Isolation of Antagonistic Endophytic Fungi from Postharvest Chestnuts and Their Biocontrol on Host Fungal Pathogens
Abstract
1. Introduction
2. Materials and Methods
2.1. Fruits and Pathogens
2.2. Isolation of Endophytic Fungi
2.3. Identification of the Fungal Isolates
2.4. Determination of the Pathogenicity of Endophytic Fungi
2.5. Evaluation of Antagonistic Activity of Endophytic Fungi against N. parvum
2.6. Determination of Antifungal Activity of Three Organic Phase Extracts of Endophytic and Endophytic Fungal Fermentation Broths
2.7. Effect of Culture Filtrate from Antagonistic Endophytic Fungi on Disease Severity of Chestnuts Caused by N. parvum
2.8. The Effect of Antagonistic Endophytic Fungi on Chestnut Fruit Decay during Storage
2.9. Statistical Analysis
3. Results
3.1. Isolation of Non-Pathogenetic Endophytic Fungi from Postharvest Chestnuts
3.2. Antagonistic Activity of the Non-Pathogenetic Endophytic Fungi against N. parvum
3.3. The Identification of Antagonistic Endophytic Fungi
3.4. Antifungal Activity of Fungal Culture Filtrate Extracts from NS-3 and NS-38 against N. parvum
3.5. Effects of Culture Filtrate from NS-3, NS-38, and NS-3-38 on Disease Severity of Chestnuts Caused by N. parvum
3.6. Effects of the Culture Filtrate from NS-3, NS-38, and NS-3-38 on Fruit Decay and Weight Loss of Chestnuts during Storage
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Santos, M.J.; Pinto, T.; Vilela, A. Sweet Chestnut (Castanea sativa Mill.) Nutritional and Phenolic Composition Interactions with Chestnut Flavor Physiology. Foods 2022, 11, 4052. [Google Scholar] [CrossRef]
- Jiang, N.; Liang, L.-Y.; Tian, C.-M. Gnomoniopsis chinensis (Gnomoniaceae, Diaporthales), a new fungus causing canker of Chinese chestnut in Hebei Province, China. MycoKeys 2020, 67, 19–32. [Google Scholar] [CrossRef]
- Donis-González, I.R.; Guyer, D.E.; Fulbright, D.W. Quantification and identification of microorganisms found on shell and kernel of fresh edible chestnuts in Michigan. J. Sci. Food Agric. 2016, 98, 354–363. [Google Scholar] [CrossRef]
- Bastianelli, G.; Morales-Rodríguez, C.; Caccia, R.; Turco, S.; Rossini, L.; Mazzaglia, A.; Thomidis, T.; Vannini, A. Use of Phosphonate Salts to Control Chestnut ‘Brown Rot’ by Gnomoniopsis castaneae in Fruit Orchards of Castanea sativa. Agronomy 2022, 12, 2434. [Google Scholar] [CrossRef]
- Silva-Campos, M.; Islam, M.T.; Cahill, D.M. Fungicide control of Gnomoniopsis smithogilvyi, causal agent of chestnut rot in Australia. Australas. Plant Path 2022, 51, 483–494. [Google Scholar] [CrossRef]
- Dahiya, D.; Sharma, H.; Rai, A.K.; Nigam, P.S. Application of biological systems and processes employing microbes and algae to Reduce, Recycle, Reuse (3Rs) for the sustainability of circular bioeconomy. AIMS Microbiol. 2022, 8, 83. [Google Scholar] [CrossRef]
- Holkar, S.K.; Ghotgalkar, P.S.; Lodha, T.D.; Bhanbhane, V.C.; Shewale, S.A.; Markad, H.; Shabeer, A.T.P.; Saha, S. Biocontrol potential of endophytic fungi originated from grapevine leaves for management of anthracnose disease caused by Colletotrichum gloeosporioides. 3 Biotech 2023, 13, 258. [Google Scholar] [CrossRef]
