Salmonella Gallinarum in Small-Scale Commercial Layer Flocks: Occurrence, Molecular Diversity and Antibiogram
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design and Location
2.2. Sample Collection from the Layer Farms
2.3. Isolation and Identification via Culture and Biochemical Tests
2.4. Serogrouping of Salmonella Isolates
2.5. Molecular Detection
2.6. Sequencing and Phylogenetic Tree Construction
2.7. Antimicrobial Susceptibility Screening
2.8. Data Management and Statistical Analysis
3. Results
3.1. Occurrence of Salmonella spp. and Salmonella Gallinarum
3.1.1. Sample Level Occurrence
3.1.2. Farm and Division Level Occurrence
3.2. Sequencing and Phylogenetic Analysis
3.3. Antibiogram
3.3.1. Antimicrobial Susceptibility Status
3.3.2. Antimicrobial Resistance Pattern
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hoque, M.N.; Mohiuddin, R.B.; Khan, M.M.H.; Hannan, A.; Alam, M.J. Outbreak of Salmonella in poultry of Bangladesh and possible remedy. J. Adv. Biotechnol. Exp. Ther. 2019, 2, 87–97. [Google Scholar] [CrossRef] [Scilit]
- Hafez, H.M. European perspectives on the control and eradication of some poultry diseases. In Advances and Challenges in Poultry Science; Tserveni-Goussi, A., Yanna-kopoulos, A., Fortomaris, P., Arsenos, G., Sossidou, E., Eds.; University Studio Press: Thessaloniki, Greece, 2008. [Google Scholar]
- Dar, M.A.; Mumtaz, P.T.; Bhat, S.A.; Nabi, M.; Taban, Q.; Shah, R.A.; Khan, H.M.; Ahmed, H.M. Genetics of Disease Resistance in Chicken, Application of Genetics and Genomics in Poultry Science; Liu, X., Ed.; IntechOpen: London, UK, 2018. Available online: https://www.intechopen.com/books/application-of-genetics-and-genomics-in-poultry-science/genetics-of-disease-resistance-in-chicken (accessed on 4 March 2021).
- Haider, M.; Chowdhury, E.; Khan, M.; Hossain, M.; Rahman, M.; Song, H.; Hossain, M. Experimental Pathogenesis of Pullorum Disease with the Local Isolate of Salmonella enterica serovar. enterica subspecies Pullorum in Pullets in Bangladesh. Korean J. Poult. Sci. 2009, 35, 341–350. [Google Scholar] [CrossRef] [Scilit]
- Popoff, M.Y.; Bockemühl, J.; Brenner, F.W. Supplement 1998 (no. 42) to the Kauffmann-White scheme. Res. Microbiol. 2000, 151, 63–65. [Google Scholar] [CrossRef] [Scilit]
- Popoff, M.Y.; LeMinor, L. Antigenic Formulas of the Salmonella Serovars, 7th revision ed.; World Health Organization Collaborating Centre for Reference and Research on Salmonella, Pasteur Institute: Paris, France, 1997. [Google Scholar]
- Christensen, J.P.; Olsen, J.; Bisgaard, M. Ribotypes of Salmonella enterica serovar Gallinarum biovars gallinarum and pullorum. Avian Pathol. 1993, 22, 725–738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiong, D.; Song, L.; Pan, Z.; Jiao, X. Identification and Discrimination of Salmonella enterica Serovar Gallinarum Biovars Pullorum and Gallinarum Based on a One-Step Multiplex PCR Assay. Front. Microbiol. 2018, 9, 1718. [Google Scholar] [CrossRef] [Scilit]
- Shivaprasad, H.L.; Barrow, P.A. Pullorum Disease and Fowl Typhoid. Diseases of Poultry, 12th ed.; Saif, Y.Y.M., Fadley, A.M., Glisson, J.R., McDougald, L.R., Nolan, L.K., Swayne, D.E., Eds.; Blackwell Publishing: Oxford, UK, 2008; pp. 620–634. [Google Scholar]
