Denovo Production of Resveratrol by Engineered Rice Wine Strain Saccharomyces cerevisiae HJ08 and Its Application in Rice Wine Brewing
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains, Media, and Culture Conditions
2.2. Plasmids and Strains Construction
2.3. Strains Cultivated in Shaking Flasks
2.4. Rice Wine Fermentation with Recombination Strain S. cerevisiae HJ08
2.5. Analytical Methods
3. Results and Discussion
3.1. Construction of the Resveratrol Biosynthesis Pathway in S. cerevisiae HJ
3.2. Evaluating Resveratrol Biosynthesis Fused Enzymes of Pc4CL-VvSTS
3.3. Alleviation of Tyrosine Feedback Inhibition for Further Enhancement of the Resveratrol Production
3.4. Batch Fermentation for Resveratrol Production
3.5. Resveratrol Production in Rice Wine Brewing
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Garcia-Alonso, A.; Sánchez-Paniagua López, M.; Manzanares-Palenzuela, C.L.; Redondo-Cuenca, A.; López-Ruíz, B. Edible plant by-products as source of polyphenols: Prebiotic effect and analytical methods. Crit. Rev. Food Sci. Nutr. 2023, 63, 10814–10835. [Google Scholar] [CrossRef] [PubMed]
- Tang, P.C.; Ng, Y.F.; Ho, S.; Gyda, M.; Chan, S.W. Resveratrol and cardiovascular health—Promising therapeutic or hopeless illusion? Pharmacol. Res. 2014, 90, 88–115. [Google Scholar] [CrossRef] [PubMed]
- Tian, B.; Liu, J. Resveratrol: A review of plant sources, synthesis, stability, modification and food application. J. Sci. Food Agric. 2020, 100, 1392–1404. [Google Scholar] [CrossRef]
- Tu, W.; Song, M.; Fan, X. Does resveratrol improve cognition in humans? A scientometric study to an in-depth review. CNS Neurosci. Ther. 2023, 29, 2413–2429. [Google Scholar] [CrossRef] [PubMed]
- Zheng, X.; Sun, K.; Liu, Y.; Yin, X.; Zhu, H.; Yu, F.; Zhao, W. Resveratrol-loaded macrophage exosomes alleviate multiple sclerosis through targeting microglia. J. Control. Release: Off. J. Control. Release Soc. 2023, 353, 675–684. [Google Scholar] [CrossRef] [PubMed]
- Breuss, J.M.; Atanasov, A.G.; Uhrin, P. Resveratrol and Its Effects on the Vascular System. Int. J. Mol. Sci. 2019, 20, 1523. [Google Scholar] [CrossRef] [PubMed]
- Nadile, M.; Retsidou, M.I.; Gioti, K.; Beloukas, A.; Tsiani, E. Resveratrol against Cervical Cancer: Evidence from In Vitro and In Vivo Studies. Nutrients 2022, 14, 5273. [Google Scholar] [CrossRef] [PubMed]
- Zhong, Z.; Guo, X.; Zheng, Y. Network Pharmacology-Based and Molecular Docking Analysis of Resveratrol’s Pharmacological Effects on Type I Endometrial Cancer. Anti-Cancer Agents Med. Chem. 2022, 22, 1933–1944. [Google Scholar] [CrossRef] [PubMed]
- Ratz-Łyko, A.; Arct, J. Resveratrol as an active ingredient for cosmetic and dermatological applications: A review. J. Cosmet. Laser Ther.: Off. Publ. Eur. Soc. Laser Dermatol. 2019, 21, 84–90. [Google Scholar] [CrossRef]
- Feng, C.; Chen, J.; Ye, W.; Liao, K.; Wang, Z.; Song, X.; Qiao, M. Synthetic Biology-Driven Microbial Production of Resveratrol: Advances and Perspectives. Front. Bioeng. Biotechnol. 2022, 10, 833920. [Google Scholar] [CrossRef]
- Ibrahim, G.G.; Yan, J.; Xu, L.; Yang, M.; Yan, Y. Resveratrol Production in Yeast Hosts: Current Status and Perspectives. Biomolecules 2021, 11, 830. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, S.Z.; Li, J.; Pan, X.; Cahoon, R.E.; Jaworski, J.G.; Wang, X.; Jez, J.M.; Chen, F.; Yu, O. Using unnatural protein fusions to engineer resveratrol biosynthesis in yeast and Mammalian cells. J. Am. Chem. Soc. 2006, 128, 13030–13031. [Google Scholar] [CrossRef]