- Aktepe, B.P.; Aysan, Y. Biological Control of Fire Blight Disease Caused by Erwinia amylovora on Apple. Erwerbs-Obstbau 2022, 65, 645–654. [Google Scholar] [CrossRef]
- Muhammad, M.; Basit, A.; Ali, K.; Ahmad, H.; Li, W.-j.; Khan, A.; Mohamed, H.I. A review on endophytic fungi: A potent reservoir of bioactive metabolites with special emphasis on blight disease management. Arch. Microbiol. 2024, 206, 129. [Google Scholar] [CrossRef]
- Elkady, W.M.; Raafat, M.M.; Abdel-Aziz, M.M.; Al-Huqail, A.A.; Ashour, M.L.; Fathallah, N. Endophytic Fungus from Opuntia ficus-indica: A Source of Potential Bioactive Antimicrobial Compounds against Multidrug-Resistant Bacteria. Plants 2022, 11, 1070. [Google Scholar] [CrossRef]
- Liu, Y.; Ponpandian, L.N.; Kim, H.; Jeon, J.; Hwang, B.S.; Lee, S.K.; Park, S.-C.; Bae, H. Distribution and diversity of bacterial endophytes from four Pinus species and their efficacy as biocontrol agents for devastating pine wood nematodes. Sci. Rep. 2019, 9, 12461. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Nie, J.; Li, Z.; Li, H.; Wu, Y.; Dong, Y.; Zhang, J. Differentiated surface fungal communities at point of harvest on apple fruits from rural and peri-urban orchards. Sci. Rep. 2018, 8, 2165. [Google Scholar] [CrossRef]
- Grabka, R.; d’Entremont, T.W.; Adams, S.J.; Walker, A.K.; Tanney, J.B.; Abbasi, P.A.; Ali, S. Fungal Endophytes and Their Role in Agricultural Plant Protection against Pests and Pathogens. Plants 2022, 11, 384. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Ruan, C.; Yi, L.; Deng, L.; Yao, S.; Zeng, K. Biocontrol ability and action mechanism of Metschnikowia citriensis against Geotrichum citri-aurantii causing sour rot of postharvest citrus fruit. Food Microbiol. 2019, 87, 103375. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Yang, S.Z.; Peng, L.T.; Zeng, K.F.; Feng, B.R.; Jingjing, Y. Compositional shifts in fungal community of chestnuts during storage and their correlation with fruit quality. Postharvest Biol. Technol. 2022, 191, 11983. [Google Scholar] [CrossRef]
- Yu, S.; Qiya, Y.; Qidi, Z.; Qianhua, Z.; Esa Abiso, G.; Xiaoyun, Z.; Siqi, Z.; Hongyin, Z. The preharvest application of Aureobasidium pullulans S2 remodeled the microbiome of tomato surface and reduced postharvest disease incidence of tomato fruit. Postharvest Biol. Technol. 2022, 194, 112101. [Google Scholar] [CrossRef]
- Prencipe, S.; Siciliano, I.; Gatti, C.; Garibaldi, A.; Gullino, M.L.; Botta, R.; Spadaro, D. Several species of Penicillium isolated from chestnut flour processing are pathogenic on fresh chestnuts and produce mycotoxins. Food Microbiol. 2018, 76, 396–404. [Google Scholar] [CrossRef] [PubMed]
- Murolo, S.; Concas, J.; Romanazzi, G. Use of biocontrol agents as potential tools in the management of chestnut blight. Biol. Control 2019, 132, 102–109. [Google Scholar] [CrossRef]
- Akone, S.H.; Mándi, A.; Kurtán, T.; Hartmann, R.; Lin, W.H.; Daletos, G.; Proksch, P. Inducing secondary metabolite production by the endophytic fungus Chaetomium sp. through fungal-bacterial co-culture and epigenetic modification. Tetrahedron 2016, 72, 6340–6347. [Google Scholar] [CrossRef]
