Activin A Reduces Porcine Granulosa Cells Apoptosis via ERβ-Dependent ROS Modulation
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Granulosa Cell Isolation and Culture
2.2. Cell Treatment
2.3. Cell Viability Assay
2.4. Measurement of E2 Secretion
2.5. Gene Expression Analysis
2.6. Analysis and Detection of ROS
2.7. Analytical Oxidative Stress-Associated Parameters
2.8. Statistical Analysis
3. Results
3.1. ACT-A Enhances the Expression of FSHR and ERβ and Significantly Increases Granulosa Cells’ Sensitivity (GCs) Sensitivity to FSH Treatment
3.2. ACT-A Attenuates Apoptosis of GCs
3.3. ACT-A Mediates GCs Apoptosis via Modulating ERβ Expression
3.4. ACT-A Mediates Intracellular ROS Levels in GCs via ERβ
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Azziz, R. Polycystic Ovary Syndrome. Obs. Gynecol. 2018, 132, 321–336. [Google Scholar] [CrossRef] [Scilit]
- Nakamura, K.; Sheps, S.; Arck, P.C. Stress and reproductive failure: Past notions, present insights and future directions. J. Assist. Reprod. Genet. 2008, 25, 47–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosenfield, R.L.; Ehrmann, D.A. The Pathogenesis of Polycystic Ovary Syndrome (PCOS): The Hypothesis of PCOS as Functional Ovarian Hyperandrogenism Revisited. Endocr. Rev. 2016, 37, 467–520. [Google Scholar] [PubMed]
- Pettersen, K.; Andersen, S.; van der Veen, A.; Nonstad, U.; Hatakeyama, S.; Lambert, C.; Lach-Trifilieff, E.; Moestue, S.A.; Kim, J.; Grønberg, B.H.; et al. Autocrine activin A signalling in ovarian cancer cells regulates secretion of interleukin 6, autophagy, and cachexia. J. Cachexia Sarcopenia Muscle 2020, 11, 195–207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pursley, J.R.; Mee, M.O.; Wiltbank, M.C. Synchronization of Ovulation in Dairy-Cows Using PGF2α and GnRH. Theriogenology 1995, 44, 915–923. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wiltbank, M.C.; Pursley, J.R. The cow as an induced ovulator: Timed AI after synchronization of ovulation. Theriogenology 2014, 81, 170–185. [Google Scholar] [CrossRef] [Scilit]
- Perry, G.A.; Smith, M.F.; Lucy, M.C.; Green, J.A.; Parks, T.E.; MacNeil, M.D.; Roberts, A.J.; Geary, T.W. Relationship between follicle size at insemination and pregnancy success. Proc. Natl. Acad. Sci. USA 2005, 102, 5268–5273. [Google Scholar] [CrossRef] [Scilit]
- Colazo, M.G.; Behrouzi, A.; Ambrose, D.J.; Mapletoft, R.J. Diameter of the ovulatory follicle at timed artificial insemination as a predictor of pregnancy status in lactating dairy cows subjected to GnRH-based protocols. Theriogenology 2015, 84, 377–383. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.P.; Mao, X.B.; Wei, Y.M.; Yu, J.N.; Li, H.; Chen, R.A.; Shi, Z.D. Studies on enhancing embryo quantity and quality by immunization against inhibin in repeatedly superovulated Holstein heifers and the associated endocrine mechanisms. Anim. Reprod. Sci. 2013, 142, 10–18. [Google Scholar] [CrossRef] [Scilit]
- Bahareldin-Ali, A.; Qin, G.-S.; Guo, R.-H.; Tsigkou, A.; Tan, Z.-Z.; Huang, J.; Li, H.; Shi, Z.-D. Endocrine and ovarian responses in water buffalo cows immunized against inhibin and subjected to the Ovsynch protocol. J. Integr. Agric. 2015, 14, 1827–1837. [Google Scholar] [CrossRef] [Scilit]
- Guo, R.-H.; He, P.-Y.; Mai, Y.-L.; Dai, Z.-C.; Chen, F.; Shi, Z.-D. A novel method to improve sow reproductive performance: Combination of pre-weaning immunization against inhibin and post-insemination hCG treatment. J. Integr. Agric. 2020, 19, 2286–2293. [Google Scholar] [CrossRef] [Scilit]
