98. [Google Scholar] [CrossRef]
  28. Castlebury, L.; Rossman, A.; Sung, G.; Hyten, A.; Spatafora, J. Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycol. Res. 2004, 108, 864–872. [Google Scholar] [CrossRef] [PubMed]
  29. Matheny, P.B.; Liu, Y.J.; Ammirati, J.F.; Hall, B.D. Using RPB1 sequences to improve phylogenetic inference among mushrooms (Inocybe, Agaricales). Am. J. Bot. 2002, 89, 688–698. [Google Scholar] [CrossRef] [PubMed]
  30. Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef] [PubMed]
  31. Mongkolsamrit, S.; Noisripoom, W.; Tasanathai, K.; Khonsanit, A.; Thanakitpipattana, D.; Himaman, W.; Kobmoo, N.; Luangsa-ard, J.J. Molecular phylogeny and morphology reveal cryptic species in Blackwellomyces and Cordyceps (Cordycipitaceae) from Thailand. Mycol. Prog. 2020, 19, 957–983. [Google Scholar] [CrossRef]
  32. Wang, Y.; Wang, Z.Q.; Thanarut, C.; Dao, V.M.; Wsng, Y.B.; Yu, H. Phylogeny and species delimitations in the economically, medically, and ecologically important genus Samsoniella (Cordycipitaceae, Hypocreales). MycoKeys 2023, 99, 227–250. [Google Scholar] [CrossRef] [PubMed]
  33. Chuang, W.Y.; Lin, Y.C.; Shrestha, B.; Luangsa-ard, J.J.; Stadler, M.; Tzean, S.S.; Wu, S.; Ko, C.C.; Hsieh, S.Y.; Wu, M.L.; et al. Phylogenetic diversity and morphological characterization of cordycipitaceous species in Taiwan. Stud. Mycol. 2024, 109, 6–61. [Google Scholar] [CrossRef] [PubMed]
  34. Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-Tree: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
  35. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. Mrbayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
  36. Letunic, I.; Bork, P. Interactive tree of life (iTOL) v3: An online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res. 2016, 44, W242–W245. [Google Scholar] [CrossRef]
  37. Sung, G.H.; Poinar, G.O.; Spatafora, J.W. The oldest fossil evidence of animal parasitism by fungi supports a Cretaceous diversification of fungal–arthropod symbioses. Mol. Phylogenet Evol. 2008, 49, 495–502. [Google Scholar] [CrossRef]
  38. Zhou, Y.M.; Zhi, J.R.; Qu, J.J.; Zou, X. Estimated divergence times of Lecanicillium in the family Cordycipitaceae provide insights into the attribution of Lecanicillium. Front. Microbiol. 2022, 13, 859886. [Google Scholar] [CrossRef] [PubMed]
  39. Drummond, A.J.; Ho, S.Y.W.; Phillips, M.J.; Rambaut, A. Relaxed phylogenetics and dating with confidence. PLoS Biol. 2006, 4, e88. [Google Scholar] [CrossRef]
  40. Lepage, T.; Bryant, D.; Philippe, H. A general comparison of relaxed molecular clock models. Mol. Biol. Evol. 2007, 24, 2669–2680. [Google Scholar] [CrossRef]
  41. Gernhard, T. The conditioned reconstrued process. J. Theor. Biol. 2008, 253, 769–778. [Google Scholar] [CrossRef]
  42. Berbee, M.L.; Taylor, J.W. Dating the molecular clock in fungi–how close are we? Fungal Biol. Rev. 2010, 24, 1–16. [Google Scholar] [CrossRef]
  43. Xie, J.; Chen, Y.; Cai, G.; Cai, R.; Hu, Z.; Wang, H. Tree Visualization By One Table (tvBOT): A web application for visualizing, modifying and annotating phylogenetic trees. Nucleic Acids Res. 2023, 51, W587–W592. [Google Scholar] [CrossRef]
  44. Yu, Y.; Harris, A.J.; Blair, C.; He, X. RASP (Reconstruct Ancestral State in Phylogenies): A tool for historical biogeography. Mol. Phylogenet. Evol. 2015, 87, 46–49. [Google Scholar] [CrossRef] [PubMed]
  45. Yu, Y.; Blair, C.; He, X. RASP 4: Ancestral state reconstruction tool for multiple genes and characters. Mol. Biol. Evol. 2019, 37, 604–606. [Google Scholar] [CrossRef]
  46. Yu, Y.; Blair, C.; He, X.J. RASP 4: Ancestral State Reconstruction Tool for Multiple. Mol. Biol. Evol. 2020, 37, 604–606. [Google Scholar] [CrossRef] [PubMed]
  47. Hyde, K.D.; Tennakoon, D.S.; Jeewon, R.; Bhat, D.J.; Maharachchikumbura, S.S.N.; Rossi, W.; Leonardi, M.; Lee, H.B.; Mun, H.; Houbraken, J.; et al. Fungal diversity notes 1036–1150: Taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Divers. 2019, 96, 1–242. [Google Scholar] [CrossRef]
  48. Chen, W.H.; Han, Y.F.; Liang, J.D.; Tian, W.Y.; Liang, Z.Q. Morphological and phylogenetic characterisations reveal three new species of Samsoniella (Cordycipitaceae, Hypocreales) from Guizhou, China. MycoKeys 2020, 74, 1–15. [Google Scholar] [CrossRef] [PubMed]
  49. Chen, W.H.; Liang, J.D.; Ren, X.X.; Zhao, J.H.; Han, F.Y. Two new species of Samsoniella (Cordycipitaceae, Hypocreales) from the Mayao River Valley, Guizhou, China. MycoKeys 2023, 99, 209–226. [Google Scholar] [CrossRef] [PubMed]
  50. Liu, S.; Zhu, M.; Keyhani, N.O.; Wu, Z.; Lv, H.; Heng, Z.; Chen, R.; Dang, Y.; Yang, C.; Chen, J.; et al. Three new species of Russulaceae (Russulales, Basidiomycota) from southern China. J. Fungi 2024, 10, 70. [Google Scholar] [CrossRef]