- Dennert, F.G.; Broggini, G.A.; Gessler, C.; Storari, M. Gnomoniopsis castanea is the main agent of chestnut nut rot in Switzerland. Phytopathol. Mediterr. 2015, 54, 199–211. [Google Scholar] [CrossRef]
- Cisterna-Oyarce, V.; Carrasco-Fernández, J.; Castro, J.F.; Santelices, C.; Muñoz-Reyes, V.; Millas, P.; Buddie, A.G.; France, A. Identification, characterization and incidence of the main pathogen causing brown rot in postharvest sweet chestnut fruits in Chile. Australas. Plant Dis. 2022, 17, 2. [Google Scholar] [CrossRef]
- Trapiello, E.; Feito, I.; González, A.J. First Report of Gnomoniopsis castaneae Causing Canker on Hybrid Plants of Castanea sativa × C. crenata in Spain. Plant Dis. 2018, 102, 1040. [Google Scholar] [CrossRef]
- Short, D.P.; Double, M.; Nuss, D.L.; Stauder, C.M.; MacDonald, W.; Kasson, M.T. Multilocus PCR Assays Elucidate Vegetative Incompatibility Gene Profiles of Cryphonectria parasitica in the United States. Appl. Environ. Microbiol. 2015, 81, 5736–5742. [Google Scholar] [CrossRef] [PubMed]
- Çakar, D. Significance of Gnomoniopsis smithogilvyi as kernel rot of sweet chestnut in Turkey. J. Phytopathol. 2024, 172, e13293. [Google Scholar] [CrossRef]
- Dobry, E.; Campbell, M. Gnomoniopsis castaneae: An emerging plant pathogen and global threat to chestnut systems. Plant Pathol. 2023, 72, 218–231. [Google Scholar] [CrossRef]
- Meyer, J.B.; Gallien, L.; Prospero, S. Interaction between two invasive organisms on the European chestnut: Does the chestnut blight fungus benefit from the presence of the gall wasp? FEMS Microbiol. Ecol. 2015, 91, 122. [Google Scholar] [CrossRef]
- Seddaiu, S.; Mello, A.; Sechi, C.; Cerboneschi, A.; Linaldeddu, B.T. First Report of Neofusicoccum parvum Associated with Chestnut Nut Rot in Italy. Plant Dis. 2021, 105, 3743. [Google Scholar] [CrossRef]
- Waqas, M.; Guarnaccia, V.; Spadaro, D. First Report of Nut Rot Caused by Neofusicoccum parvum on Hazelnut (Corylus avellana) in Italy. Plant Dis. 2022, 106, 1987. [Google Scholar] [CrossRef] [PubMed]
- Zhu, F.; Xiao, J.; Zhang, Y.; Wei, L.; Liang, Z. Dazomet application suppressed watermelon wilt by the altered soil microbial community. Sci. Rep. 2020, 10, 21668. [Google Scholar] [CrossRef]
- Samson, R.A.; Visagie, C.M.; Houbraken, J.; Hong, S.-B.; Hubka, V.; Klaassen, C.H.; Perrone, G.; Seifert, K.A.; Susca, A.; Tanney, J.B. Phylogeny, identification and nomenclature of the genus Aspergillus. Stud. Mycol. 2014, 78, 141–173. [Google Scholar] [CrossRef]
- Nouri, M.T.; Lawrence, D.P.; Holland, L.A.; Doll, D.A.; Kallsen, C.E.; Culumber, C.M.; Trouillas, F.P. Identification and Pathogenicity of Fungal Species Associated with Canker Diseases of Pistachio in California. Plant Dis. 2019, 103, 2397–2411. [Google Scholar] [CrossRef] [PubMed]
- Ebrahimi, L.; Hatami Rad, S.; Etebarian, H.R. Apple Endophytic fungi and their antagonism against apple scab disease. Front. Microbiol. 2022, 13, 1024001. [Google Scholar] [CrossRef] [PubMed]