- Guo, R.; Chen, F.; Mei, C.; Dai, Z.; Yan, L.; Shi, Z. Conception Rate and Reproductive Hormone Secretion in Holstein Cows Immunized against Inhibin and Subjected to the Ovsynch Protocol. Animals 2020, 10, 313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, F.; Lu, J.; Guo, R.; Mei, C.; Guo, B.; Li, W.; Tsigkou, A.; Shi, Z. Rectifying cow infertility under heat stress by immunization against inhibin and supplementation of progesterone. Domest. Anim. Endocrinol. 2022, 80, 106726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsueh, A.J.; Dahl, K.D.; Vaughan, J.; Tucker, E.; Rivier, J.; Bardin, C.W.; Vale, W. Heterodimers and Homodimers of Inhibin Subunits Have Different Paracrine Action in the Modulation of Luteinizing Hormone-Stimulated Androgen Biosynthesis. Proc. Natl. Acad. Sci. USA 1987, 84, 5082–5086. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lewis, K.A.; Gray, P.C.; Blount, A.L.; MacConell, L.A.; Wiater, E.; Bilezikjian, L.M.; Vale, W. Betaglycan binds inhibin and can mediate functional antagonism of activin signalling. Nature 2000, 404, 411–414. [Google Scholar] [CrossRef] [Scilit]
- Knight, P.G.; Glister, C. Potential local regulatory functions of inhibins, activins and follistatin in the ovary. Reproduction 2001, 121, 503–512. [Google Scholar] [CrossRef] [Scilit]
- Welt, C.; Sidis, Y.; Keutmann, H.; Schneyer, A. Activins, inhibins, and follistatins: From endocrinology to signaling. A paradigm for the new millennium. Exp. Biol. Med. 2002, 227, 724–752. [Google Scholar] [CrossRef] [Scilit]
- Luisi, S.; Palumbo, M.; Calonaci, G.; De Leo, V.; Razzi, S.; Inaudi, P.; Cobellis, G.; Petraglia, F. Serum inhibin B correlates with successful ovulation in infertile women. J. Assist. Reprod. Genet. 2003, 20, 241–247. [Google Scholar] [CrossRef] [Scilit]
- Jimenez-Krassel, F.; Winn, M.E.; Burns, D.; Ireland, J.L.H.; Ireland, J.J. Evidence for a negative intrafollicular role for inhibin in regulation of estradiol production by granulosa cells. Endocrinology 2003, 144, 1876–1886. [Google Scholar] [CrossRef] [Scilit]
- Cai, L.; Sun, A.; Li, H.; Tsinkgou, A.; Yu, J.; Ying, S.; Chen, Z.; Shi, Z. Molecular mechanisms of enhancing porcine granulosa cell proliferation and function by treatment in vitro with anti-inhibin alpha subunit antibody. Reprod. Biol. Endocrinol. 2015, 13, 26. [Google Scholar] [CrossRef] [Scilit]
- Liu, N.; Wang, S.; Yao, Q.; Li, Y.; Hu, H.; Tang, X.; Ran, H.; Price, C.A.; Jiang, Z. Activin A attenuates apoptosis of granulosa cells in atretic follicles through ERβ-induced autophagy. Reprod. Domest. Anim. 2022, 57, 625–634. [Google Scholar] [CrossRef] [Scilit]
- Azad, M.; Kikusato, M.; Sudo, S.; Amo, T.; Toyomizu, M. Time course of ROS production in skeletal muscle mitochondria from chronic heat-exposed broiler chicken. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2010, 157, 266–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, A.; Dou, J.; Wang, Y.; Jiang, X.; Khan, M.Z.; Luo, H.; Usman, T.; Zhu, H. Evaluation of heat stress effects on cellular and transcriptional adaptation of bovine granulosa cells. J. Anim. Sci. Biotechnol. 2020, 11, 25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tanimoto, R.; Sekii, K.; Morohaku, K.; Li, J.; Pépin, D.; Obata, Y. Blocking estrogen-induced AMH expression is crucial for normal follicle formation. Development 2021, 148, dev197459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dilaver, N.; Pellatt, L.; Jameson, E.; Ogunjimi, M.; Bano, G.; Homburg, R.; Mason, H.D.; Rice, S. The regulation and signalling of anti-Müllerian hormone in human granulosa cells:relevance to polycystic ovary syndrome. Hum. Reprod. 2019, 34, 2467–2479. [Google Scholar]
