Morphological and Phylogenetic Analyses Reveal Three New Species of Didymella (Didymellaceae, Pleosporales) from Jiangxi, China
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Fungal Isolation
2.2. Morphological and Cultural Characterization
2.3. DNA Extraction, PCR Amplification, and Sequencing
2.4. Phylogenetic Analyses
3. Results
3.1. Molecular Phylogeny
3.2. Taxonomy
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Saccardo, P.A. Sylloge Pyrenomycetum. Syll. Fung. 1882, 1, 1–768. [Google Scholar]
- De Gruyter, J.; Aveskamp, M.M.; Woudenberg, J.H.C.; Verkley, G.J.M.; Groenewald, J.Z.; Crous, P.W. Molecular phylogeny of Phoma and allied anamorph genera: Towards a reclassification of the Phoma complex. Mycol. Res. 2009, 113, 508–519. [Google Scholar] [CrossRef]
- Chen, Q.; Jiang, J.R.; Zhang, G.Z.; Cai, L.; Crous, P.W. Resolving the Phoma enigma. Stud. Mycol. 2015, 82, 137–217. [Google Scholar] [CrossRef]
- Chen, Q.; Bakhshi, M.; Balci, Y.; Broders, K.D.; Cheewangkoon, R.; Chen, S.F.; Fan, X.L.; Gramaje, D.; Halleen, F.; Horta Jung, M.; et al. Genera of phytopathogenic fungi: GOPHY 4. Stud. Mycol. 2022, 101, 417–564. [Google Scholar] [CrossRef]
- Aveskamp, M.M.; De Gruyter, J.; Woudenberg, J.H.C.; Verkley, G.J.M.; Crous, P.W. Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma and related pleosporalean genera. Stud. Mycol. 2010, 65, 1–60. [Google Scholar] [CrossRef]
- Zhang, Y.; Crous, P.W.; Schoch, C.L.; Hyde, K.D. Pleosporales. Fungal Divers. 2012, 53, 1–221. [Google Scholar] [CrossRef]
- Hou, L.W.; Groenewald, J.Z.; Pfenning, L.H.; Yarden, O.; Crous, P.W.; Cai, L. The phoma-like dilemma. Stud. Mycol. 2020, 96, 309–396. [Google Scholar] [CrossRef]
- Species Fungorum. Available online: http://www.speciesfungorum.org/Names/Names.asp (accessed on 18 December 2023).
- Magaña-Dueñas, V.; Cano-Lira, J.F.; Stchigel, A.M. New Dothideomycetes from freshwater habitats in Spain. J. Fungi 2021, 7, 1102. [Google Scholar] [CrossRef]
- Ahmadpour, S.A.; Mehrabi-Koushki, M.; Farokhinejad, R.; Asgari, B. New species of the family Didymellaceae in Iran. Mycol. Prog. 2022, 21, 28. [Google Scholar] [CrossRef]
- Boonmee, S.; Wanasinghe, D.N.; Calabon, M.S.; Huanraluek, N.; Chandrasiri, S.K.U.; Jones, G.E.B.; Rossi, W.; Leonardi, M.; Singh, S.K.; Rana, S.; et al. Fungal diversity notes 1387–1511: Taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Divers. 2019, 111, 1–335. [Google Scholar] [CrossRef]
- Chen, Q.; Hou, L.W.; Duan, W.J.; Crous, P.W.; Cai, L. Didymellaceae revisited. Stud. Mycol. 2017, 87, 105–159. [Google Scholar] [CrossRef]
- Chen, T.; Wang, S.; Jiang, X.; Huang, Y.; Mo, M.; Yu, Z. New Species of Didymellaceae within aquatic plants from southwestern China. J. Fungi 2023, 9, 761. [Google Scholar] [CrossRef]
- Crous, P.W.; Wingfield, M.J.; Burgess, T.I.; Carnegie, A.J.; Hardy, G.E.S.J.; Smith, D.; Summerell, B.A.; Cano-Lira, J.F.; Guarro, J.; Hobraken, J.; et al. Fungal Planet description sheets: 625–715. Persoonia 2017, 39, 270–467. [Google Scholar] [CrossRef]
- Crous, P.W.; Wingfield, M.J.; Burgess, T.I.; Hardy, G.E.S.J.; Gené, J.; Guarro, J.; Baseia, I.G.; García, D.; Gusmao, L.F.P.; Souza-Motta, C.M.; et al. Fungal Planet description sheets: 716–784. Persoonia 2018, 40, 239–392. [Google Scholar] [CrossRef]