- Chiu, C.H.; Ou, J.T. Rapid identification of Salmonella serovars in feces by specific detection of virulence genes, invA and spvC, by an enrichment broth culture-multiplex PCR combination assay. Clin. Microbiol. 1996, 34, 2619–2622. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gulig, P.A.; Danbara, H.; Guiney, D.G.; Lax, A.J.; Norel, F.; Rhen, M. Molecular analysis of spv virulence genes of the Salmonella virulence plasmids. Mol. Microbiol. 1993, 7, 825–830. [Google Scholar] [CrossRef] [Scilit]
- Malorny, B.; Hoorfar, J.; Bunge, C.; Helmuth, C.B.R. Multicenter validation of the analytical accuracy of Salmonella PCR: Towards an international standard. Appl. Environ. Microbiol. 2003, 69, 290–296. [Google Scholar] [CrossRef] [Scilit]
- Galán, J.E.; Curtiss, R., 3rd. Cloning and molecular characterization of genes whose products allow Salmonella typhimurium to penetrate tissue culture cells. Proc. Natl. Acad. Sci. USA 1989, 86, 6383–6387. [Google Scholar] [CrossRef] [Scilit]
- Gulig, P.A.; Caldwell, A.L.; Chiodo, V.A. Identification, genetic analysis and DNA sequence of a 7.8-kb virulence region of the Salmonella typhimurium virulence plasmid. Mol. Microbiol. 1992, 6, 1395–1411. [Google Scholar] [CrossRef] [Scilit]
- Ou, J.T.; Baron, L.S.; Dai, X.Y.; Life, C.A. The virulence plasmids of Salmonella serovars typhimurium, choleraesuis, dublin, and enteritidis, and the cryptic plasmids of Salmonella serovars copenhagen and sendai belong to the same incompatibility group, but not those of Salmonella serovars durban, gallinarum, give, infantis and pullorum. Microb. Pathog. 1990, 8, 101–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Turki, Y.; Mehr, I.; Ouzari, H.; Khessairi, A.; Hassen, A. Molecular typing, antibiotic resistance, virulence gene and biofilm formation of different Salmonella enterica serotypes. J. Gen. Appl. Microbiol. 2014, 60, 123–130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahn, K.; De Grandis, S.; Clarke, R.; McEwen, S.; Galan, J.; Ginocchio, C.; Curtiss Iii, R.; Gyles, C. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol. Cell. Probes 1992, 6, 271–279. [Google Scholar] [CrossRef] [Scilit]
- Shivaprasad, H. Fowl typhoid and pullorum disease. Rev. Sci. Tech. 2000, 19, 405–416. [Google Scholar] [CrossRef] [Scilit]
- Kang, M.S.; Kim, A.; Jung, B.Y.; Her, M.; Jeong, W.; Cho, Y.M.; Oh, J.Y.; Lee, Y.J.; Kwon, J.H.; Kwon, Y.K. Characterization of antimicrobial resistance of recent Salmonella enterica serovar Gallinarum isolates from chickens in South Korea. Avian Pathol. 2010, 39, 201–205. [Google Scholar] [CrossRef] [Scilit]
- Kabir, S.M.L. Avian colibacillosis and salmonellosis: A closer look at epidemiology, pathogenesis, diagnosis, control and public health concerns. Int. J. Environ. Res. Public Health 2010, 7, 89–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahman, M.A.; Samad, M.A.; Rahman, M.B.; Kabir, S.M.L. Bacterio-pathological studies on salmonellosis, colibacillosis and pasteurellosis in natural and experimental infections in chickens. Bangladesh J. Vet. Med. 2004, 2, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Saha, A.; Sufian, M.; Hossain, M.; Hossain, M. Salmonellosis in layer chickens: Pathological features and isolation of bacteria from ovaries and inner content of laid eggs. J. Bangladesh Agric. Univ. 2012, 10, 61–67. [Google Scholar] [CrossRef] [Scilit]
- Al Mamun, M.A.; Kabir, S.M.L.; Islam, M.M.; Lubna, M.; Islam, S.S.; Akhter, A.H.M.T.; Hossain, M.M. Molecular identification and characterization of Salmonella species isolated from poultry value chains of Gazipur and Tangail districts of Bangladesh. Afr. J. Microbiol. Res. 2017, 11, 474–481. [Google Scholar]