  51. Zhao, Z.; Mu, T.; Keyhani, N.O.; Pu, H.; Lin, Y.; Lv, Z.; Xiong, J.; Chen, X.; Zhan, X.; Lv, H.; et al. Diversity and new species of Ascomycota from Bamboo in China. J. Fungi 2024, 10, 454. [Google Scholar] [CrossRef]
  52. Zhang, X.; Fu, Z.; Lu, F.; Song, J.; Zhao, C. Morphological characteristics and phylogenetic analyses revealed a new invertebrate-pathogenic fungus Akanthomyces bannaensis (Cordycipitaceae, Ascomycota), in China. Phytotaxa 2024, 666, 26. [Google Scholar] [CrossRef]
  53. Zhu, G.; Chen, Y.; Wu, W.; Liu, R.; Tang, Y.; Li, P.; Xu, A. Coupling relationships between urban block spatial morphology and microclimate in severe cold regions. iScience 2023, 26, 108313. [Google Scholar] [CrossRef] [PubMed]
  54. Zhang, Z.; Liu, X.; Tao, M.; Liu, X.; Xia, J.; Zhang, X.; Meng, Z. Taxonomy, phylogeny, divergence time estimation, and biogeography of the family Pseudoplagiostomataceae (Ascomycota, Diaporthales). J. Fungi 2023, 9, 82. [Google Scholar] [CrossRef]
  55. Zhang, Q.Y.; Liu, H.G.; Papp, V.; Zhou, M.; Dai, Y.; Yuan, Y. New insights into the classification and evolution of Favolaschia (Agaricales, Basidiomycota) and its potential distribution, with descriptions of eight new species. Mycosphere 2023, 14, 777–814. [Google Scholar] [CrossRef]
  56. Mu, T.; Lin, Y.; Pu, H.; Keyhani, N.O.; Danga, Y.; Lv, H.; Zhao, Z.; Heng, Z.; Wu, Z.; Xiong, C.; et al. Molecular phylogenetic and estimation of evolutionary divergence and biogeography of the family Schizoparmaceae and allied families (Diaporthales, Ascomycota). Mol. Phylogenet Evol. 2024, 201, 108211. [Google Scholar] [CrossRef]
  57. Schulte, P.; Alegret, L.; Arenillas, I.; Arz, J.A.; Barton, P.J.; Bown, P.R.; Bralower, T.J.; Christeson, G.L.; Claeys, P.; Cockell, C.S. The Chicxulub asteroid impact and mass extinction at the Cretaceous–Paleogene boundary. Science 2010, 327, 1214–1218. [Google Scholar] [CrossRef] [PubMed]
  58. Chen, J.J.; Cui, B.K.; Zhou, L.W.; Korhonen, K.; Dai, Y.C. Phylogeny, divergence time estimation, and biogeography of the genus Heterobasidion (Basidiomycota, Russulales). Fungal Divers. 2015, 71, 185–200. [Google Scholar] [CrossRef]
  59. Qiu, Y.X.; Fu, C.X.; Comes, H.P. Plant molecular phylogeography in China and adjacent regions: Tracing the genetic imprints of Quaternary climate and environmental change in the world’s most diverse temperate flora. Mol. Phylogenet. Evol. 2011, 59, 225–244. [Google Scholar] [CrossRef] [PubMed]
  60. Feng, B.; Xu, J.; Wu, G.; Hosen, M.I.; Zeng, N.K.; Li, Y.C.; Tolgor, B.; Kost, G.W.; Yang, Z.L. DNA sequence analyses reveal abundant diversity, endemism and evidence for Asian origin of the Porcini mushrooms. PLoS ONE 2012, 7, e37567. [Google Scholar] [CrossRef]
  61. Golan, J.J.; Pringle, A. Long–distance dispersal of fungi. Microbiol. Spectr. 2017, 5, 1–24. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Phylogeny of Cordycipitaceae inferred from the combined dataset SSU, LSU, tef–1α, rpb1, and rpb2, with Trichoderma deliquescens ATCC 208838 and Trichoderma stercorarium ATCC 62321 as outgroup. The maximum likelihood bootstrap support values and Bayesian posterior probabilities bootstrap support values above 70% and 0.90 are shown at the first and second position, respectively. Fungal isolates from this study are shown in red. Arrows show the support values at the branching points. The scale at the bottom left indicates the number of nucleotide substitutions per site. Yellow–green strips represent different neighboring species.
Figure 1. Phylogeny of Cordycipitaceae inferred from the combined dataset SSU, LSU, tef–1α, rpb1, and rpb2, with Trichoderma deliquescens ATCC 208838 and Trichoderma stercorarium ATCC 62321 as outgroup. The maximum likelihood bootstrap support values and Bayesian posterior probabilities bootstrap support values above 70% and 0.90 are shown at the first and second position, respectively. Fungal isolates from this study are shown in red. Arrows show the support values at the branching points. The scale at the bottom left indicates the number of nucleotide substitutions per site. Yellow–green strips represent different neighboring species.
Jof 11 00028 g001
Figure 2. Divergence time estimation of Cordycipitaceae inferred from molecular clock analyses based on five-locus dataset of SSU, LSU, tef–1α, rpb1, and rpb2 regions. The 95% highest posterior density (HPD) and Bayesian posterior probabilities (BYPP) of estimated divergence times indicated by horizontal red bars. The mean divergence times of each node not less than 0.7 are shown at the internodes. Scale in millions of years (Mya).