- Crous, P.W.; Carnegie, A.J.; Wingfield, M.J.; Sharma, R.; Mughini, G.; Noordeloos, M.E.; Santini, A.; Shouche, Y.S.; Bezerra, J.D.P.; Dima, B.; et al. Fungal Planet description sheets: 868–950. Persoonia 2019, 42, 291–473. [Google Scholar] [CrossRef]
- Crous, P.W.; Osieck, E.R.; Jurjevi, Ž.; Boers, J.; Van Iperen, A.L.; Starink-Willemse, M.; Dima, B.; Balashov, S.; Bulgakov, T.S.; Johnston, P.R.; et al. Fungal Planet description sheets: 1284–1382. Persoonia 2021, 47, 178–374. [Google Scholar] [CrossRef]
- Jayasiri, S.C.; Hyde, K.D.; Jones, E.B.G.; McKenzie, E.H.C.; Jeewon, R.; Phillips, A.J.L.; Bhat, D.J.; Wanasinghe, D.N.; Liu, J.K.; Lu, Y.Z.; et al. Diversity, morphology and molecular phylogeny of Dothideomycetes on decaying wild seed pods and fruits. Mycosphere 2019, 10, 1–186. [Google Scholar] [CrossRef]
- Das, K.; Lee, S.Y.; Jung, H.Y. Molecular and morphological characterization of two novel species collected from Soil in Korea. Mycobiology 2020, 48, 9–19. [Google Scholar] [CrossRef]
- Mapook, A.; Hyde, K.D.; McKenzie, E.H.C.; Jones, E.B.G.; Bhat, D.J.; Jeewon, R.; Stadler, M.; Samarakoon, M.C.; Malaithong, M.; Tanunchai, B.; et al. Taxonomic and phylogenetic contributions to fungi associated with the invasive weed Chromolaena odorata (Siam weed). Fungal Divers. 2020, 101, 1–175. [Google Scholar] [CrossRef]
- Scarpari, M.; Vitale, S.; Giambattista, G.D.; Luongo, L.; De Gregorio, T.; Schreiber, G.; Petrucci, M.; Belisario, A.; Voglmayr, H. Didymella corylicola sp. nov., a new fungus associated with hazelnut fruit development in Italy. Mycol. Prog. 2020, 19, 317–328. [Google Scholar] [CrossRef]
- Tan, Y.P.; Bishop-Hurley, S.L.; Shivas, R.G.; Cowan, D.A.; Maggs-Kölling, G.; Maharachchikumbura, S.S.N.; Pinruan, U.; Bransgrove, K.L.; De la Peña-Lastra, S.; Larsson, E.; et al. Fungal Planet description sheets: 1436–1477. Persoonia 2022, 49, 261–350. [Google Scholar] [CrossRef]
- Valenzuela-Lopez, N.; Cano-Lira, J.F.; Guarro, J.; Sutton, D.A.; Wiederhold, N.; Crous, P.W.; Schigel, A.M. Coelomycetous Dothideomycetes with emphasis on the families Cucurbitariaceae and Didymellaceae. Stud. Mycol. 2018, 90, 1–69. [Google Scholar] [CrossRef]
- Hou, L.W.; Hernandez-Restrepo, M.; Groenewald, J.Z.; Cai, L.; Crous, P.W. Citizen science project reveals high diversity in Didymellaceae (Pleosporales, Dothideomycetes). Mycokeys 2020, 65, 49–99. [Google Scholar] [CrossRef]
- Hyde, K.D.; Dong, Y.; Phookamsak, R.; Jeewon, R.; Bhat, D.J.; Jones, E.B.G.; Liu, N.G.; Abeywickrama, P.D.; Mapook, A.; Wei, D.; et al. Fungal diversity notes 1151–1276: Taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Divers. 2020, 100, 5–277. [Google Scholar] [CrossRef]
- Lee, G.; Kim, K.D.; Cho, W.D.; Kim, W. Didymella acutilobae sp. nov. causing leaf spot and stem rot in Angelica acutiloba. Mycobiology 2023, 51, 313–319. [Google Scholar] [CrossRef]
- Turland, N.J.; Wiersema, J.H.; Barrie, F.R.; Greuter, W.; Hawksworth, D.L.; Herendeen, P.S.; Knapp, S.; Kusber, W.H.; Li, D.Z.; Marhold, K.; et al. (Eds.) International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code) adopted by the Nineteenth International Botanical Congress, Shenzhen, China, July 2017; Regnum Veg. 159; Koeltz Botanical Books: Glashütten, Germany, 2018; pp. 1–254. [Google Scholar] [CrossRef]
- Index Fungorum. Available online: http://www.indexfungorum.org/Names/Names.asp (accessed on 18 December 2023).