- Zhang, M.; Gao, Q.; Liu, Y.; Fang, Z.; Gong, Z.; Zhao, Z.K.; Yang, X. Metabolic engineering of Rhodotorula toruloides for resveratrol production. Microb. Cell Factories 2022, 21, 270. [Google Scholar] [CrossRef] [PubMed]
- Sáez-Sáez, J.; Wang, G.; Marella, E.R.; Sudarsan, S.; Cernuda Pastor, M.; Borodina, I. Engineering the oleaginous yeast Yarrowia lipolytica for high-level resveratrol production. Metab. Eng. 2020, 62, 51–61. [Google Scholar] [CrossRef]
- Meng, L.; Diao, M.; Wang, Q.; Peng, L.; Li, J.; Xie, N. Efficient biosynthesis of resveratrol via combining phenylalanine and tyrosine pathways in Saccharomyces cerevisiae. Microb. Cell Factories 2023, 22, 46. [Google Scholar] [CrossRef]
- Liu, M.; Wang, C.; Ren, X.; Gao, S.; Yu, S.; Zhou, J. Remodelling metabolism for high-level resveratrol production in Yarrowia lipolytica. Bioresour. Technol. 2022, 365, 128178. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Hu, W.; Xia, Y.; Mu, Z.; Tao, L.; Song, X.; Zhang, H.; Ni, B.; Ai, L. Flavor Formation in Chinese Rice Wine (Huangjiu): Impacts of the Flavor-Active Microorganisms, Raw Materials, and Fermentation Technology. Front. Microbiol. 2020, 11, 580247. [Google Scholar] [CrossRef] [PubMed]
- Ren, N.; Gong, W.; Zhao, Y.; Zhao, D.G.; Xu, Y. Innovation in sweet rice wine with high antioxidant activity: Eucommia ulmoides leaf sweet rice wine. Front. Nutr. 2023, 9, 1108843. [Google Scholar] [CrossRef]
- Paramasivan, K.; Mutturi, S. Progress in terpene synthesis strategies through engineering of Saccharomyces cerevisiae. Crit. Rev. Biotechnol. 2017, 37, 974–989. [Google Scholar] [CrossRef]
- Chrzanowski, G. Saccharomyces cerevisiae-An Interesting Producer of Bioactive Plant Polyphenolic Metabolites. Int. J. Mol. Sci. 2020, 21, 7343. [Google Scholar] [CrossRef]
- Kim, J.; Hoang Nguyen Tran, P.; Lee, S.M. Current Challenges and Opportunities in Non-native Chemical Production by Engineered Yeasts. Front. Bioeng. Biotechnol. 2020, 8, 594061. [Google Scholar] [CrossRef] [PubMed]
- Gietz, R.D.; Schiestl, R.H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2007, 2, 31–34. [Google Scholar] [CrossRef] [PubMed]
- Khatri, D.; Chhetri, S.B.B. Reducing Sugar, Total Phenolic Content, and Antioxidant Potential of Nepalese Plants. BioMed Res. Int. 2020, 2020, 7296859. [Google Scholar] [CrossRef]
- Wang, Y.; Yi, H.; Wang, M.; Yu, O.; Jez, J.M. Structural and kinetic analysis of the unnatural fusion protein 4-coumaroyl-CoA ligase::stilbene synthase. J. Am. Chem. Soc. 2011, 133, 20684–20687. [Google Scholar] [CrossRef] [PubMed]
- Fink, T.; Stevović, B.; Verwaal, R.; Roubos, J.A.; Gaber, R.; Benčina, M.; Jerala, R.; Gradišar, H. Metabolic enzyme clustering by coiled coils improves the biosynthesis of resveratrol and mevalonate. AMB Express 2020, 10, 97. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.F.; Yi, X.; Johnston, T.G.; Alper, H.S. De novo resveratrol production through modular engineering of an Escherichia coli-Saccharomyces cerevisiae co-culture. Microb. Cell Factories 2020, 19, 143. [Google Scholar] [CrossRef] [PubMed]