Figure 2. Divergence time estimation of Cordycipitaceae inferred from molecular clock analyses based on five-locus dataset of SSU, LSU, tef–1α, rpb1, and rpb2 regions. The 95% highest posterior density (HPD) and Bayesian posterior probabilities (BYPP) of estimated divergence times indicated by horizontal red bars. The mean divergence times of each node not less than 0.7 are shown at the internodes. Scale in millions of years (Mya).
Jof 11 00028 g002
Figure 3. Ancestralstate reconstruction and divergence time estimation of Akanthomyces s.l. using the SSU, LSU, tef–1α, rpb1, and rpb2 dataset. (a) The pie chart in each node indicates the possible ancestral distributions inferred from Bayesian Binary Markov chain Monte Carlo analysis (BBM) implemented in RASP. A black asterisk represents other ancestral ranges. (b) Possible dispersal routes of Akanthomyces s.l.
Figure 3. Ancestralstate reconstruction and divergence time estimation of Akanthomyces s.l. using the SSU, LSU, tef–1α, rpb1, and rpb2 dataset. (a) The pie chart in each node indicates the possible ancestral distributions inferred from Bayesian Binary Markov chain Monte Carlo analysis (BBM) implemented in RASP. A black asterisk represents other ancestral ranges. (b) Possible dispersal routes of Akanthomyces s.l.
Jof 11 00028 g003
Table 1. PCR primers and their annealing temperatures used in this study.
Table 1. PCR primers and their annealing temperatures used in this study.
GenePrimersSequence (5′-3′)Annealing TemperatureReferences
SSUnrSSU-CoFTCTCAAAGATTAAGCCATGC55 °C[24]
nrSSU-CoRTCACCAACGGAGACCTTG
LSULR0RGTACCCGCTGAACTTAAGC52 °C[25,26]
LR5TCCTGAGGGAAACTTCG
tef-1αEF1α-EFGCTCCYGGHCAYCGTGAYTTYAT60 °C[27]
EF1α-ERATGACACCRACRGCRACRGTYTG
rpb1RPB1-AcCAYCCWGGYTTYATCAAGAAFrom 57 °C to 72 °C at 0.2 °C/s[28,29]
RPB1-CrCCNGCDATNTCRTTRTCCATRTA
rpb2fRPB2-5FGAYGAYMGWGATCAYTTYGG56 °C[30]
fRPB2-7cRCCCATRGCTTGTYYRCCCAT
Table 2. Taxa used in the phylogenetic analysis and their GenBank accession numbers.
Table 2. Taxa used in the phylogenetic analysis and their GenBank accession numbers.
SpeciesStrain No. Host/SubstrateGenBank Accession Numbers
SSULSUtef-1αrpb1rpb2
Akanthomyces aculeatusHUA 186145LepidopteraMF416572MF416520MF416465--
Akanthomyces baishanensisCGMCC3.25673Lepidoptera; NoctuidaePP177381PP179404PP464678PP464641PP464655
Akanthomyces baishanensisCGMCC3.25674Lepidoptera; NoctuidaePP177382PP179405PP464679PP464642PP464656
Akanthomyces bannaensisCL Zhao 34016Lepidoptera; Dudusa sphingiformis-PP571897--PP588774
Akanthomyces buriramensisBCC 45158Lepidoptera; Noctuidae-ON008543ON013546ON013561-
Akanthomyces buriramensisBCC 45166Lepidoptera; Noctuidae-ON008544ON013547ON013562-
Akanthomyces buriramensisBCC 47939Lepidoptera; Noctuidae-ON008545ON013548ON013563-
Akanthomyces fusiformisBCC 40756Lepidoptera; Pyralidae-ON008549ON013552ON013567ON013576
Akanthomyces laosensisYFCC 1910941Lepidoptera; Noctuidae-OQ509510OQ506286OQ511535OQ511549
Akanthomyces laosensisYFCC 1910942Lepidoptera; Noctuidae-OQ509511OQ506287OQ511536OQ511550
Akanthomyces niveusBCC 40747Lepidoptera-ON008550ON013553ON013568ON013577
Akanthomyces niveusBCC 79887Lepidoptera-ON008551ON013554-ON013578
Akanthomyces noctuidarumBCC36265Lepidoptera; Noctuidae-MT356084MT477978MT477994MT477987
Akanthomyces noctuidarumBCC47498Lepidoptera; Noctuidae-MT356086MT477980MT477996MT477988
Akanthomyces phariformisBCC 45148Lepidoptera; Erebidae-ON008556ON013559-ON013583
Akanthomyces phariformisBCC 76537Lepidoptera; Noctuidae-ON008557ON013560-ON013584
Akanthomyces pseudonoctuidarumYFCC 1808943Lepidoptera; Noctuidae OQ509512OQ506288OQ511537OQ511551
Akanthomyces pseudonoctuidarumYFCC 1808944Lepidoptera; Noctuidae OQ509513OQ506289OQ511538OQ511552
Akanthomyces pyralidarumBCC28816Lepidoptera; Pyralidac-MT356091MT477982MT478000MT478007
Akanthomyces pyralidarumBCC32191Lepidoptera; Pyralidac-MT356092MT477983MT478001MT477989
Akanthomyces taiwanicusNTUPPMCC 20-060Lepidoptera (Agrius convolvuli)-MT974356MW200213MW200221MW200230
Akanthomyces taiwanicusNTUPPMCC 20-060-1Lepidoptera (Agrius convolvuli)-PP190926---
Akanthomyces tortricidarumBCC41868Lepidoptera; Tortricidae-MT356089MT477985MT477998MT478008