- Gao, Y.H.; Sun, W.; Su, Y.Y.; Cai, L. Three new species of Phomopsis in Gutianshan nature reserve in China. Mycol. Prog. 2014, 13, 111–121. [Google Scholar] [CrossRef]
- Cai, L.; Hyde, K.D.; Taylor, P.W.J.; Weir, B.S.; Waller, J.M.; Abang, M.M.; Zhang, J.Z.; Yang, Y.L.; Phoulivong, S.; Liu, Z.Y.; et al. A polyphasic approach for studying Colletotrichum. Fungal Divers. 2009, 39, 183–204. [Google Scholar]
- White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 315–322. [Google Scholar] [CrossRef]
- Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef]
- Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from Filamentous Ascomycetes. Appl. Environ. Microb. 1995, 61, 1323–1330. [Google Scholar] [CrossRef]
- Voglmayr, H.; Akulov, O.Y.; Jaklitsch, W.M. Reassessment of Allantonectria, phylogenetic position of Thyronectroidea, and Thyronectria caraganae sp. nov. Mycol. Prog. 2016, 15, 921–937. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Res. 2020, 20, 348–355. [Google Scholar] [CrossRef] [PubMed]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods. 2017, 14, 587–589. [Google Scholar] [CrossRef]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Minh, B.Q.; Nguyen, M.A.T.; von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
- De Gruyter, J.; Noordeloos, M.E.; Boerema, G.H. Contributions towards a monograph of Phoma (Coelomycetes)—I. 3. Section Phoma: Taxa with conidia longer than 7 µm. Persoonia 1998, 16, 471–490. [Google Scholar]
- Chen, Q.; Zhang, K.; Zhang, G.Z.; Cai, L. A polyphasic approach to characterise two novel species of Phoma (Didymellaceae) from China. Phytotaxa 2015, 197, 267–281. [Google Scholar] [CrossRef]
- Xu, Z.H.; Kuang, W.G.; Qiu, L.; Zhang, X.G.; Castaneda-Ruíz, R.F.; Ma, J. Corynespora sinensis sp. nov. from Jiangxi, China. Mycotaxon 2020, 135, 803–809. [Google Scholar] [CrossRef]
- Yang, Q.; Jiang, N.; Tian, C.M. New species and records of Diaporthe from Jiangxi Province, China. Mycokeys 2021, 77, 41–64. [Google Scholar] [CrossRef]
- Zhai, Z.J.; Yan, J.Q.; Li, W.W.; Gao, Y.; Hu, H.J.; Zhou, J.P.; Song, H.Y.; Hu, D.M. Three novel species of Distoseptispora (Distoseptisporaceae) isolated from bamboo in Jiangxi Province, China. Mycokeys 2022, 88, 35–54. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.F.; Liu, J.W.; Xu, Z.H.; Castañeda-Ruíz, R.F.; Zhang, K.; Ma, J. Morphology and multigene phylogeny revealed three new species of Helminthosporium (Massarinaceae, Pleosporales) from China. J. Fungi 2023, 9, 280. [Google Scholar] [CrossRef] [PubMed]
- Woudenberg, J.H.C.; Aveskamp, M.M.; De Gruyter, J.; Spiers, A.G.; Crous, P.W. Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype. Persoonia 2009, 22, 56–62. [Google Scholar] [CrossRef] [PubMed]
- Thambugala, K.M.; Hyde, K.D.; Zhang, J.F.; Liu, Z.Y. Didymella eriobotryae sp. nov. (Didymellaceae) and Arthrinium arundinis (Apiosporaceae) from fruit of Eriobotrya japonica (loquat) in China. Phytotaxa 2018, 382, 136. [Google Scholar] [CrossRef]
- Liu, J.K.; Hyde, K.D.; Jones, E.G.; Ariyawansa, H.A.; Bhat, D.J.; Boonmee, S.; Maharachchikumbura, S.S.N.; McKenzie, E.H.C.; Phookamsak, R.; Phukhamsakda, C.; et al. Fungal diversity notes 1–110: Taxonomic and phylogenetic contributions to fungal species. Fungal Divers. 2015, 72, 1–197. [Google Scholar] [CrossRef]