- Becker, J.V.; Armstrong, G.O.; van der Merwe, M.J.; Lambrechts, M.G.; Vivier, M.A.; Pretorius, I.S. Metabolic engineering of Saccharomyces cerevisiae for the synthesis of the wine-related antioxidant resveratrol. FEMS Yeast Res. 2003, 4, 79–85. [Google Scholar] [CrossRef] [PubMed]
- Trantas, E.; Panopoulos, N.; Ververidis, F. Metabolic engineering of the complete pathway leading to heterologous biosynthesis of various flavonoids and stilbenoids in Saccharomyces cerevisiae. Metab. Eng. 2009, 11, 355–366. [Google Scholar] [CrossRef]
- Chen, X.; Zaro, J.L.; Shen, W.C. Fusion protein linkers: Property, design and functionality. Adv. Drug Deliv. Rev. 2013, 65, 1357–1369. [Google Scholar] [CrossRef]
- Wang, Y.; Yu, O. Synthetic scaffolds increased resveratrol biosynthesis in engineered yeast cells. J. Biotechnol. 2012, 157, 258–260. [Google Scholar] [CrossRef]
- Sander, T.; Farke, N.; Diehl, C.; Kuntz, M.; Glatter, T.; Link, H. Allosteric Feedback Inhibition Enables Robust Amino Acid Biosynthesis in E. coli by Enforcing Enzyme Overabundance. Cell Syst. 2019, 8, 66–75.e8. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, A.; Kildegaard, K.R.; Li, M.; Borodina, I.; Nielsen, J. Establishment of a yeast platform strain for production of p-coumaric acid through metabolic engineering of aromatic amino acid biosynthesis. Metab. Eng. 2015, 31, 181–188. [Google Scholar] [CrossRef]
- Li, Y.; Mao, J.; Song, X.; Wu, Y.; Cai, M.; Wang, H.; Liu, Q.; Zhang, X.; Bai, Y.; Xu, H.; et al. Optimization of the l-tyrosine metabolic pathway in Saccharomyces cerevisiae by analyzing p-coumaric acid production. 3 Biotech 2020, 10, 258. [Google Scholar] [CrossRef] [PubMed]
- Braga, A.; Silva, M.; Oliveira, J.; Silva, A.R.; Ferreira, P.; Ottens, M.; Rocha, I.; Faria, N. An adsorptive bioprocess for production and recovery of resveratrol with Corynebacterium glutamicum. J. Chem. Technol. Biotechnol. 2018, 93, 1661–1668. [Google Scholar] [CrossRef]
- Shaito, A.; Posadino, A.M.; Younes, N.; Hasan, H.; Halabi, S.; Alhababi, D.; Al-Mohannadi, A.; Abdel-Rahman, W.M.; Eid, A.H.; Nasrallah, G.K.; et al. Potential adverse effects of resveratrol: A literature review. Int. J. Mol. Sci. 2020, 21, 2084. [Google Scholar] [CrossRef] [PubMed]
- Du, Y.; Yang, B.; Yi, Z.; Hu, L.; Li, M. Engineering Saccharomyces cerevisiae Coculture Platform for the Production of Flavonoids. J. Agric. Food Chem. 2020, 68, 2146–2154. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Halls, C.; Zhang, J.; Matsuno, M.; Zhang, Y.; Yu, O. Stepwise increase of resveratrol biosynthesis in yeast Saccharomyces cerevisiae by metabolic engineering. Metab. Eng. 2011, 13, 455–463. [Google Scholar] [CrossRef] [PubMed]
- Sun, P.; Liang, J.L.; Kang, L.Z.; Huang, X.Y.; Huang, J.J.; Ye, Z.W.; Guo, L.Q.; Lin, J.F. Increased resveratrol production in wines using engineered wine strains Saccharomyces cerevisiae EC1118 and relaxed antibiotic or auxotrophic selection. Biotechnol. Prog. 2015, 31, 650–655. [Google Scholar] [CrossRef]
- Song, Y.; Feng, L.; Ye, D.; Song, Y.; Qin, Y.; Liu, Y.; Liu, S. A biosynthesis method to produce resveratrol in Saccharomyces cerevisiae with secretion expression of grape anti-oxidant resveratrol synthase gene during wine fermentation. Pak. J. Bot. 2018, 50, 2443–2448. Available online: https://www.cabidigitallibrary.org/doi/full/10.5555/20183317261 (accessed on 21 July 2024).