Akanthomyces tortricidarumBCC72638Lepidoptera; Tortricidae-MT356088MT478004MT477997MT477992
Akanthomyces tuberculatusOSC 111002LepidopteraDQ522553DQ518767DQ522338-DQ522435
Akanthomyces xixiuensisHKAS 125851LepidopteraOP693479OP693481OP838888OP838890OP838892
Akanthomyces xixiuensisXX21081764LepidopteraOP693478OP693480OP838887OP838889OP838891
Arachnidicola araneicolaGY29011Araneae; spider--MK955950MK955944MK955947
Arachnidicola araneicolaGY29012Araneae; spider--MK955951MK955945MK955948
Arachnidicola araneogenusGZUIFDX1Araneus sp.---MH978181MH978184
Arachnidicola araneogenusGZUIFSN1Araneus sp.--MH978188MH978183MH978186
Arachnidicola bashanensisCQ05621Araneae; spider-OQ300420OQ325024-OQ349684
Arachnidicola bashanensisCQ05622Araneae; spider-OQ300421OQ325025-OQ349685
Arachnidicola beibeiensisCQ05921Araneae; spider-OQ300424OQ325028-OQ349688
Arachnidicola beibeiensisCQ05922Araneae; spider-OQ300427OQ325029-OQ349689
Arachnidicola kanyawimiaeNHJ 6709Araneae; spiderEU369110EU369042EU369025EU369067EU369086
Arachnidicola kanyawimiaeTBRC 7242Araneae; spider-MF140718MF140838MF140784MF140808
Arachnidicola kanyawimiaeTBRC 7243On unidentified insect-MF140717MF140837MF140783MF140807
Arachnidicola kanyawimiaeTBRC 7244Araneae; spider-MF140716MF140836--
Arachnidicola kunmingensisYFCC 1708939Araneae; spider-OQ509508OQ506284OQ511533OQ511547
Arachnidicola kunmingensisYFCC 1808940Araneae; spider-OQ509509OQ506285OQ511534OQ511548
Arachnidicola subaraneicolaYFCC 2107937Araneae; spider-OQ509514OQ506290OQ511539OQ511553
Arachnidicola subaraneicolaYFCC 2107938Araneae; spider-OQ509515OQ506291OQ511540OQ511554
Arachnidicola sulphureusTBRC 7248Araneae; spider-MF140722MF140843MF140787MF140812
Arachnidicola sulphureusTBRC 7249Araneae; spider-MF140721MF140842MF140786MF140734
Arachnidicola thailandicaTBRC 7245Araneae; spider--MF140839-MF140809
Arachnidicola thailandicaTBRC 7246Araneae; spider-MF140719MF140840-MF140810
Arachnidicola tiankengensisKY11571Araneae; spider-ON502825ON525447-ON525446
Arachnidicola tiankengensisKY11572Araneae; spider-ON502827ON525449-ON525448
Arachnidicola waltergamsiiTBRC 7251Araneae; spider-MF140713MF140833MF140781MF140805
Arachnidicola waltergamsiiTBRC 7252Araneae; spider-MF140714MF140834MF140782MF140806
Ascopolyporus polychrousP.C. 546Hemiptera-DQ118737DQ118745DQ127236-
Ascopolyporus villosusARSEF 6355Hemiptera-AY886544DQ118750DQ127241-
Beauveria acridophilaHUA 179219Orthoptera; Acrididae-JQ895541JQ958613JX003857JX003841
Beauveria acridophilaHUA 179220Orthoptera; AcrididaeJQ895527JQ895536JQ958614JX003852JX003842
Beauveria amorphaARSEF 2641Hymenoptera; Formicidae-AB100039AY531917HQ880880HQ880952
Beauveria baoshanensisCCTCC AF2018011Coleoptera; ChrysomelidaeMG642882MG642840MG642897MG642854MG642867
Beauveria bassianaARSEF 1564Lepidoptera; ArctiidaeEU334676-HQ880974HQ880833HQ880905
Beauveria bassianaYFCC 3369Coleoptera; ScarabaeidaeMN576768MN576824MN576994MN576884MN576938
Beauveria blattidicolaMCA 1727Blattodea; BlattidaeMF416593MF416539MF416483MF416640-
Beauveria brongniartiiARSEF 617Coleoptera; ScarabaeidaeAB027335AB027381HQ880991HQ880854HQ880926
Beauveria brongniartiiYFCC 3240Coleoptera; ScarabaeidaeMN576769MN576825MN576995MN576885MN576939
Bhushaniella rubraBCC 47541Spider eggs in sac-OQ892133OQ914428OQ914431OQ914433
Bhushaniella rubraBCC 47542Spider eggs in sac-OQ892134OQ914429OQ914432OQ914434
Blackwellomyces aurantiacusBCC 85060Lepidoptera (larva)-MT003028MT017840MT017800MT017819
Blackwellomyces aurantiacusBCC 85061Lepidoptera (larva)-MT003029MT017841MT017801MT017820
Blackwellomyces calendulinusBCC 68500Coleoptera (larva)-MT003030MT017842MT017802MT017821
Blackwellomyces calendulinusBCC 68502Coleoptera (larva)-MT003031MT017843MT017803MT017822
Blackwellomyces cardinalisOSC 93609Lepidoptera; TineidaeAY184973AY184962DQ522325DQ522370DQ522422
Blackwellomyces cardinalisOSC 93610Lepidoptera; TineidaeAY184974AY184963EF469059EF469088EF469106
Blackwellomyces kaihuaensisHMAS 285455Lepidoptera (larva)OQ981975OQ981968OQ980401OQ980409OQ980408
Blackwellomyces kaihuaensisHMAS 285456Lepidoptera (larva)OQ981976OQ981969OQ980402OQ980410-
Blackwellomyces laterisMFLU 18-0663Coleoptera (larva) NG_067678MK086061MK069471MK084615MK079354