- He, K.; Ren, T.; Zhu, S.; Zhao, A. The complete mitochondrial genome of Fulica atra (Avian, Gruiformes, Rallidae). Mitochondr. DNA 2016, 27, 3161–3162. [Google Scholar] [CrossRef]
- Kulik, T.; Van Diepeningen, A.D.; Hausner, G. Editorial: The significance of mitogenomics in mycology. Front. Microbiol. 2021, 11, 628579. [Google Scholar] [CrossRef]
- Tan, H.; Yu, Y.; Fu, Y.; Liu, T.; Wang, Y.; Peng, W.; Wang, B.; Chen, J. Comparative analyses of Flammulina filiformis mitochondrial genomes reveal high length polymorphism in intergenic regions and multiple intron gain/loss in cox1. Int. J. Biol. Macromol. 2022, 221, 1593–1605. [Google Scholar] [CrossRef]
- Aveskamp, M.M.; De Gruyter, J.; Crous, P.W. Biology and recent developments in the systematics of Phoma, a complex genus of major quarantine significance. Fungal Divers. 2008, 31, 1–18. [Google Scholar]
Locus | Primers | Sequence 5′-3′ | PCR Program |
---|---|---|---|
ITS | ITS5 | GGAAGTAAAAGTCGTAACAAGG | 94 °C: 3 min, (94 °C: 15 s, 55 °C: 15 s, 72 °C: 30 s) ×35 cycles, 72 °C: 5 min |
ITS4 | TCCTCCGCTTATTGATATGC | ||
TUB2 | Bt2a | GGTAACCAAATCGGTGCTGCTTTC | 94 °C: 3 min, (94 °C: 15 s, 55 °C: 15 s, 72 °C: 30 s) × 35 cycles, 72 °C: 5 min |
Bt2b | ACCCTCAGTGTAGTGACCCTTGGC | ||
LSU | LSU-LR0R | GTACCCGCTGAACTTAAGC | 94 °C: 3 min, (94 °C: 15 s, 55 °C: 15 s, 72 °C: 30 s) × 35 cycles, 72 °C: 5 min |
LSU-LR7 | TACTACCACCAAGATCT | ||
RPB2 | dRPB2-5f | GAYACNGAYGAYCGWGAYCAYTTYGG | 94 °C: 3 min, (94 °C: 15 s, 56 °C: 15 s, 72 °C: 2 min) × 35 cycles, 72 °C: 5 min |
dRPB2-7r | AANCCCATDGCYTGYTTDCCCAT |
Species | Strain Number | Host, Substrate | Host Family | Locality | GenBank Accession Numbers | |||
---|---|---|---|---|---|---|---|---|
LSU | ITS | RPB2 | TUB2 | |||||
Didymella acetosellae | CBS 631.76 | Rumex acetosella | Polygonaceae | UK | MN943749 | MN973542 | MT018176 | MT005645 |
D. aeria | CGMCC 3.18353T = LC 7441 | Air | China | KY742205 | KY742051 | KY742137 | KY742293 | |
D. aliena | CBS 379.93 = PD 82/945 | Berberis sp. | Berberidaceae | The Netherlands | GU238037 | GU237851 | KP330416 | GU237578 |
D. aloeicola | CBS 562.88T | Aloe sp. | Asphodelaceae | Italy | MN943742 | MN973535 | MT018164 | MT005638 |
D. americana | CBS 185.85 = PD 80/1191 | Zea mays | Poaceae | USA | GU237990 | FJ426972 | KT389594 | FJ427088 |
D. americana | CBS 568.97T | Glycine max | Fabeceae | USA | GU237991 | FJ426974 | MN983437 | FJ427090 |
D. anserina | CBS 360.84 | Potato flour | The Netherlands | GU237993 | GU237839 | KT389596 | GU237551 | |
D. aquatica | CGMCC 3.18349T = LC 5556 | Water | China | KY742209 | KY742055 | KY742140 | KY742297 | |
D. arachidicola | CBS 333.75T = ATCC 28,333 = IMI 386,092 = PREM 44889 | Arachis hypogaea | Fabeceae | South Africa | GU237996 | GU237833 | KT389598 | GU237554 |
D. aurea | CBS 269.93T = PD 78/1087 | Medicago polymorpha | Fabeceae | New Zealand | GU237999 | GU237818 | KT389599 | GU237557 |
D. azollae | IRAN 3058CT | Azolla filiculoides | Iran | MT514912 | MT514915 | – | MT512518 | |
D. bellidis | CBS 714.85 = PD 74/265 | Bellis perennis | Asteraceae | The Netherlands | GU238046 | GU237904 | KP330417 | GU237586 |
D. bischofiae | HJAUP C1776T | Bischofia polycarpa | Euphorbiaceae | China | OR625713 | OR625712 | OR620208 | OR620206 |
D. bischofiae | HJAUP C1776b | Bischofia polycarpa | Euphorbiaceae | China | OR905564 | OR905553 | – | OR934716 |
D. bischofiae | HJAUP C1776c | Bischofia polycarpa | Euphorbiaceae | China | OR905561 | OR905554 | – | OR934717 |