- Mridha, D.; Uddin, M.N.; Alam, B.; Akhter, A.H.M.T.; Islam, S.S.; Islam, M.S.; Khan, M.S.R.; Kabir, S.M.L. Identification and characterization of Salmonella spp. from samples of broiler farms in selected districts of Bangladesh. Vet. World 2020, 13, 275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parvej, M.S.; Nazir, K.N.H.; Rahman, M.B.; Jahan, M.; Khan, M.F.R.; Rahman, M. Prevalence and characterization of multi-drug resistant Salmonella Enterica serovar Gallinarum biovar Pullorum and Gallinarum from chicken. Vet. World 2016, 9, 65. [Google Scholar] [CrossRef] [Scilit]
- Ferdous, T.A.; Kabir, S.M.L.; Amin, M.M.; Hossain, K.M.M. Identification and antimicrobial susceptibility of Salmonella species isolated from washing and rinsed water of broilers in pluck shops. Int. J. Anim. Veter. Adv. 2013, 5, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Berchieri Júnior, A.; Oliveira, G.H.D.; Pinheiro, L.A.S.; Barrow, P.A. Experimental Salmonella Gallinarum infection in light laying hen lines. Braz. J. Microbiol. 2000, 31, 50–52. [Google Scholar] [CrossRef] [Scilit]
- Khan, M.F.R.; Rahman, M.B.; Khan, M.S.R.; Nazir, K.H.M.N.H.; Rahman, M. Antibiogram and plasmid profile analysis of isolated poultry Salmonella of Bangladesh. Pak. J. Biol. Sci. 2005, 8, 1614–1619. [Google Scholar] [CrossRef] [Scilit]
- Im, M.C.; Jeong, S.J.; Kwon, Y.-K.; Jeong, O.-M.; Kang, M.-S.; Lee, Y.J. Prevalence and characteristics of Salmonella spp. isolated from commercial layer farms in Korea. Poult. Sci. 2015, 94, 1691–1698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Salauddin, A.S.; Hossain, M.F.; Dutta, A.; Mahmud, S.; Islam, M.S.; Saha, S.; Kabir, S.M.L. Isolation, identification, and antibiogram studies of Salmonella species and Escherichia coli from boiler meat in some selected areas of Bangladesh. Int. J. Basic Clin. Pharmacol. 2015, 4, 1000. [Google Scholar] [CrossRef] [Scilit]
- Ansarey, F.H. Prospects of poultry industry in Bangladesh. In Proceedings of the Seminar and Reception on Animal Husbandry Education and Profession in Bangladesh—A Journey of 50 Years, (AHEPB’12), Dhaka, Bangladesh, 2012; pp. 62–65. [Google Scholar]
- Van Schothorst, M.; Renaud, A.; Van Beek, C. Salmonella isolation using RVS broth and MLCB agar. Food Microbiol. 1987, 4, 11–18. [Google Scholar] [CrossRef] [Scilit]
- Islam, M.K.; Kabir, S.M.L.; Haque, A.K.M.Z.; Sarker, Y.A.; Sikder, M.H. Molecular detection and characterization of Escherichia coli, Salmonella spp. and Campylobacter spp. isolated from broiler meat in Jamalpur, Tangail, Netrokona and Kishoreganj districts of Bangladesh. Afr. J. Microbiol. Res. 2018, 12, 761–770. [Google Scholar]
- FDA. Bacteriological Analytical Manual, 8th ed.; AOAC International: Gaithersburg, MD, USA, 1998.
- Sannat, C.; Patyal, A.; Rawat, N.; Ghosh, R.; Jolhe, D.; Shende, R.; Hirpurkar, S.; Shakya, S. Characterization of Salmonella Gallinarum from an outbreak in Raigarh, Chhattisgarh. Vet. World 2017, 10, 144. [Google Scholar] [CrossRef] [Scilit]
- Phillips, I. Cowan and Steel’s Manual for the Identification of Medical Bacteria. J. Clin. Pathol. 1993, 46, 975. [Google Scholar] [CrossRef] [Scilit]
- Grimont, P.A.; Weill, F.-X. Antigenic Formulae of the Salmonella Serovars; WHO Collaborating Centre for Reference and Research on Salmonella, Institut Pasteur: Paris, France, 2007; Volume 9, pp. 1–166. Available online: https://www.pasteur.fr/sites/default/files/veng_0.pdf (accessed on 4 March 2021).