- Fantinel, V.S.; Muniz, M.F.B.; Baptista, P.; Santos, S.; Pereira, J.A.; Martins, F.; Ciotta, M.N.; Poletto, T.; da Silva, J.C.P. Endophytic fungal communities isolated from two genotypes of feijoa fruits (Feijoa sellowiana O. Berg.) and prospection of potential agents against anthracnose pathogens. Biol. Control 2023, 184, 105288. [Google Scholar] [CrossRef]
- Zoran, T.; Sartori, B.; Sappl, L.; Aigner, M.; Sánchez-Reus, F.; Rezusta, A.; Chowdhary, A.; Taj-Aldeen, S.J.; Arendrup, M.C.; Oliveri, S.; et al. Azole-Resistance in Aspergillus terreus and Related Species: An Emerging Problem or a Rare Phenomenon. Front. Microbiol. 2018, 9, 516. [Google Scholar] [CrossRef] [PubMed]
- Kumari, R.; Goldar, W.A.; Mondal, S.; Patra, S.; Bhattacharya, S.; Haldar, P.K. Protective effect of Basella alba leaf against diabetic nephropathy in rats. Adv. Tradit. Med. 2020, 21, 111–119. [Google Scholar] [CrossRef]
- Syamsia, S.S.; Abubakar, A.I.; Amanda, A.P.F.; Noerfitryani, N.N.; Iradhatullah, I.R.; Henry, H.K.; Rakhmad, R.A. Combination on endophytic fungal as the Plant Growth-Promoting Fungi (PGPF) on cucumber (Cucumis sativus). Biodiversitas 2021, 22, 1194–1202. [Google Scholar] [CrossRef]
- Yang, S.; Liu, L.; Li, D.; Xia, H.; Su, X.; Peng, L.; Pan, S. Use of active extracts of poplar buds against Penicillium italicum and possible modes of action. Food Chem. 2015, 196, 610–618. [Google Scholar] [CrossRef] [PubMed]
- Silva, S.; da Costa, H.; Lopes, T.; Ramos, V.; Rodrigues, N.; Alberto Pereira, J.; Lino-Neto, T.; Baptista, P. Potential of the endophyte Penicillium commune in the control of olive anthracnose via induction of antifungal volatiles in host plant. Biol. Control 2023, 187, 105373. [Google Scholar] [CrossRef]
- Ting, A.S.Y.; Mah, S.W.; Tee, C.S. Evaluating the feasibility of induced host resistance by endophytic isolate Penicillium citrinum BTF08 as a control mechanism for Fusarium wilt in banana plantlets. Biol. Control 2012, 61, 155–159. [Google Scholar] [CrossRef]
- Brinkmann, N.; Schneider, D.; Sahner, J.; Ballauff, J.; Edy, N.; Barus, H.; Irawan, B.; Budi, S.W.; Qaim, M.; Daniel, R.; et al. Intensive tropical land use massively shifts soil fungal communities. Sci. Rep. 2019, 9, 3403. [Google Scholar] [CrossRef]
- Sangster, W.; Hegarty, J.P.; Schieffer, K.M.; Wright, J.R.; Hackman, J.; Toole, D.R.; Lamendella, R.; Stewart, D.B., Sr. Bacterial and Fungal Microbiota Changes Distinguish C. difficile Infection from Other Forms of Diarrhea: Results of a Prospective Inpatient Study. Front. Microbiol. 2016, 7, 789. [Google Scholar] [CrossRef] [PubMed]
- Farha, A.K.; Hatha, A.M. Bioprospecting potential and secondary metabolite profile of a novel sediment-derived fungus Penicillium sp. ArCSPf from continental slope of Eastern Arabian Sea. Mycology 2019, 10, 109–117. [Google Scholar] [CrossRef] [PubMed]
- Vieira, G.; Sette, L.D.; de Angelis, D.A.; Sass, D.C. Antifungal activity of cyclopaldic acid from Antarctic Penicillium against phytopathogenic fungi. 3 Biotech 2023, 13, 374. [Google Scholar] [CrossRef] [PubMed]