- Anderson, E.; Albertini, D.F. Gap junctions between the oocyte and companion follicle cells in the mammalian ovary. J. Cell Biol. 1976, 71, 680–686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drummond, A.E. TGFbeta signalling in the development of ovarian function. Cell Tissue Res. 2005, 322, 107–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matsuda, F.; Inoue, N.; Manabe, N.; Ohkura, S. Follicular growth and atresia in mammalian ovaries: Regulation by survival and death of granulosa cells. J. Reprod. Dev. 2012, 58, 44–50. [Google Scholar] [CrossRef] [Scilit]
- Adu-Gyamfi, E.A.; Djankpa, F.T.; Nelson, W.; Czika, A.; Sah, S.K.; Lamptey, J.; Ding, Y.-B.; Wang, Y.-X. Activin and inhibin signaling: From regulation of physiology to involvement in the pathology of the female reproductive system. Cytokine 2020, 133, 155105. [Google Scholar] [CrossRef] [Scilit]
- Rahman, N.A.; Huhtaniemi, I. Hormonal regulation of proliferation of granulosa and Leydig cell lines derived from gonadal tumors of transgenic mice expressing the inhibin-alpha subunit promoter/simian virus 40 T-antigen fusion gene. Mol. Cell. Endocrinol. 1999, 149, 9–17. [Google Scholar]
- Lu, C.; Yang, W.; Chen, M.; Liu, T.; Yang, J.; Tan, P.; Li, L.; Hu, X.; Fan, C.; Hu, Z.; et al. Inhibin A inhibits follicle-stimulating hormone (FSH) action by suppressing its receptor expression in cultured rat granulosa cells. Mol. Cell. Endocrinol. 2009, 298, 48–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ozawa, M.; Shi, F.; Watanabe, G.; Suzuki, A.K.; Taya, K. Regulatory role of inhibin in follicle-stimulating hormone secretion and folliculogenesis in the guinea pig. J. Vet. Med. Sci. 2001, 63, 1091–1095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hillier, S.G. Regulatory functions for inhibin and activin in human ovaries. J. Endocrinol. 1991, 131, 171–175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, E.B.; Chakravarthi, V.P.; Wolfe, M.W.; Rumi, M.K. ERbeta Regulation of Gonadotropin Responses during Folliculogenesis. Int. J. Mol. Sci. 2021, 22, 10348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Emmen, J.M.; Couse, J.F.; Elmore, S.A.; Yates, M.M.; Kissling, G.E.; Korach, K.S. In vitro growth and ovulation of follicles from ovaries of estrogen receptor (ER){alpha} and ER{beta} null mice indicate a role for ER{beta} in follicular maturation. Endocrinology 2005, 146, 2817–2826. [Google Scholar] [CrossRef] [Scilit]
- Couse, J.F.; Yates, M.M.; Deroo, B.J.; Korach, K.S. Estrogen receptor-beta is critical to granulosa cell differentiation and the ovulatory response to gonadotropins. Endocrinology 2005, 146, 3247–3262. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.; Yao, Y.; Ma, X.; Fu, B.; Li, N.; Zhang, C. Mechanisms of OCT4 on 3,5,3′-Tri-iodothyronine and FSH-induced Granulosa Cell Development in Female Mice. Endocrinology 2021, 162, bqab183. [Google Scholar] [CrossRef] [Scilit]
- Roth, Z.; Arav, A.; Bor, A.; Zeron, Y.; Braw-Tal, R.; Wolfenson, D. Improvement of quality of oocytes collected in the autumn by enhanced removal of impaired follicles from previously heat-stressed cows. Reproduction 2001, 122, 737–744. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Gao, H.; Tian, Z.; Wu, Y.; Wang, Y.; Fang, Y.; Lin, L.; Han, Y.; Wu, S.; Haq, I.; et al. Effects of chronic heat stress on granulosa cell apoptosis and follicular atresia in mouse ovary. J. Anim. Sci. Biotechnol. 2016, 7, 57. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.-Q.; Shen, M.; Wu, W.-J.; Li, B.-J.; Weng, Q.-N.; Li, M.; Liu, H.-L. Expression of PUMA in Follicular Granulosa Cells Regulated by FoxO1 Activation During Oxidative Stress. Reprod. Sci. 2015, 22, 696–705. [Google Scholar] [CrossRef] [Scilit]