Blackwellomyces laterisHMAS 352953Lepidoptera (larva)PP554483PP554184PP556330PP556331PP556332
Blackwellomyces minutusBCC 88269Coleoptera (larva) -MT003032MT017844MT017804MT017823
Blackwellomyces pseudomilitarisBCC 1919Lepidoptera (larva)MF416588MF416534MF416478-MF416440
Blackwellomyces pseudomilitarisBCC 2091Lepidoptera (larva)MF416589MF416535MF416479-MF416441
Blackwellomyces roseostromatusBCC 91358Lepidoptera (larva)-MT003033MT017845MT017805MT017824
Blackwellomyces roseostromatusBCC 91360Lepidoptera (larva)-MT003035MT017847MT017807MT017826
Blackwellomyces taiwanensisNTUPPMCC 20-068Coleoptera (larva) -MT974411--MW200251
Blackwellomyces taiwanensisNTUPPMCC 20-071Coleoptera (larva) -MT974409MW200242MW200246MW200250
Cordyceps bifusisporaEFCC 5690Lepidoptera (pupa)EF468952EF468806EF468746EF468854EF468909
Cordyceps bifusisporaEFCC 8260-EF468953EF468807EF468747EF468855EF468910
Cordyceps coleopterorumCBS 110.73Coleoptera (larva)JF415965JF415988JF416028JN049903JF416006
Cordyceps koratensisNHJ 2662Lepidoptera-GQ249982GQ250032ON470206ON470208
Cordyceps koratensisNHJ 666.01Arachnida-GQ249981GQ250031--
Cordyceps militarisARSEF 5050Lepidoptera--HQ881020HQ880901HQ880973
Cordyceps militarisOSC 93623Lepidoptera (pupa)AY184977AY184966DQ522332DQ522377AY545732
Cordyceps nabanheensisYFCC 8409Lepidoptera (larva)OL468564OL468584OL473532OL739578OL473543
Cordyceps nabanheensisYFCC 8410Lepidoptera (larva)OL468565OL468585OL473533OL739579OL473544
Cordyceps tenuipesARSEF 5135Lepidoptera (pupa)MF416612JF415980JF416020JN049896JF416000
Corniculantispora aphanocladiiCBS 797.84Agaricus bisporusKM283763KM283787KM283811KM283833KM283853
Corniculantispora psalliotaeCBS 101270SoilAF339607EF469081EF469066EF469095EF469113
Corniculantispora psalliotaeCBS 532.81SoilAF339609AF339560EF469067EF469096EF469112
Engyodontium parvisporumIHEM 22910Human bronchoscopy specimen-LC092915LC425558--
Engyodontium rectidentatumCBS 206.74Air-LC092912LC425553--
Engyodontium rectidentatumCBS 641.74Buried keratinous substance-LC092914LC425540--
Flavocillium bifurcatumYFCC 6101Lepidoptera; Noctuidae-MN576781MN576951MN576841MN576897
Gamszarea humicolaCGMCC3.19303SoilMK311231MK328997MK336027-MK335979
Gamszarea wallaceiCBS 101237 LepidopteraAY184978AY184967EF469073EF469102EF469119
Gibellula leiopusBCC16025Araneae MF416602MF416548MF416492MF416649-
Gibellula longisporaNHJ 12014Araneae EU369098-EU369017EU369055EU369075
Gibellula pulchraNHJ 10808Araneae EU369099EU369035EU369018EU369056EU369076
Hevansia minutaBCC 47519Araneae, Meotipa sp.-MZ684002MZ707811MZ707826MZ707833
Hevansia novoguineensisCBS 610.80Araneae -MH394646MH521885-MH521844
Hevansia novoguineensisNHJ 11923Araneae EU369095EU369032EU369013EU369052EU369072
Hevansia novoguineensisNHJ 13161Araneae EU369093-EU369011EU369050-
Jenniferia cinereaNHJ 03510Araneae, Amyciaea sp.EU369091GQ249970EU369009EU369048EU369070
Jenniferia thomisidarumBCC 37881Araneae, Diaea cf. dorsata-MZ684010MZ707823MZ707830MZ707843
Jenniferia thomisidarumBCC 37882Araneae, Diaea cf. dorsata-MZ684011MZ707824MZ707831MZ707844
Kanoksria zaquensisHMAS 246915Ophiocordyceps sinensisMT789701MT789697MT797812MT797810-
Kanoksria zaquensisHMAS 246917Ophiocordyceps sinensisMT789700MT789696MT797811MT797809-
Lecanicillium aranearumCBS 726.73aArachnidaAF339586AF339537EF468781EF468887EF468934
Lecanicillium araneogenumGZU1031LeaAraneae; spiderKX845705-KX845697KX845699KY845701
Lecanicillium araneosumKY11341Araneae; spider-ON502832ON525443-ON525442
Lecanicillium araneosumKY11342Araneae; spider-ON502837ON525445-ON525444
Lecanicillium attenuatumCBS 402.78Leaf litter (Acer saccharum)AF339614AF339565EF468782EF468888EF468935
Lecanicillium attenuatumCBS 170.76Lepidoptera; Carpocapsa OP752153OP762607OP762611OP762615
Lecanicillium attenuatumKACC 42493 -KM283756KM283780KM283804KM283826KM283846
Lecanicillium fusisporumCBS 164.70Coltricia perennisAF339598AF339549EF468783EF468889
Lecanicillium lecaniiCBS 101247Hemiptera; CoccidaeAF339604AF339555DQ522359DQ522407DQ522466
Lecanicillium lepidopterorumGZAC SD05151Lepidoptera (pupa)----MT727044
Lecanicillium longisporumCBS 102072 Macrosiphoniella sanborni (Hemiptera)KM283772KM283796KM283819KM283839KM283861
Lecanicillium longisporumCBS 126.27Hemiptera; MonophlebidaeKM283773KM283797KM283820KM283840KM283862