- Abro, M.A.; Sun, X.; Li, X.; Jatoi, G.H.; Guo, L.-D. Biocontrol Potential of Fungal Endophytes against Fusarium oxysporum f. sp. cucumerinum Causing Wilt in Cucumber. Plant Pathol. J. 2019, 35, 598–608. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Shi, J.; Wang, Y.; Yang, K.; Zhao, X.; Wang, G.; Xu, D.; Wang, Y.; Yao, J.; Fu, W. Label-free bacterial colony detection and viability assessment by continuous-wave terahertz transmission imaging. J. Biophotonics 2018, 11, e201700386. [Google Scholar] [CrossRef] [PubMed]
- Hallas-Møller, M.; Nielsen, K.F.; Frisvad, J.C. Secondary metabolite production by cereal-associated penicillia during cultivation on cereal grains. Appl. Microbiol. Biotechnol. 2018, 102, 8477–8491. [Google Scholar] [CrossRef] [PubMed]
- Le, H.M.T.; Do, Q.T.; Doan, M.H.T.; Vu, Q.T.; Nguyen, M.A.; Vu, T.H.T.; Nguyen, H.D.; Duong, N.T.T.; Tran, M.H.; Chau, V.M.; et al. Chemical Composition and Biological Activities of Metabolites from the Marine Fungi Penicillium sp. Isolated from Sediments of Co To Island, Vietnam. Molecules 2019, 24, 3830. [Google Scholar] [CrossRef]
- Lindsay, C.A.; Kinghorn, A.D.; Rakotondraibe, H.L. Bioactive and unusual steroids from Penicillium fungi. Phytochemistry 2023, 11, 113638. [Google Scholar] [CrossRef] [PubMed]
- Deshmukh, S.K.; Dufosse, L.; Chhipa, H.; Saxena, S.; Mahajan, G.B.; Gupta, M.K. Fungal Endophytes: A Potential Source of Antibacterial Compounds. J. Fungi 2022, 8, 164. [Google Scholar] [CrossRef]
- Toghueo, R.M.K.; Boyom, F.F. Endophytic Penicillium species and their agricultural, biotechnological, and pharmaceutical applications. 3 Biotech 2020, 10, 107. [Google Scholar] [CrossRef]
- Zang, Y.; Gong, Y.-H.; Li, X.-W.; Li, X.-N.; Liu, J.-J.; Chen, C.-M.; Zhou, Y.; Gu, L.-H.; Luo, Z.-W.; Wang, J.-P.; et al. Canescones A–E: Aromatic polyketide dimers with PTP1B inhibitory activity from Penicillium canescens. Org. Chem. Front. 2019, 6, 3274–3281. [Google Scholar] [CrossRef]
- Zhou, H.; Li, L.; Wu, C.; Kurtán, T.; Mándi, A.; Liu, Y.; Gu, Q.; Zhu, T.; Guo, P.; Li, D. Penipyridones A–F, Pyridone Alkaloids from Penicillium funiculosum. J. Nat. Prod. 2016, 79, 1783–1790. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Peng, Q.; Ji, Y.; Xie, A.; Yang, L.; Mu, S.; Li, Z.; He, T.; Xiao, Y.; Zhao, J.; et al. Isolation and Identification of Antibacterial Bioactive Compounds From Bacillus Megaterium L2. Front. Microbiol. 2021, 12, 645484. [Google Scholar] [CrossRef] [PubMed]
- Al-Saleem, M.S.M.; Hassan, W.H.B.; El Sayed, Z.I.; Abdel-Aal, M.M.; Abdel-Mageed, W.M.; Abdelsalam, E.; Abdelaziz, S. Metabolic Profiling and In Vitro Assessment of the Biological Activities of the Ethyl Acetate Extract of Penicillium chrysogenum “Endozoic of Cliona sp. Marine Sponge” from the Red Sea (Egypt). Mar. Drugs 2022, 20, 326. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Chang, P.; Gao, L.; Wang, X. The Endophytic Fungus Albifimbria verrucaria from Wild Grape as an Antagonist of Botrytis cinerea and Other Grape Pathogens. Phytopathology 2020, 110, 843–850. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Zhuang, X.; Yin, Y.; Wu, D.; He, W.; Zhu, W.; Xu, Y.; Zuo, M.; Wang, L. Indole Diterpene Derivatives from the Aspergillus flavus GZWMJZ-288, an Endophytic Fungus from Garcinia multiflora. Molecules 2023, 8, 7931. [Google Scholar] [CrossRef] [PubMed]