D. boeremae | CBS 109942T = PD 84/402 | Medicago littoralis cv. Harbinger | Fabeceae | Australia | GU238048 | FJ426982 | KT389600 | FJ427097 |
D. brevipilosa | FMR 17415; CBS 148654 | Plant debris | Spain | OU612372 | OU612373 | OU612359 | OU612358 | |
D. brunneospora | CBS 115.58T = DSM 62044 | Chrysanthemum roseum | Asteraceae | Germany | KT389723 | KT389505 | KT389625 | KT389802 |
D. calidophila | CBS 448.83T | Soil | Egypt | GU238052 | FJ427059 | MT018170 | FJ427168 | |
D. cari | CBS 144497T | Coriandrum sativum | Apiaceae | Canada | MH327861 | MH327825 | – | MH327899 |
D. chenopodii | CBS 128.93 = PD 79/140 | Chenopodium quinoa cv. Sajana | Chenopodiaceae | Peru | GU238055 | GU237775 | KT389602 | GU237591 |
D. chlamydospora | LC 13586 | Elymus glaucus | Poaceae | China | MT229671 | MT229694 | MT239091 | MT249262 |
D. chlamydospora | CGMCC 3.20072 = LC 13587T | Elymus glaucus | Poaceae | China | MT229672 | MT229695 | MT239092 | MT249263 |
D. chlamydospora | LC 13588 | Polygonum viviparum | Polygonaceae | China | MT229673 | MT229696 | MT239093 | MT249264 |
D. chlamydospora | LC 13589 | Polygonum sibiricum | Polygonaceae | China | MT229674 | MT229697 | MT239094 | MT249265 |
D. chloroguttulata | CGMCC 3.18351T = LC 7435 | Air | China | KY742211 | KY742057 | KY742142 | KY742299 | |
D. chromolaenae | MFLUCC 17-1459T | Chromolaena odorata | Asteraceae | Thailand | MT214457 | MT214363 | – | – |
D. clerodendri | HJAUP C1698T | Clerodendrum cyrtophyllum | Lamiaceae | China | OR625714 | OR625709 | OR620207 | OR611942 |
D. clerodendri | HJAUP C1698b | Clerodendrum cyrtophyllum | Lamiaceae | China | OR905576 | OR905545 | OR947923 | OR934711 |
D. clerodendri | HJAUP C1698c | Clerodendrum cyrtophyllum | Lamiaceae | China | OR905575 | OR905546 | OR947921 | OR934712 |
D. coffeae-arabicae | CBS 123380T = PD 84/1013 | Coffea arabica | Rubiaceae | Ethiopia | GU238005 | FJ426993 | KT389603 | FJ427104 |
D. combreti | CBS 137982T | Combretum mossambicensis | Combretaceae | Zambia | KJ869191 | KJ869134 | MT018139 | MT005626 |
D. corylicola | CBS 146357; CREADC-F2403T | Corylus avellana | Betulaceae | Italy | MN954290 | MN954301 | MN958323 | MN958333 |
D. corylicola | CREADC-F2411 | Corylus avellana | Betulaceae | Italy | MN954298 | MN954309 | MN958330 | MN958340 |
D. curtisii | PD 86/1145 = CBS 251.92 | Nerine sp. | Amaryllidaceae | The Netherlands | GU238013 | FJ427038 | MT018131 | FJ427148 |
D. cylindrica | IRAN 3051C | Pteridium aquilinum | Pteridiaceae | Iran | OK257022 | OK257014 | OK247736 | OK247741 |
D. dactylidis | PD 73/1414 = CBS 124513T | Dactylis glomerata | Poaceae | USA | GU238061 | GU237766 | MT018173 | GU237599 |
D. degraaffiae | CBS 144956T | Soil | The Netherlands | MN823295 | MN823444 | MN824470 | MN824618 | |
D. dimorpha | CBS 346.82T | Opuntia sp. | Cactaceae | Spain | GU238068 | GU237835 | MT018158 | GU237606 |
D. ellipsoidea | CGMCC 3.18350T = LC 7434 | Air | China | KY742214 | KY742060 | KY742145 | KY742302 | |
D. erhaiensis | YMF1.05023 | Hydrocharis dubia | Hydrocharitaceae | China | MH257457 | MH257369 | MH311809 | MH422997 |
D. erhaiensis | YMF1.05021T | Eichhornia crassipes | Pontederiaceae | China | MH257455 | MH257367 | MH311807 | MH422995 |
D. eucalyptica | PD 79/210 = CBS 377.91 | Eucalyptus sp. | Myrtaceae | Australia | GU238007 | GU237846 | KT389605 | GU237562 |