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef] [Scilit]
- Lin, C.; Tsen, H. Use of two 16S DNA targeted oligonucleotides as PCR primers for the specific detection of Salmonella in foods. J. Appl. Bacteriol. 1996, 80, 659–666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bayer, A.; Kirby, W.; Sherris, J.; Turck, M. Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol. 1966, 45, 493–496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clinical Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing, 26th ed.; CLSI Supplement M100S: Wayne, PA, USA, 2016; pp. 1–256. [Google Scholar]
- Sweeney, M.T.; Lubbers, B.V.; Schwarz, S.; Watts, J.L. Applying definitions for multidrug resistance, extensive drug resistance and pandrug resistance to clinically significant livestock and companion animal bacterial pathogens. J. Antimicrob. Chemother. 2018, 73, 1460–1463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haider, M.G.; Rahman, M.M.; Hossain, M.M.; Rashid, M.; Sufian, M.A.; Islam, M.M.; Haque, A.F.M.H. Production of formalin killed fowl typhoid vaccine using local isolates of Salmonella gallinarum in Bangladesh. J. Vet. Med. 2007, 33–38. [Google Scholar] [CrossRef] [Scilit]
- Bura, Q.T.; Magwisha, H.B.; Mdegela, R.H. Seroprevalence and risk factors for Salmonella gallinarum infection in smallholder layers in Mwanza City, Tanzania. Livest. Res. Rural. Dev. 2014, 26, 10. [Google Scholar]
- OIE. Fowl Typhoid and Pullorum Disease; Terrestrial Animal Health Code; World Organisation for Animal Health (OIE): Paris, France, 2019; Chapter 10.7. [Google Scholar]
- Huneau-Salaün, A.; Marianne, C.; Françoise, L.; Isabelle, P.; Sandra, R.; Virginie, M.; Philippe, F.; Nicolas, R. Risk factors for Salmonella enterica subsp. enterica contamination in 519 French laying hen flocks at the end of the laying period. Prev. Vet. Med. 2009, 89, 51–58. [Google Scholar] [CrossRef] [Scilit]
- Iwabuchi, E.; Maruyama, N.; Hara, A.; Nishimura, M.; Muramatsu, M.; Ochiai, T.; Hirai, K. Nationwide survey of Salmonella prevalence in environmental dust from layer farms in Japan. J. Food Prot. 2010, 73, 1993–2000. [Google Scholar] [CrossRef] [Scilit]
- Mdegela, R.H.; Yongolo, M.G.; Minga, U.M.; Olsen, J.E. Molecular epidemiology of Salmonella gallinarum in chickens in Tanzania. Avian Pathol. 2000, 29, 457–463. [Google Scholar] [CrossRef] [Scilit]
- Snow, L.; Davies, R.; Christiansen, K.; Carrique-Mas, J.; Wales, A.; O’connor, J.; Cook, A.; Evans, S. Survey of the prevalence of Salmonella species on commercial laying farms in the United Kingdom. Vet. Rec. 2007, 161, 471–476. [Google Scholar] [CrossRef] [Scilit]
- Neogi, S.B.; Islam, M.M.; Islam, S.S.; Akhter, A.H.M.T.; Sikder, M.M.H.; Yamasaki, S.; Kabir, S.M.L. Risk of multi-drug resistant Campylobacter spp. and residual antimicrobials at poultry farms and live bird markets in Bangladesh. BMC Infect. Dis. 2020, 20, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Sirdar, M.M.; Picard, J.; Bisschop, S.; Gummow, B. A questionnaire survey of poultry layer farmers in Khartoum State, Sudan, to study their antimicrobial awareness and usage patterns. Onderstepoort J. Vet. Res. 2012, 79, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, Y.J.; Kang, M.S. Protective efficacy of live Salmonella gallinarum 9R vaccine in commercial layer flocks. Avian Pathol. 2007, 36, 495–498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yasmin, S.; Nawaz, M.; Anjum, A.A.; Ashraf, K.; Ullah, N.; Mustafa, A.; Ali, M.A.; Mehmood, A. Antibiotic susceptibility pattern of Salmonellae isolated from poultry from different Districts of Punjab, Pakistan. Pak. Vet. J. 2019, 40, 98–102. [Google Scholar]
- Lee, S.K.; Chon, J.W.; Song, K.Y.; Hyeon, J.Y.; Moon, J.S.; Seo, K.-H. Prevalence, characterization, and antimicrobial susceptibility of Salmonella Gallinarum isolated from eggs produced in conventional or organic farms in South Korea. Poult. Sci. 2013, 92, 2789–2797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sultana, M.; Bilkis, R.; Diba, F.; Hossain, M.A. Predominance of multidrug resistant zoonotic Salmonella Enteritidis genotypes in poultry of Bangladesh. J. Poult. Sci. 2014, 51, 424–434. [Google Scholar] [CrossRef] [Scilit]
- Seo, K.W.; Kim, J.J.; Mo, I.P.; Lee, Y.J. Molecular characteristic of antimicrobial resistance of Salmonella Gallinarum isolates from chickens in Korea, 2014 to 2018. Poult. Sci. 2019, 98, 5416–5423. [Google Scholar] [CrossRef] [Scilit]
- Nath, S.K.; Akter, S.; Dutta, A.; Sen, A.B.; Chakrabarty, R.; Gupta, M.D. Prevalence and Antibiogram of Salmonella in Hisex Brown Strain at Commercial Poultry Farm in Chittagong. Int. J. Curr. Res. Biol. Med. 2015, 2, 14–19. [Google Scholar]
- Olovo, C.V.; Reward, E.E.; Obi, S.N.; Ike, A.C. Isolation, Identification and Antibiogram of Salmonella from Cloacal Swabs of Free Range Poultry in Nsukka, Nigeria. J. Adv. Microbiol. 2019, 1, 1–9. [Google Scholar]
- Chereau, F.; Opatowski, L.; Tourdjman, M.; Vong, S. Risk assessment for antibiotic resistance in South East Asia. BMJ 2017, 5, 358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dolberg, F. Poultry Sector Country Review. Bangladesh. 2008. Available online: http://www.fao.org/3/ai319e/ai319e.pdf (accessed on 4 March 2021).