Strains and Plasmids | Relevant Characteristics | Source |
---|---|---|
S. cerevisiae strains | ||
HJ | wild type haploid strain | Angel, China |
HJ01 | HJ, δ-Site:: PGPD1-Pc4CL-TADH1, PTEF1-VvSTS-TADH2, Hygromycin B marker | This study |
HJ02 | HJ, δ-Site:: PGPD1-Pc4CL-VvSTS-TADH2, Hygromycin B marker | This study |
HJ03 | HJ, δ-Site:: PGPD1-Pc4CL-E3AK-VvSTS-TADH2, Hygromycin B marker | This study |
HJ04 | HJ, δ-Site:: PGPD1-Pc4CL-TPTP-VvSTS-TADH2, Hygromycin B marker | This study |
HJ05 | HJ, δ-Site:: PPGK1-RtTAL-TCYC1, PGPD1-Pc4CL-TADH1, PTEF1-VvSTS-TADH2, Hygromycin B marker | This study |
HJ06 | HJ04, rDNA site:: PGPM1-RtTAL-TFBA1, PPGK1-ARO4K229L-TCYC1, clonNAT marker | This study |
HJ07 | HJ04, rDNA site:: PGPM1-RtTAL-TFBA1, PTEF1-ARO7G141S-TADH1, clonNAT marker | This study |
HJ08 | HJ04, rDNA site:: PGPM1-RtTAL-TFBA1, PPGK1-ARO4K229L-TCYC1, PTEF1-ARO7G141S-TADH1, clonNAT marker, | This study |
Plasmids | ||
pAG36 | CEN/ARS, PAgTEF1-natMX-TAgTEF1, Ampr, clonNAT resistance | Euroscarf, Frankfurt, Germany |
pUG27 | loxP-PAgTEF1-Sphis5-TAgTEF1-loxP, Ampr, histidine prototrophy | Euroscarf, Frankfurt, Germany |
pUG75 | loxP-PAgTEF1-hphMX-TAgTEF1-loxP, Ampr, Hygromycin B resistance | Euroscarf, Frankfurt, Germany |
p426 | 2 μm ori, URA3, PPGK1-TCYC1, Ampr | Bio SCI, Hangzhou, China |
pUG27-NTC | clonNAT resistance, Ampr, clonNAT resistance as a selection marker by δ-integration | This study |
p426-TAL1 | 2 μm ori, URA3, PPGK1-RtTAL-TCYC1 | This study (Figure S1) |
p426-4CL | 2 μm ori, URA3, PGPD1-Pc4CL-TADH1 | This study (Figure S2) |
p426-STS | 2 μm ori, URA3, PTEF1-VvSTS-TADH2 | This study (Figure S3) |
p426-ARO4 | 2 μm ori, URA3, PPGK1-ARO4K229L-TCYC1 | This study |
p426-ARO7 | 2 μm ori, URA3, PTEF1-ARO7G141S-TADH1 | This study |
p426-TAL2 | 2 μm ori, URA3, PGPM1-RtTAL-TFBA1 | This study (Figure S4) |
Primers | Sequences (5′-3′) | Applications |
---|---|---|
Amplification and δ-Site integration of 4CL and STS genes in HJ01 | ||
1 | CTCGAGGGATATAGGAATCCTC | Forward primer for amplification of δ-Site upstream region |
2 | TATTGATAATGATAAACTCGAACTGTGTTGGAATAGAAATCAACTATCATC | Reverse primer for amplification of δ-Site upstream region |
3 | GATGATAGTTGATTTCTATTCCAACACAGTTCGAGTTTATCATTATCAATA | Forward primer for amplification of 4CL from p426-4CL |
4 | AAACATTTTGAAGCTATGGTGTGTGGATCCGTGTGGAAGAACGATTACAA | Reverse primer for amplification of 4CL from p426-4CL |
5 | TTGTAATCGTTCTTCCACACGGATCCACACACCATAGCTTCAAAATGTTT | Forward primer for amplification of STS from p426-STS |
6 | TAAGGGTTGTCGACCTGCAGCGTAGGCCGCAAATTAAAGCCTTC | Reverse primer for amplification of STS from p426-STS |
7 | TATTTCTCATTTTCCTTCGCATGCCTACGCTGCAGGTCGACAACCCTTAA | Forward primer for amplification of HygB selected maker from pUG75 |
8 | AACAACACCTGCTTCATCAGCTGTTACGACTCACTATAGGGAGACCGGCA | Reverse primer for amplification of HygB selected maker from pUG75 |
9 | TGCCGGTCTCCCTATAGTGAGTCGTAACAGCTGATGAAGCAGGTGTTGTT | Forward primer for amplification of δ-Site downstream region |
10 | GAGAACTTCTAGTATATTCTGTATACCTAATATT | Reverse primer for amplification of δ-Site downstream region |