- Alajlan, L.; Al Husnain, L.; AlKahtani, M.D.F.; orfali, R.; Ameen, F. Avicennia marina endophytic fungi shows antagonism against tomato pathogenic fungi. J. Saudi Soc. Agric. Sci. 2022, 22, 214–222. [Google Scholar] [CrossRef]
- Zhu, X.J.; Hu, Y.F.; Chen, X.; Wang, Y.H.; Fang, W.P.; Li, X.H. Endophytic fungi from Camellia sinensis show an antimicrobial activity against the rice blast pathogen Magnaporthe grisea. Phyton 2014, 83, 57. [Google Scholar] [CrossRef]






| Genetic Locus | Primer Name | Primer Sequence (5′-3′) |
|---|---|---|
| BenA | BT2a-F | GGTAACCAAATCGGTGCTGCTT |
| BT2a-R | ACCCTCAGTGTAGTGACCCTTGGC | |
| CaM | CMD5-F | CCGAGTACAAGGARGCCTTC |
| CMD6-R | CCGATRGAGGTCATRACGTGG | |
| ITS | ITS1 | TCCGTAGGTGAACCTGCGG |
| ITS4 | TCCTCCGCTTATTGATATGC |
| Strains | Inhibition Rate (%) | Strains | Inhibition Rate (%) |
|---|---|---|---|
| NS-3 | 51.85 ± 1.39 k | NS-38-43 | 76.67 ± 1.98 b |
| NS-38 | 69.26 ± 1.72 cde | NS-38-56 | 75.93 ± 0.26 b |
| NS-3-38 | 86.67 ± 0.45 a | NS-38-58 | 75.00 ± 2.36 bc |
| NS-11 | 44.07 ± 1.14 lm | NS-43-56 | 77.22 ± 1.64 b |
| NS-3-11 | 43.15 ± 1.83 mn | NS-43-58 | 76.11 ± 0.45 b |
| NS-43 | 59.26 ± 1.59 fj | NS-56-58 | 67.59 ± 3.28 de |
| NS-3-43 | 44.81 ± 5.02 lm | NS-3-38-11 | 55.37 ± 5.00 jk |
| NS-56 | 45.19 ± 4.12 lm | NS-3-38-43 | 36.48 ± 2.58 op |
| NS-3-56 | 56.30 ± 2.77 jk | NS-3-38-56 | 41.85 ± 3.86 no |
| NS-58 | 42.22 ± 0.45 mno | NS-3-38-58 | 65.93 ± 2.24 de |
| NS-3-58 | 50.00 ± 8.03 kj | NS-43-56-58 | 62.78 ± 1.57 ef |
| NS-11-38 | 75.93 ± 3.86 b | NS-56-58-11 | 36.85 ± 1.14 |
| NS-11-43 | 76.48 ± 2.10 b | NS-56-58-38 | 77.59 ± 2.58 b |
| NS-11-56 | 74.63 ± 1.39 bc | NS-56-58-43 | 72.41 ± 2.05 bcd |
| NS-11-58 | 69.07 ± 1.14 cde | NS-56-58-3 | 67.04 ± 0.69 cd |
| NS-F | 32.59 ± 4.89 p |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wen, Y.; Li, M.; Yang, S.; Peng, L.; Fan, G.; Kang, H. Isolation of Antagonistic Endophytic Fungi from Postharvest Chestnuts and Their Biocontrol on Host Fungal Pathogens. J. Fungi 2024, 10, 573. https://doi.org/10.3390/jof10080573
Wen Y, Li M, Yang S, Peng L, Fan G, Kang H. Isolation of Antagonistic Endophytic Fungi from Postharvest Chestnuts and Their Biocontrol on Host Fungal Pathogens. Journal of Fungi. 2024; 10(8):573. https://doi.org/10.3390/jof10080573
Chicago/Turabian StyleWen, Yunmin, Meng Li, Shuzhen Yang, Litao Peng, Gang Fan, and Huilin Kang. 2024. "Isolation of Antagonistic Endophytic Fungi from Postharvest Chestnuts and Their Biocontrol on Host Fungal Pathogens" Journal of Fungi 10, no. 8: 573. https://doi.org/10.3390/jof10080573
APA StyleWen, Y., Li, M., Yang, S., Peng, L., Fan, G., & Kang, H. (2024). Isolation of Antagonistic Endophytic Fungi from Postharvest Chestnuts and Their Biocontrol on Host Fungal Pathogens. Journal of Fungi, 10(8), 573. https://doi.org/10.3390/jof10080573