- Takagi, K.; Yamada, T.; Miki, Y.; Umegaki, T.; Nishimura, M.; Sasaki, J. Makoto Nishimura, and Junzo Sasaki Histological Observation of the Development of Follicles and Follicular Atresia in Immature Rat Ovaries. Acta Med. Okayama 2007, 61, 283–298. [Google Scholar] [PubMed]
- Liao, H.-Q.; Zhou, J.; Cao, Y.; Nie, Y.-L.; Li, M.-Q.; Zhou, J. Vigilin interacts with ER-β to protect against palmitic acid-induced granulosa cells apoptosis via inhibiting calcineurin-mediated Drp1 signaling pathway. Steroids 2020, 163, 108699. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Regan, S.L.P.; Knight, P.; Yovich, J.L.; Leung, Y.; Arfuso, F.; Dharmarajan, A. Granulosa Cell Apoptosis in the Ovarian Follicle—A Changing view. Front. Endocrinol. 2018, 9, 61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, S.J.; Jung, S.Y.; Wu, S.-P.; Hawkins, S.M.; Park, M.J.; Kyo, S.; Qin, J.; Lydon, J.P.; Tsai, S.Y.; Tsai, M.-J.; et al. Estrogen Receptor β Modulates Apoptosis Complexes and the Inflammasome to Drive the Pathogenesis of Endometriosis. Cell 2015, 163, 960–974. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McPherson, S.J.; Hussain, S.; Balanathan, P.; Hedwards, S.L.; Niranjan, B.; Grant, M.; Chandrasiri, U.P.; Toivanen, R.; Wang, Y.; Taylor, R.A.; et al. Estrogen receptor–β activated apoptosis in benign hyperplasia and cancer of the prostate is androgen independent and TNFα mediated. PNAS 2010, 107, 3123–3128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, M.; Li, X.; Jia, S.; Liu, S.; Fu, L.; Jiang, X.; Yang, M. Bisphenol AF induces apoptosis via estrogen receptor beta (ERβ) and ROS-ASK1-JNK MAPK pathway in human granulosa cell line KGN. Environ. Pollut. 2021, 270, 116051. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Panza, S.; Santoro, M.; De Amicis, F.; Morelli, C.; Passarelli, V.; D’Aquila, P.; Giordano, F.; Cione, E.; Passarino, G.; Bellizzi, D.; et al. Estradiol via estrogen receptor beta influences ROS levels through the transcriptional regulation of SIRT3 in human seminoma TCam-2 cells. Tumor Biol. 2017, 39, 1–8. [Google Scholar] [CrossRef] [Scilit]




| Gene | Primer Sequences (5′—3′) | Length |
|---|---|---|
| β-Actin | F: CTTCCTGGGCATGGAGTCC | 201 bp |
| R: GGCGCGATGATCTTGATCTTC | ||
| CYP19A1 | F: GGTCACAACAAGACAGGA | 168 bp |
| R: AACCAAGAGAAGAAAGCC | ||
| FSHR | F: GCCCAGAACTAAAACACAATG | 107 bp |
| R: TATAGACAAGTAACCGTCAGC | ||
| BAX | F: AATTGGCTTGGTCTGTAT | 104 bp |
| R: CGGTCGTGATGGTATGTG | ||
| BCL2 | F: CATGCGTATTTATATTTG | 112 bp |
| R: CTCTGCTGCTTGCTGCTA | ||
| CASPASE 3 | F: ATGTCAGGCTAGTCTCTC | 124 bp |
| R: TGGTATGTAACTTGGGGA | ||
| ERβ | F: TATCTCCTCCCAGCAGCAGTCT | 153 bp |
| F: TATCTCCTCCCAGCAGCAGTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, F.; Zhu, X. Activin A Reduces Porcine Granulosa Cells Apoptosis via ERβ-Dependent ROS Modulation. Vet. Sci. 2022, 9, 704. https://doi.org/10.3390/vetsci9120704
Chen F, Zhu X. Activin A Reduces Porcine Granulosa Cells Apoptosis via ERβ-Dependent ROS Modulation. Veterinary Sciences. 2022; 9(12):704. https://doi.org/10.3390/vetsci9120704
Chicago/Turabian StyleChen, Fang, and Xiaoqing Zhu. 2022. "Activin A Reduces Porcine Granulosa Cells Apoptosis via ERβ-Dependent ROS Modulation" Veterinary Sciences 9, no. 12: 704. https://doi.org/10.3390/vetsci9120704
APA StyleChen, F., & Zhu, X. (2022). Activin A Reduces Porcine Granulosa Cells Apoptosis via ERβ-Dependent ROS Modulation. Veterinary Sciences, 9(12), 704. https://doi.org/10.3390/vetsci9120704