Amplification and δ-Site integration of 4CL and STS genes in HJ02 (Directed fusion) using primers 1/2, 3/11, 12/6, 7/8, 9 and 10 | ||
11 | TTCTGAATTCTTCAACGGAAGCCATCTTTGGCAAGTCACCAGAAGCGATC | Reverse primer for amplification of 4CL from p426-4CL |
12 | GATCGCTTCTGGTGACTTGCCAAAGATGGCTTCCGTTGAAGAATTCAGAA | Forward primer for amplification of STS from p426-STS |
Amplification and δ-Site integration of 4CL and STS genes in HJ03 (E3AK linker) using primers 1/2, 3/13, 14/6, 7/8, 9 and 10 | ||
13 | TCTTCAACGGAAGCCATCTTAGCAGCAGCTTCCTTTGGCAAATCACCAGA | Reverse primer for amplification of 4CL from p426-4CL |
14 | TCTGGTGATTTGCCAAAGGAAGCTGCTGCTAAGATGGCTTCCGTTGAAGA | Forward primer for amplification of STS from p426-STS |
Amplification and δ-Site integration of 4CL and STS genes in HJ04 (TPTP linker) using primers 1/2, 3/15, 16/6, 7/8, 9 and 10 | ||
15 | GAATTCTTCAACGGAAGCCATAGGTGTAGGTGTCTTTGGCAAATCACCAGA | Reverse primer for amplification of 4CL from p426-4CL |
16 | TCTGGTGATTTGCCAAAGACACCTACACCTATGGCTTCCGTTGAAGAATTC | Forward primer for amplification of STS from p426-STS |
Amplification and δ-Site integration of TAL, 4CL and STS genes in HJ05 using primers 1/17, 18/19, 20/4, 5/6, 7/8, 9 and 10 | ||
17 | CTACGTAAGATAATTGTATATTACGCAGCTGAAGCTTCGTACGC | Reverse primer for amplification of δ-Site upstream region |
18 | GATGATAGTTGATTTCTATTCCAACATATTTTAGATTCCTGACTTCAACTC | Forward primer for amplification of TAL from p426-TAL1 |
19 | TATCAGATCCACTAGTGGCCTATGCAGTGTCGAAAACGAGCTCAGT | Reverse primer for amplification of TAL from p426-TAL1 |
20 | GGGACGCTCGAAGGCTTTAATTTGCCAGTTCGAGTTTATCATTATCAATA | Forward primer for amplification of 4CL from p426-4CL |
For site-directed mutagenesis of ARO4 and ARO7 genes | ||
21 | ACAAATATAAAAACAACTAGTGGATCCATGAGTGAATCTCCAATGTTCG | Amplify ARO4 for p426-ARO4 construction from S. cerevisiae genome, forward primer. |
22 | TCGAGGTCGACGGTATCGATAAGCTTCATTTCTTGTTAACTTCTCTTC | Amplify ARO4 for p426-ARO4 construction from S. cerevisiae genome, reverse primer. |
23 | CATTTCATGGGTGTTACTTTGCATGGTGTTGCTGCTATC | ARO4 site-directed mutations primers, forward primer. |
24 | GATAGCAGCAACACCATGCAAAGTAACACCCATGAAATG | ARO4 site-directed mutations primers, reverse primer. |
25 | CTAAGTTTTAATTACAAAACTAGTATGGATTTCACAAAACCAGAAAC | Amplify ARO7 for p426-ARO7 construction from S. cerevisiae genome, forward primer. |
26 | GAATTCCTGCAGCCCGGGGGATCCTCACTCTTCCAACCTTCTTAGCAAG | Amplify ARO7 for p426-ARO7 construction from S. cerevisiae genome, reverse primer. |
27 | GATAAGAATAACTTCAGTTCTGTTGCCACTAG | ARO7 site-directed mutations primers, forward primer. |
28 | CTAGTGGCAACAGAACTGAAGTTATTCTTATC | ARO7 site-directed mutations primers, reverse primer. |
Amplification and rDNA-Site integration of TAL and ARO4K229L genes in HJ06 using primers 30/31, 32/33, 34/35, 36/37, 38 and 39 | ||
30 | CCGGAACCTCTAATCATTCG | Forward primer for amplification of rDNA-Site upstream region |
31 | CTTAAAGTCATACATTGCACGACTAGCTTGAGGTATAATGCAAGTACGGT | Reverse primer for amplification of rDNA-Site upstream region |