Lecanicillium muscariumCBS 143.62Hemiptera; AleyrodidaeKM283774KM283798KM283821KM283841KM283863
Lecanicillium neocoleopterorumGY11242Coleoptera; ladybug--MN097815MN097817MN097814
Lecanicillium neocoleopterorumGY11241Coleoptera; ladybug--MN097813MN097816MN097812
Lecanicillium pissodisBBC7Heteroptera (Corythucha arcuata)MT004819MT004835MT027503MT027506MT027509
Lecanicillium pissodisCBS 118231Pissodes strobi adultKM283775KM283799KM283822KM283842KM283864
Lecanicillium sabanenseANDES-F 1024Hemiptera; CoccidaeKC633251KC875225KC633266-KC633249
Lecanicillium uredinophilumCEP 054Hemiptera (Trialeurodes vaporariorum)-OP752150MH062184OP762608OP762612
Lecanicillium uredinophilumCEP 057Hemiptera (Trialeurodes vaporariorum)-OP752151MH062186OP762609OP762613
Lecanicillium uredinophilumCEP 108Hemiptera (Myzus persicae)-OP752152MH062188OP762610OP762614
Liangia sinensisYFCC3103FungiMN576726MN576782MN576952MN576842MN576898
Liangia sinensisYFCC3104FungiMN576727MN576783MN576953MN576843MN576899
Liangia sinensisCGMCC3.25667Ophiocordycepsglobiceps on DipteraPP177399PP179398PP464672PP464635PP482036
Liangia sinensisCGMCC3.25668Ophiocordycepsglobiceps on DipteraPP177400PP179399PP464673PP464636PP482037
Neohyperdermium piperisCBS 116719Hemiptera-AY466442DQ118749DQ127240EU369083
Neohyperdermium pulvinatumP.C. 602Hemiptera-DQ118738DQ118746DQ127237-
Neotorrubiella chinghridicolaBCC 39684Orthopterida-MK632096MK632071MK632181MK632148
Neotorrubiella chinghridicolaBCC 80733Orthopterida-MK632097MK632072MK632176MK632149
Niveomyces albusBCC 74477Ophiocordyceps sp. on Arachnida (Araneae)-ON103158ON125016ON286877ON125028
Niveomyces albusBCC 83025Ophiocordyceps sp. on Diptera-ON103157ON125015ON286876ON125027
Niveomyces coronatusNY 04434800Ophiocordyceps camponoti-floridaniON493547ON493606ON513397ON513399ON513400
Niveomyces formicidarumBCC 79346Ophiocordyceps sp. on Hymenoptera-ON103160ON125018ON286878ON125030
Niveomyces formicidarumBCC 83026Ophiocordyceps sp. on Hymenoptera-ON103161ON125019ON286879-
Niveomyces hirsutellaeBCC 36631Ophiocordyceps sp. on Hemiptera-ON103164ON125022ON286882ON125033
Niveomyces hirsutellaeBCC 36632Ophiocordyceps sp. on Hemiptera-ON103165ON125023ON286883ON125034
Niveomyces hirsutellaeBCC 78482Ophiocordyceps sp. on Hemiptera-ON103166ON125024ON286884ON125035
Niveomyces insectorumCBS 756.73Palthothyreus tarsatus in Rubiaceae, associated with Gibellula formicarum-ON103169ON125026ON286887ON125038
Niveomyces multisynnematusBCC 90307Ophiocordyceps sp. on Hemiptera-ON103162ON125020ON286880ON125031
Niveomyces multisynnematusBCC 90308Ophiocordyceps sp. on Hemiptera-ON103163ON125021ON286881ON125032
Niveomyces multisynnematusCGMCC3.25670Ophiocordyceps sp. on DipteraPP177379PP179401PP464674PP464637PP464651
Niveomyces multisynnematusCGMCC3.25672Ophiocordyceps sp. on DipteraPP177380PP179403PP464675PP464638PP464652
Parengyodontium albumCBS 368.72Soil-LC092910LC382183--
Parengyodontium albumCBS 504.83Human brain abscess-LC092899LC382177--
Pleurodesmospora lepidopterorumDY 10501Lepidoptera--MW834317MW834315MW834316
Pleurodesmospora lepidopterorumDY 10502Lepidoptera--MW834319-MW834318
Polystromomyces araneaeBCC 93301Arachnida-MZ684016MZ707825MZ707832MZ707845
Pseudogibellula formicarumBCC 84257Ophiocordyceps flavida-MT512653MT533480MT533473-
Pseudogibellula formicarumCBS 433.73Palthothyreus tarsatus-MH872442MT533481MT533475-
Pseudoniveomyces blattaeBCC 53567Blattodea-ON103167-ON286885ON125036
Pseudoniveomyces blattaeBCC 53568Blattodea-ON103168ON125025ON286886ON125037
Samsoniella alboaurantiumCBS 240.32Lepidoptera (pupa)JF415958JF415979JF416019JN049895JF415999
Samsoniella alboaurantiumCBS 262.58SoilAB080087MH869308MF416497MF416654MF416448
Samsoniella alpinaYFCC 5818Hepialidae (Hepialus baimaensis)MN576753MN576809MN576979MN576869MN576923
Samsoniella alpinaYFCC 5831Hepialidae (Hepialus baimaensis)MN576754MN576810MN576980MN576870MN576924
Samsoniella anhuiensisRCEF2590Araneae; spiderOR978313OR978316OR966516OR989964-
Samsoniella anhuiensisRCEF2830Araneae; spiderOM268843OM268848OM483864OM751889-
Samsoniella antleroidesYFCC 6016Noctuidae (larvae) MN576747MN576803MN576973MN576863MN576917