D. exigua | CBS 183.55T | Rumex arifolius | Polygonaceae | France | EU754155 | GU237794 | EU874850 | GU237525 |
D. finnmarkica | CBS 145572T | Pinus sylvestris | Pinaceae | Norway | MK876429 | MK876388 | MK876484 | – |
D. gardeniae | CBS 626.68T = IMI 108771 | Gardenia jasminoides | Rubiaceae | India | GQ387595 | FJ427003 | KT389606 | FJ427114 |
D. gei | CGMCC 3.20068 = LC 13581T | Geum sp. | Rosaceae | China | MT229675 | MT229698 | MT239095 | MT249266 |
D. glomerata | CBS 528.66 = PD 63/590 | Chrysanthemum sp. | Asteraceae | The Netherlands | EU754184 | FJ427013 | GU371781 | FJ427124 |
D. gongkaensis | YMF1.05095T | Hippuris vulgaris | Hippuridaceae | China | MH257458 | MH257372 | MH311812 | MH422999 |
D. gongkaensis | YMF1.05029 | Hippuris vulgaris | Hippuridaceae | China | MH257459 | MH257373 | MH311813 | MH423000 |
D. guttulata | CBS 127976T | Soil | Zimbabwe | MN943730 | MN973524 | MT018138 | MT005625 | |
D. heteroderae | CBS 109.92T = PD 73/1405 | Undefined food material | The Netherlands | GU238002 | FJ426983 | KT389601 | FJ427098 | |
D. hippuris | YMF1.05089T | Hippuris vulgaris | Hippuridaceae | China | MH257473 | MH257388 | MH311827 | MH423015 |
D. hippuris | YMF1.05204 | Myriophyllum spicatum | Haloragaceae | China | MH257482 | MH257397 | MH311835 | – |
D. ilicicola | CGMCC 3.18355T = LC 8126 = LC 8127 | Ilex chinensis | Aquifoliaceae | Italy | KY742219 | KY742065 | KY742150 | KY742307 |
D. indica | CBS 653.77T | Unknown | India | MN943741 | MN973534 | MT018159 | MT005637 | |
D. infuscatispora | CGMCC 3.18356T = LC 8128 | Chrysanthemum indicum | Asteraceae | China | KY742221 | KY742067 | KY742152 | KY742309 |
D. keratinophila | CBS 143032T | Human superficial tissue | USA | LN907343 | LT592901 | LT593039 | LT592970 | |
D. kooimaniorum | CBS 144951T | Soil | The Netherlands | MN823299 | MN823448 | MN824474 | MN824622 | |
D. lethalis | CBS 103.25 | Unknown | Unknown | Unknown | GU238010 | GU237729 | KT389607 | GU237564 |
D. ligulariae | CGMCC 3.20070 = LC 13583T | Ligularia sibirica | Asteraceae | China | MT229676 | MT229699 | MT239096 | MT249267 |
D. longicolla | CBS 124,514 = PD 80/1189T | Opuntia sp. | Cactaceae | Spain | GU238095 | GU237767 | MT018161 | GU237622 |
D. macrophylla | CGMCC 3.18357 = LC 8131T | Hydrangea macrophylla | Saxifragaceae | Italy | KY742224 | KY742070 | KY742154 | KY742312 |
D. magnoliae | MFLUCC 18-1560T | Magnolia grandiflora | Magnoliaceae | China | MK348033 | MK347814 | MK434852 | – |
D. macrostoma | CBS 223.69 | Acer pseudoplatanus | Aceraceae | Switzerland | GU238096 | GU237801 | KT389608 | GU237623 |
D. maydis | CBS 588.69T | Zea mays | Poaceae | USA | EU754192 | FJ427086 | GU371782 | FJ427190 |
D. microchlamydospora | CBS 105.95T | Eucalyptus sp. | Myrtaceae | UK | GU238104 | FJ427028 | KP330424 | FJ427138 |
D. mitis | CBS 443.72T | Soil | South Africa | MN943729 | MN973523 | MT018137 | MT005624 | |
D. molleriana | CBS 229.79 = LEV 7660 | Digitalis purpurea | Scrophulariaceae | New Zealand | GU238067 | GU237802 | KP330418 | GU237605 |
D. musae | CBS 463.69 | Mangifera indica | Anacardiaceae | India | GU238011 | FJ427026 | MT018148 | FJ427136 |
D. myriophyllana | YMF1.05035 | Myriophyllum aquaticum | Haloragaceae | China | MH257484 | MH257399 | MH311837 | MH423001 |
D. myriophyllana | YMF1.05100T | Myriophyllum aquaticum | Haloragaceae | China | MH257486 | MH257401 | MH311839 | MH423003 |
D. naikii | PLS3T | Cajanus cajan | Fabaceae | India | OM830704 | OM952211 | – | OM858681 |
D. negriana | CBS 358.71 | Vitis vinifera | Vitaceae | Germany | GU238116 | GU237838 | KT389610 | GU237635 |
D. nigricans | PDDCC 6546 = CBS 444.81T | Actinidia chinensis | Actinidiaceae | New Zealand | GU238000 | GU237867 | MT018146 | GU237558 |
D. ocimicola | CGMCC 3.18358T = LC 8137 | Ocimum sp. | Lamiaceae | China | KY742232 | KY742078 | MT018181 | KY742320 |
D. pedeiae | PD 92/612A = CBS 124517T | Schefflera elegantissima | Araliaceae | The Netherlands | GU238127 | GU237770 | KT389612 | GU237642 |
D. pinodella | CBS 531.66 | Trifolium pretense | Fabeceae | USA | GU238017 | FJ427052 | KT389613 | FJ427162 |
D. pinodes | CBS 525.77T | Pisum sativum | Fabeceae | Belgium | GU238023 | GU237883 | KT389614 | GU237572 |
D. pittospori | HJAUP C1740T | Pittosporum tobira | Pittosporaceae | China | OR625711 | OR625710 | – | OR620205 |
D. pittospori | HJAUP C1800 | Eriobotrya japonica | Rosaceae | China | OR905581 | OR905550 | OR947922 | OR934715 |
D. pomorum | CBS 539.66 = ATCC 16,791 = IMI 122,266 = PD 64/914 | Polygonum tataricum | Polygonaceae | The Netherlands | GU238028 | FJ427056 | KT389618 | FJ427166 |
D. prolaticolla | CBS 126182T | Surface soil | Namibia | MN943740 | MN973533 | MT018157 | MT005636 | |
D. prosopidis | CBS 136414T | Prosopis sp. | Fabaceae | South Africa | KF777232 | KF777180 | MT018149 | MT005631 |
D. protuberans | CBS 381.96T = PD 71/706 | Lycium halifolium | Solanaceae | The Netherlands | GU238029 | GU237853 | KT389620 | GU237574 |
D. pteridis | CBS 379.96T | Pteris sp. | Pteridaceae | The Netherlands | KT389722 | KT389504 | KT389624 | KT389801 |
D. qilianensis | LC 13584 | Rheum officinale | Polygonaceae | China | MT229677 | MT229700 | MT239097 | MT249268 |
D. qilianensis | CGMCC 3.20071 = LC 13585T | Rheum officinale | Polygonaceae | China | MT229678 | MT229701 | MT239098 | MT249269 |
D. rhei | CBS 109,177 = LEV 15,165 = PD 2000/9941 | Rheum rhaponticum | Polygonaceae | New Zealand | GU238139 | GU237743 | KP330428 | GU237653 |
D. rumicicola | CBS 683.79T = LEV 15094 | Rumex obtusifolius | Polygonaceae | New Zealand | KT389721 | KT389503 | KT389622 | KT389800 |
D. sancta | CBS 281.83T | Ailanthus altissima | Simaroubaceae | South Africa | GU238030 | FJ427063 | KT389623 | FJ427170 |
D. segeticola | CGMCC 3.17489T = LC 1636 | Cirsium segetum | Asteraceae | China | KP330455 | KP330443 | KP330414 | KP330399 |
D. senecionicola | CBS 160.78 = LEV 11451 | Senecio jacobaea | Asteraceae | New Zealand | GU238143 | GU237787 | MT018177 | GU237657 |
D. sinensis | CGMCC 3.18348T = LC 5210 | Cerasus pseudocerasus | Rosaceae | China | KY742239 | KY742085 | MT018127 | KY742327 |
D. subglobispora | CBS 364.91T | Ananas sativus | Bromeliaceae | Unknown | MN943737 | MN973531 | MT018153 | MT005634 |
D. subglomerata | CBS 110.92 = PD 76/1010 | Triticum sp. | Poaceae | USA | GU238032 | FJ427080 | KT389626 | FJ427186 |
D. subherbarum | CBS 250.92T = DAOM 171,914 = PD 92/371 | Zea mays | Poaceae | Canada | GU238145 | GU237809 | MT018162 | GU237659 |
D. subrosea | CBS 733.79T | Abies alba litter | Pinaceae | France | MN943747 | MN973540 | MT018174 | MT005643 |
D. suiyangensis | CGMCC 3.18352T = LC 7439 | Air | China | KY742243 | KY742089 | KY742168 | KY742330 | |
D. tabebuiicola | COAD 3340T | Tabebuia aurea | Bignoniaceae | Brazil | MZ703623 | MZ703618 | MZ712360 | MZ712364 |
D. uniseptata | CGMCC 3.20069 = LC 13582T | Syringa vulgaris | Oleaceae | China | MT229679 | MT229702 | MT239099 | MT249270 |
D. variabilis | CBS 254.79T | Vitis vinifera | Vitaceae | Italy | MN943751 | MN973544 | MT018182 | MT005647 |
D. viburnicola | CBS 523.73 = PD 69/800 | Viburnum cassioides | Adoxaceae | The Netherlands | GU238155 | GU237879 | KP330430 | GU237667 |
Epicoccum camelliae | CGMCC 3.18343 T = LC 4858 | Camellia sinensis | Theaceae | China | KY742245 | KY742091 | KY742170 | KY742333 |
E. camelliae | LC 4862 | Camellia sinensis | Theaceae | China | KY742246 | KY742092 | KY742171 | KY742334 |
E. latusicollum | CGMCC 3.18346T = LC 5158 | Sorghum bicolor | Poaceae | China | KY742255 | KY742101 | KY742174 | KY742343 |
E. latusicollum | LC 4859 | Camellia sinensis | Theaceae | China | KY742256 | KY742102 | KY742175 | KY742344 |
E. latusicollum | LC 5124 | Vitex negundo | Lamiaceae | China | KY742257 | KY742103 | – | KY742345 |
E. nigrum | CBS 173.73T = ATCC 24,428 = IMI 164070 | Dactylis glomerata | Poaceae | USA | GU237975 | FJ426996 | KT389632 | FJ427107 |
E. poae | CGMCC 3.18363T = LC 8160 | Poa annua | Poaceae | USA | KY742267 | KY742113 | KY742182 | KY742355 |
E. sorghinum | CBS 179.80 = PD 76/1018 | Sorghum vulgare | Poaceae | PuertoRico | GU237978 | FJ427067 | KT389635 | FJ427173 |
E. sorghinum | CBS 627.68 = PD 66/926 | Citrus sp. | Rutaceae | France | GU237979 | FJ427072 | KT389636 | FJ427178 |
Paraboeremia adianticola | CBS 187.83 = PD 82/128 | Polystichum adiantiforme | Dryopteridaceae | USA | GU238035 | GU237796 | KP330401 | GU237576 |
P. adianticola | CBS 260.92 = PD 86/1103 | Pteris ensiformis | Pteridaceae | – | KT389752 | KT389534 | – | KT389832 |
P. camellae | CGMCC 3.18106T = LC 4852 | Camellia sp. | Theaceae | China | KX829042 | KX829034 | KX829050 | KX829058 |
P. camellae | CGMCC 3.18107 = LC 6253 | Camellia sp. | Theaceae | China | KX829043 | KX829035 | KX829051 | KX829059 |
P. oligotrophica | CGMCC 3.18111T = LC 6250 | Carbonatite | China | KX829039 | KX829031 | KX829047 | KX829055 | |
P. oligotrophica | CGMCC 3.18112 = LC 6251 | Carbonatite | China | KX829040 | KX829032 | KX829048 | KX829056 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, X.; Hu, Y.; Xia, J.; Zhang, K.; Ma, L.; Xu, Z.; Ma, J. Morphological and Phylogenetic Analyses Reveal Three New Species of Didymella (Didymellaceae, Pleosporales) from Jiangxi, China. J. Fungi 2024, 10, 75. https://doi.org/10.3390/jof10010075
Luo X, Hu Y, Xia J, Zhang K, Ma L, Xu Z, Ma J. Morphological and Phylogenetic Analyses Reveal Three New Species of Didymella (Didymellaceae, Pleosporales) from Jiangxi, China. Journal of Fungi. 2024; 10(1):75. https://doi.org/10.3390/jof10010075
Chicago/Turabian StyleLuo, Xingxing, Yafen Hu, Jiwen Xia, Kai Zhang, Liguo Ma, Zhaohuan Xu, and Jian Ma. 2024. "Morphological and Phylogenetic Analyses Reveal Three New Species of Didymella (Didymellaceae, Pleosporales) from Jiangxi, China" Journal of Fungi 10, no. 1: 75. https://doi.org/10.3390/jof10010075
APA StyleLuo, X., Hu, Y., Xia, J., Zhang, K., Ma, L., Xu, Z., & Ma, J. (2024). Morphological and Phylogenetic Analyses Reveal Three New Species of Didymella (Didymellaceae, Pleosporales) from Jiangxi, China. Journal of Fungi, 10(1), 75. https://doi.org/10.3390/jof10010075