32 | ACCGTACTTGCATTATACCTCAAGCTAGTCGTGCAATGTATGACTTTAAG | Forward primer for amplification of TAL from p426-TAL2 |
33 | GAGTTGAAGTCAGGAATCTAAAATAAAAGATGAGCTAGGCTTTTGTAAAA | Reverse primer for amplification of TAL from p426-TAL2 |
34 | TTTTACAAAAGCCTAGCTCATCTTTTATTTTAGATTCCTGACTTCAACTC | Forward primer for amplification of ARO4 K229L from p426-ARO4 |
35 | TTAAGGGTTGTCGACCTGCAGCGTAGCAAATTAAAGCCTTCGAGCGTCCC | Reverse primer for amplification of ARO4 K229L from p426-ARO4 |
36 | GGGACGCTCGAAGGCTTTAATTTGCTACGCTGCAGGTCGACAACCCTTAA | Forward primer for amplification of NTC selected maker from pUG27-NTC |
37 | TCTCTGCGTGCTTGAGGTATAATGCACGACTCACTATAGGGAGACCGGCA | Reverse primer for amplification of NTC selected maker from pUG27-NTC |
38 | TGCCGGTCTCCCTATAGTGAGTCGTGCATTATACCTCAAGCACGCAGAGA | Forward primer for amplification of rDNA-Site downstream region |
39 | AACGAACGAGACCTTAACCT | Reverse primer for amplification of rDNA-Site downstream region |
Amplification and rDNA-Site integration of TAL and ARO7G141S genes in HJ07 using primers 30/31, 32/40, 41/42, 43/37, 38 and 39 | ||
40 | AAACATTTTGAAGCTATGGTGTGTGAAAGATGAGCTAGGCTTTTGTAAAA | Reverse primer for amplification of TAL from p426-TAL2 |
41 | TTTTACAAAAGCCTAGCTCATCTTTCACACACCATAGCTTCAAAATGTTT | Forward primer for amplification of ARO7 G141S from p426-ARO7 |
42 | TTAAGGGTTGTCGACCTGCAGCGTAGATCCGTGTGGAAGAACGATTACAA | Reverse primer for amplification of ARO7 G141S from p426-ARO7 |
43 | TTGTAATCGTTCTTCCACACGGATCTACGCTGCAGGTCGACAACCCTTAA | Forward primer for amplification of NTC selected maker from pUG27-NTC |
Amplification and rDNA-Site integration of TAL, ARO4K229L and ARO7G141S genes in HJ08 using primers 30/31, 32/33, 34/44, 45/42, 43/37, 38 and 39 | ||
44 | AAACATTTTGAAGCTATGGTGTGTGGCAAATTAAAGCCTTCGAGCGTCCC | Reverse primer for amplification of ARO4 K229L from p426-ARO4 |
45 | GGGACGCTCGAAGGCTTTAATTTGCCACACACCATAGCTTCAAAATGTTT | Forward primer for amplification of ARO7 G141S from p426-ARO7 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
An, H.; Li, G.; Yang, Z.; Xiong, M.; Wang, N.; Cao, X.; Yu, A. Denovo Production of Resveratrol by Engineered Rice Wine Strain Saccharomyces cerevisiae HJ08 and Its Application in Rice Wine Brewing. J. Fungi 2024, 10, 513. https://doi.org/10.3390/jof10080513
An H, Li G, Yang Z, Xiong M, Wang N, Cao X, Yu A. Denovo Production of Resveratrol by Engineered Rice Wine Strain Saccharomyces cerevisiae HJ08 and Its Application in Rice Wine Brewing. Journal of Fungi. 2024; 10(8):513. https://doi.org/10.3390/jof10080513
Chicago/Turabian StyleAn, Huihui, Guangpeng Li, Zhihan Yang, Meng Xiong, Na Wang, Xitao Cao, and Aiqun Yu. 2024. "Denovo Production of Resveratrol by Engineered Rice Wine Strain Saccharomyces cerevisiae HJ08 and Its Application in Rice Wine Brewing" Journal of Fungi 10, no. 8: 513. https://doi.org/10.3390/jof10080513
APA StyleAn, H., Li, G., Yang, Z., Xiong, M., Wang, N., Cao, X., & Yu, A. (2024). Denovo Production of Resveratrol by Engineered Rice Wine Strain Saccharomyces cerevisiae HJ08 and Its Application in Rice Wine Brewing. Journal of Fungi, 10(8), 513. https://doi.org/10.3390/jof10080513