Samsoniella antleroidesYFCC 6113Noctuidae (larvae) MN576748MN576804MN576974MN576864MN576918
Samsoniella araneaRCEF2831Araneae; spiderOM268844OM268849OM483865OM751882OM802500
Samsoniella araneaRCEF2868Araneae; spiderOM268845OM268850OM483866OM751883OM802501
Samsoniella araneaRCEF2870Araneae; spiderOR978314OR978317OR966517OR989965OR989966
Samsoniella aurantiaTBRC 7271Lepidoptera-MF140728MF140846MF140791MF140818
Samsoniella aurantiaTBRC 7273Lepidoptera-MF140726MF140844-MF140816
Samsoniella cardinalisYFCC 5830Limacodidae (pupa) MN576732MN576788MN576958MN576848MN576902
Samsoniella cardinalisYFCC 6144Limacodidae (pupa) MN576730MN576786MN576956MN576846MN576900
Samsoniella cardinalisYFCC 6320Limacodidae (pupa)MN576731MN576787MN576957MN576847MN576901
Samsoniella coccinellidicolaYFCC 8772CoccinellidaeON563166ON621670ON676514ON676502ON568685
Samsoniella coccinellidicolaYFCC 8773CoccinellidaeON563167ON621671ON676515ON676503ON568686
Samsoniella coleopterorumA19501Curculionidae (Snout beetle) --MN101586MT642600MN101585
Samsoniella coleopterorumGY407201Lepidoptera (larvae)-MZ827010MZ855233-MZ855239
Samsoniella cristataYFCC 6023Saturniidae (pupa)MN576736MN576792MN576962MN576852MN576906
Samsoniella cristataYFCC 7004Saturniidae (pupa)MN576737MN576793MN576963MN576853MN576907
Samsoniella duyunensisDY07501Formicidae (Ant)-OR263307OR282780OR282773OR282776
Samsoniella duyunensisDY09161Lepidoptera (pupa)-OQ363112OQ398145OR296698OQ397660
Samsoniella erucaeKY11121 Lepidoptera (Caterpillar)-ON502835ON525425-ON525424
Samsoniella erucaeKY11122Lepidoptera (Caterpillar)-ON502822ON525427-ON525426
Samsoniella farinosporaYFCC 8774Araneae; spiderON563168ON621672ON676516ON676504ON568687
Samsoniella farinosporaYFCC 9051Lepidoptera; HepialusON563169ON621673ON676517ON676505ON568688
Samsoniella fusiformisporaRCEF5406Araneae; spiderOM268846OM268851OM483867OM751890-
Samsoniella hanianaYFCC 8769Lepidoptera (pupa)ON563170ON621674ON676518ON676506ON568689
Samsoniella hanianaYFCC 8770Lepidoptera (pupa)ON563171ON621675ON676519ON676507ON568690
Samsoniella hepialiCor-4Fungi (Ophiocordyceps sinensis)MN576743MN576799MN576969MN576859MN576913
Samsoniella hepialiICMM 82-2Fungi (Ophiocordyceps sinensis)MN576738MN576794MN576964MN576854MN576908
Samsoniella hepialiYFCC 7024LepidopteraMN576741MN576797MN576967MN576857MN576911
Samsoniella hymenopterorumA19521Vespidae (Bee)--MN101588MT642601MT642604
Samsoniella hymenopterorumA19522Vespidae (Bee)--MN101591MN101589MN101590
Samsoniella inthanonensisTBRC 7915Lepidoptera (pupa)-MF140725MF140849MF140790MF140815
Samsoniella kunmingensisYHH 16002Lepidoptera (pupa)MN576746MN576802MN576972MN576862MN576916
Samsoniella lanmaoaYFCC 6148Lepidoptera (pupa)MN576733MN576789MN576959MN576849MN576903
Samsoniella lanmaoaYFCC 6193Lepidoptera (pupa)MN576734MN576790MN576960MN576850MN576904
Samsoniella lasiocampidarumNTUPPMCC 20-061Lepidoptera (larva)-MT974364MW200220MW200229-
Samsoniella lasiocampidarumNTUPPMCC 20-062Lepidoptera (larva)-MT974361MW200218MW200227MW200236
Samsoniella neopupicolaKY11321Lepidoptera (pupa)-ON502839ON525433-ON525432
Samsoniella neopupicolaKY11322Lepidoptera (pupa)-ON502833ON525435-ON525434
Samsoniella pseudotortricidaeYFCC 9052Lepidoptera (pupa)ON563173ON621677ON676521ON676509ON568692
Samsoniella pseudotortricidaeYFCC 9053Lepidoptera (pupa)ON563174ON621678ON676522ON676510ON568693
Samsoniella pupicolaDY101681Lepidoptera (pupa)-MZ827009MZ855231-MZ855237
Samsoniella pupicolaDY101682Lepidoptera (pupa)-MZ827635MZ855232-MZ855238
Samsoniella ramosaYFCC 6020Lepidoptera (pupa)MN576749MN576805MN576975MN576865MN576919
Samsoniella sanmingenseCGMCC3.25661Lepidoptera (larva)PP177395PP179392PP482033PP464664PP464647
Samsoniella sanmingenseCGMCC3.25662Lepidoptera (larva)PP177396PP179393PP482034PP464665PP464648
Samsoniella sinensisYFCC 8766Lepidoptera (larvae)ON563175ON621679ON676523ON676511ON568694
Samsoniella sinensisYFCC 8767DermapteraON563176ON621680ON676524ON676512ON568695
Samsoniella tiankengensisKY11741Lepidoptera (pupa)-ON502838ON525437-ON525436
Samsoniella tiankengensisKY11742Lepidoptera (pupa)-ON502841ON525439-ON525438
Samsoniella tortricidaeYFCC 6013Lepidoptera (pupa)MN576751MN576807MN576977MN576867MN576921