- Singer, R.S.; Finch, R.; Wegener, H.C.; Bywater, R.; Walters, J.; Lipsitch, M. Antibiotic resistance—The interplay between antibiotic use in animals and human beings. Lancet Infect. Dis. 2003, 3, 47–51. [Google Scholar] [CrossRef] [Scilit]
- Babapour, A.; Azami, L.; Fartashmehr, J. Overview of antibiotic residues in beef and mutton in Ardebil, North West of Iran. World Appl. Sci. J. 2012, 19, 1417–1422. [Google Scholar]
- Akhter, A.H.M.T.; Islam, S.S.; Sufian, M.A.; Hossain, M.; Rahman, S.M.M.; Kabir, S.M.L.; Uddin, M.G.; Hossin, S.M.; Hossain, M.M. Implementation of code of practices (CoP) in selected poultry farms of Bangladesh. Asian Australas. J. Food Saf. Secur. 2018, 2, 45–55. [Google Scholar]
- Fraser, R.W.; Williams, N.; Powell, L.; Cook, A. Reducing Campylobacter and salmonella infection: Two studies of the economic cost and attitude to adoption of on farm biosecurity measures. Zoonoses Public Health 2010, 57, e109–e115. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Gene | Sequence (5′-3′) | Amplicon Size (bp) | Annealing Temperature | Reference |
|---|---|---|---|---|
| Sal 16S rRNA F | TGTTGTGGTTAATAACCGCA | 574 | 50 °C | [40] |
| Sal 16S rRNA R | CACAAATCCATCTCTGGA | |||
| invA-S139 | GTG AAATTATCGCCACGTTCGGGCAA | 284 | 64 °C | [17] |
| invA-S141 | TCATCGCACCGTCAAAGGAACC | |||
| spvC-SPV1 | ACTCCTTGCACAACCAAATGCGGA | 571 | 64 °C | [10] |
| spvC-SPV2 | TGTCTTCTGCATTTCGCCACCATCA |
| Method/Type of Sample | Number of Isolates | Occurrence (with 95% Confidence Interval) | p-Value (Pearson’s Chi-Squared Test) |
|---|---|---|---|
| Selective culture (Salmonella spp.) | |||
| Cloacal swab (n = 535) | 138 | 25.8 (22.1–29.7) | 0.003 |
| Visceral organ (n = 50) | 24 | 48 (33.7–62.6) | |
| Droppings (n = 180) | 52 | 29 (22.4–36.1) | |
| Total sample (N = 765) | 214 | 28 (24.8–31.3) | |
| Biochemical identification (Salmonellla Gallinarum) | |||
| Cloacal swab (n = 138) | 130 | 24.3 (20.7–28.2) | 0.02 |
| Visceral organ (n = 24) | 21 | 42 (28.2–56.8) | |
| Droppings (n = 52) | 48 | 26.7 (20.4–33.8) | |
| Total sample (N = 214) | 199 | 26 (22.9–29.3) | |
| Biochemical Tests | Salmonella Gallinarum | Salmonella Typhimurium | Salmonella Pullorum | Others |
|---|---|---|---|---|
| Carbohydrate fermentation | ||||
| Glucose | + | + | + | - |
| (Acid) | (Acid and Gas) | (Acid and Gas) | - | |
| Dulcitol | + | + | - | - |
| (Acid) | (Acid) | |||
| Maltose | + | + | ± | - |
| (Acid) | (Acid and Gas) | (Acid and Gas) | ||
| Indole production | - | - | - | - |
| Methyl red test | + | + | + | - |
| Voges-Proskauer test | - | - | - | - |
| Motility | - | + | - | - |
| Total isolates | 199 | 6 | 0 | 9 |
| Type of Sample | Number of Isolates | Occurrence (with 95% CI *) | p-Value (Pearson’s Chi-Squared Test) |
|---|---|---|---|
| 16S rRNA gene based PCR (Salmonella spp.) | |||
| Cloacal swab (n = 535) | 134 | 25 (21.4–28.9) | 0.015 |
| Visceral organ (n = 50) | 22 | 44 (30–58.7) | |
| Droppings (n = 180) | 49 | 27.2 (20.9–34.3) | |
| Total sample (N = 65) | 205 | 26.8 (23.7–30.1) | |
| invA and spvC gene based PCR (Salmonella Gallinarum) | |||
| Cloacal swab (n = 535) | 129 | 24.1 (20.5–28) | 0.02 |
| Visceral organ (n = 50) | 21 | 42.0 (28.2–56.8) | |
| Droppings (n = 180) | 47 | 26.1 (20–33.2) | |
| Total sample (N = 765) | 197 | 25.8 (22.7–29) | |
| Isolate (n) | No. of Serogroup (%) | |||
|---|---|---|---|---|
| Poly A-I | Group B (O: 4, 5, 27) | Group C (O: 6, 7, 8, 14, 20) | Group D (O: 9, 46) | |
| Salmonella spp. (205) | 205 (100) | 4 (2%) | 2 (1%) | 199 (97%) |
| Resistance Against Antimicrobials | Resistance Patterns | Salmonella Gallinarum Isolates (n = 197) | |
|---|---|---|---|
| No. (%) of Strains | Subtotal (No. (%)) | ||
| Against one to two antimicrobial agents | |||
| Against one | OT | 15 (7.6) | 39 (19.9) |
| SXT | 9 (4.6) | ||
| AMX | 7 (3.6) | ||
| DO | 8 (4.1) | ||
| Against two | OT, SXT | 9 (4.6) | 27 (13.7) |
| OT, AMX | 18 (9.1) | ||
| Against three or more antimicrobial agents (multidrug resistance) | |||
| Against three | CIP, DO, AZM | 19 (9.6) | 42 (21.3) |
| OT, CN, AMX | 23 (11.7) | ||
| Against four | ENR, OT, SXT, AMX | 16 (8.1) | 16 (8.1) |
| Against five | N, DO, SXT, AZM, AMX | 19 (9.6) | 35 (17.7) |
| GEN, LEV, OT, SXT, AMX | 16 (8.1) | ||
| Against six | CN, N, ENR, DO, SXT, AMX | 17 (8.6) | 38 (19.3) |
| N, LEV, AZM, OT, SXT, AMX | 21 (10.7) | ||
| Against three or more antimicrobials | 131 (66.5) | ||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Haque, A.K.M.Z.; Akter, M.R.; Islam, S.S.; Alam, J.; Neogi, S.B.; Yamasaki, S.; Kabir, S.M.L. Salmonella Gallinarum in Small-Scale Commercial Layer Flocks: Occurrence, Molecular Diversity and Antibiogram. Vet. Sci. 2021, 8, 71. https://doi.org/10.3390/vetsci8050071
Haque AKMZ, Akter MR, Islam SS, Alam J, Neogi SB, Yamasaki S, Kabir SML. Salmonella Gallinarum in Small-Scale Commercial Layer Flocks: Occurrence, Molecular Diversity and Antibiogram. Veterinary Sciences. 2021; 8(5):71. https://doi.org/10.3390/vetsci8050071
Chicago/Turabian StyleHaque, A. K. M. Ziaul, Mir Rowshan Akter, SK Shaheenur Islam, Jahangir Alam, Sucharit Basu Neogi, Shinji Yamasaki, and S. M. Lutful Kabir. 2021. "Salmonella Gallinarum in Small-Scale Commercial Layer Flocks: Occurrence, Molecular Diversity and Antibiogram" Veterinary Sciences 8, no. 5: 71. https://doi.org/10.3390/vetsci8050071
APA StyleHaque, A. K. M. Z., Akter, M. R., Islam, S. S., Alam, J., Neogi, S. B., Yamasaki, S., & Kabir, S. M. L. (2021). Salmonella Gallinarum in Small-Scale Commercial Layer Flocks: Occurrence, Molecular Diversity and Antibiogram. Veterinary Sciences, 8(5), 71. https://doi.org/10.3390/vetsci8050071