Samsoniella tortricidaeYFCC 6131Lepidoptera (pupa)MN576750MN576806MN576976MN576866MN576920
Samsoniella vallisDY07241Lepidoptera (pupa)-OR263306OR282778OR282772OR282774
Samsoniella vallisDY07242Lepidoptera (pupa)-OR263308OR282779-OR282775
Samsoniella winandaeTBRC 17511 Lepidoptera (Cocoon)-OM491231OM687896OM687901OM687899
Samsoniella winandaeTBRC 17512Lepidoptera (pupa)-OM491232OM687897OM687902OM687900
Samsoniella yuanzuiensisNTUPPMCC 20-065 Lepidoptera (pupa)-MT974360MW200217MW200226MW200235
Samsoniella yunnanensisYFCC 1527Fungi (Cordyceps cicadae)MN576756MN576812MN576982MN576872MN576926
Samsoniella yunnanensisYFCC 1824Fungi (Cordyceps cicadae)MN576757MN576813MN576983MN576873MN576927
Simplicillium lamellicolaCBS 116.25Soil AF339601AF339552DQ522356DQ522404DQ522462
Simplicillium lanosoniveumCBS 101267Fungi (Hemileia vastatrix)AF339603AF339554DQ522357DQ522405DQ522463
Simplicillium lanosoniveumCBS 704.86Fungi (Hemileia vastatrix)AF339602AF339553DQ522358DQ522406DQ522464
Simplicillium obclavatumCBS 311.74Air above sugarcane fieldAF339567AF339517EF468798--
Trichoderma deliquescensATCC 208838On decorticated conifer woodAF543768AF543791AF543781AY489662DQ522446
Trichoderma stercorariumATCC 62321Cow dungAF543769AF543792AF543782AY489633EF469103
Zouia cauligalbarumGZUIFRZHJ01Lepidoptera (Stemborer)MH730665MH730667MH801920MH801922MH801924
Zouia cauligalbarumGZUIFRZHJ02Lepidoptera (Stemborer)MH730666MH730668MH801921MH801923MH801925
Note: Newly generated sequences are in bold.
Table 3. Bayesian estimates of divergence times (Mya), including 95% posterior density (HPD) and Bayesian posterior probabilities (BYPP), for the major 33 nodes in Figure 2.
Table 3. Bayesian estimates of divergence times (Mya), including 95% posterior density (HPD) and Bayesian posterior probabilities (BYPP), for the major 33 nodes in Figure 2.
NodeMean (Mya)/95% HPD (Mya)/BYPPNodeMean (Mya)/95% HPD (Mya)/BYPP
1133.64/125.06–142.88/1.001848.44/44.71–52.18/1.00
2103.80/94.70–112.91/1.001946.32/42.74–50.13/-
3101.99/100.99–102.95/1.002045.95/33.86–58.83/1.00
495.25/90.35–99.62/-2144.90/39.67–50.59/0.99
588.91/83.36–95.03/12244.24/42.74–50.13/-
681.44/76.23–86.67/1.002343.17/38.55–47.96/1.00
777.42/72.36–82.89/-2443.07/39.90–46.44/0.95
875.82/70.02–81.86/-2540.98/36.32–45.92/1.00
973.34/66.20–80.29/-2639.56/36.33–42.85/1.00
1070.81/64.51–77.00/1.002734.57/31.41–37.67/1.00
1163.57/58.85–68.69/-2834.11/25.41–42.93/-
1261.85/56.28–67.78/12929.32/26.68–31.97/1.00
1360.78/55.31–66.35/13026.70/21.42–31.96/-
1459.24/54.54–64.03/-3122.46/20.04–24.96/1.00
1557.53/51.65–63.41/-3220.50/18.40–22.81/0.93
1652.26/47.14–57.94/13316.43/12.76–20.03/0.97
1748.64/42.96–54.84/-
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pu, H.; Yang, J.; Keyhani, N.O.; Yang, L.; Zheng, M.; Qiu, C.; Mao, Y.; Shang, J.; Lin, Y.; Xiong, C.; et al. Molecular Phylogenetics and Estimation of Evolutionary Divergence and Biogeography of the Family Cordycipitaceae (Ascomycota, Hypocreales). J. Fungi 2025, 11, 28. https://doi.org/10.3390/jof11010028

AMA Style

Pu H, Yang J, Keyhani NO, Yang L, Zheng M, Qiu C, Mao Y, Shang J, Lin Y, Xiong C, et al. Molecular Phylogenetics and Estimation of Evolutionary Divergence and Biogeography of the Family Cordycipitaceae (Ascomycota, Hypocreales). Journal of Fungi. 2025; 11(1):28. https://doi.org/10.3390/jof11010028

Chicago/Turabian Style

Pu, Huili, Jiao Yang, Nemat O. Keyhani, Lixia Yang, Minhai Zheng, Chenghao Qiu, Yuchen Mao, Junya Shang, Yongsheng Lin, Chengjie Xiong, and et al. 2025. "Molecular Phylogenetics and Estimation of Evolutionary Divergence and Biogeography of the Family Cordycipitaceae (Ascomycota, Hypocreales)" Journal of Fungi 11, no. 1: 28. https://doi.org/10.3390/jof11010028

APA Style

Pu, H., Yang, J., Keyhani, N. O., Yang, L., Zheng, M., Qiu, C., Mao, Y., Shang, J., Lin, Y., Xiong, C., Lin, L., Lai, P., Huang, Y., Yuan, X., Liang, H., Fan, L., Ma, X., Qiu, C., & Qiu, J. (2025). Molecular Phylogenetics and Estimation of Evolutionary Divergence and Biogeography of the Family Cordycipitaceae (Ascomycota, Hypocreales). Journal of Fungi, 11(1), 28. https://doi.org/10.3390/jof11010028

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop