Next Article in Journal
Antioxidant Activity, Phenolic Acid, and Flavonoid Composition of an Antiseptic Ointment Based on Aloe and Green Propolis and Its Potential for Preventing Mastitis in Dairy Cows
Previous Article in Journal
Comparative Echocardiographic Evaluation of Right Pulmonary Artery Dimensions and Right Pulmonary Artery Distensibility Index in Dogs with Heartworm Disease
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Xenotransplantation of Cryopreserved Calf Testicular Tissues

State Key Laboratory for Diagnosis and Treatment of Severe Zoonotic Infectious Diseases, College of Veterinary Medicine, Jilin University, Changchun 130062, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Vet. Sci. 2025, 12(3), 247; https://doi.org/10.3390/vetsci12030247
Submission received: 8 February 2025 / Revised: 28 February 2025 / Accepted: 3 March 2025 / Published: 4 March 2025

Simple Summary

The cryopreservation of testicular tissues is one of the strategies used for the germplasm preservation of endangered animals and especially to ensure high-quality and high-output livestock. The isolation of live cells and tissue transplantation are generally used to test the viability of cryopreserved tissues. Previously, we developed the freezing protocol of bovine testicular tissues and demonstrated the viability of these frozen–thawed bovine testicular tissues by the isolation and culture of viable cells. However, the whole viability of these tissues still needs to be verified. For this purpose, the subcutaneous xenotransplantation of calf testicular tissues was performed with castrated nude mice as recipients. Subsequently, the survival and development of the grafts were observed and analyzed initially after 28 days, which showed that cryopreserved calf testicular tissues retain their viability and developmental capacity after thawing and xenotransplantation.

Abstract

The cryopreservation of testicular tissues meets the demands for the germplasm preservation of humans and animals. Previously, we reported on the cryopreservation of bovine testicular tissues. To further evaluate the viability of these tissues, subcutaneous xenotransplantation of the frozen–thawed calf testicular tissues was performed with castrated nude mice as the recipients. After 28 days (D28), the survival and development of the grafts were examined. The grafts from 1-day-old (D1) calf testes were recovered and angiogenesis around the grafts was observed. Histologically, the seminiferous cords in the grafts were well maintained and capillaries in the interstitium were observed. Quantitative real-time PCR (qRT-PCR) analysis showed that the grafts expressed germline genes Gfrα-1, C-kit, and Sycp3 and somatic genes Sox9, Acta2, and Star. The expressions of C-kit, Sox9, Acta2, and Star were higher in 28D grafts than those in 1D and 30-day-old (30D) calf testicular controls. Together, we initially demonstrate that cryopreserved calf testicular tissues retain their viability and developmental capacity after xenotransplantation.

1. Introduction

Cryopreserved testicular tissues have a wide range of applications, particularly for the germplasm preservation of humans and animals [1,2,3]. With the continuous improvements in cryopreservation technology, combined with optimized culture systems and transplant techniques, the cryopreservation of testicular tissues lays a foundation for the further study of the spermatogenesis, diagnosis, and treatment of male sterility [2,3,4,5]. Generally, viability of the frozen–thawed testicular tissues can be assayed by three methods: (1) isolate and culture viable cells, (2) culture tissue fragments/blocks, and (3) transplant whole tissue fragments/blocks. The third method might be the better protocol to evaluate the histological integrity and entire viability of the frozen–thawed testicular tissues.
Tissue transplantation includes autotransplantation, allotransplantation, and xenotransplantation. Testicular tissue transplantation is an effective strategy to study the mechanism of spermatogenesis and treat male sterility. The autotransplantation of testicular tissues can be conducted orthotopically or heterotopically. The ability of cells to differentiate and form functional sperm is closely related to the status of immature testicular tissues. Healthy offspring were successfully obtained by the autotransplantation of immature testicular tissue from mice [1,6], rabbit [6], pig [1,7,8,9,10], and non-human primates [11,12], combined with intracytoplasmic monosperm microinjection. These reports confirmed the application feasibility of the cryopreservation of testicular tissue and subsequent transplantation in reproduction. Testicular xenotransplantation mostly uses mice as recipients, particularly for studies in large animals, such as pig [1,7,8,9,10], goat [1], sheep [13,14], buffalo [15], and non-human primate macaques [11,12]. In cattle, the ectopic xenografting of fresh testicular tissues has also been reported [16,17,18,19,20]. However, whether frozen–thawed bovine testicular tissues can survive and develop after xenotransplantation is unknown.
Based on our previous work [20,21], cryopreserved testicular tissues from 1-day-old (D1) calves were ectopically xenografted under the skin on the backs of castrated nude mice, and the grafts 28 days (D28) after transplantation were evaluated for growth, angiogenesis, and gene expressions, with the ungrafted testicular tissues of D1 and 30-day-old (D30) calves used as controls. We briefly showed here that the cryopreserved calf testicular tissues remained their integrity and viability in vivo after xenotransplantation, which provides evidence for the future application of cryopreserving–grafting testicular tissues in large livestock.

2. Materials and Methods

2.1. Bovine Testes and Chemicals

The testicular tissues of D1 and D30 calves (n = 3, respectively) were all cryopreserved and thawed as described [20,21]. Nine BALB/c (a laboratory white mouse breed, named by Halsey J. Bagg. He mixed his name “Bagg” and the word “albino”. “c” is the recessive epistatic gene for white coat color) male nude mice aged 4–5 weeks (14–16 g) were used as the recipients (Liaoning Changsheng Biotechnology Co., Ltd., Benxi, Liaoning Province, China). The experimental materials and procedures used here received endorsement from the Animal Welfare and Research Ethics Committee at Jilin University (No. SY201903002). Chemicals including matrigel (Gibco, Vacaville, CA, USA), 2% pentobarbital sodium (Beijing Chemical Works, Beijing, China), phosphate-buffered saline (PBS, BOSTER, Wuhan, China), and 4% paraformaldehyde solution (Biosharp, Hefei, China) were used. TransScript® All-in-One First-Strand cDNA Synthesis SuperMix was sourced from TransGen Biotech (Beijing, China).

2.2. Experimental Design, Recipient Castration, and Tissue Xenografting

Experimental Design: Nine mice were all castrated as the recipients, which all received grafts of D1 calf testicular tissues. The ungrafted testicular tissues of D1 and D30 calves (cryopreserved and thawed) were used as controls for a histological comparison and mRNA level analysis.
Recipient Castration: Each mouse was kept in a supine position after it was anesthetized by intraperitoneal injection with 2% pentobarbital sodium (40 mg/kg body weight). A 0.5 cm incision was made in the scrotum and the testes were removed. The spermatic cords and fat pads were returned to the abdominal cavity, following which the peritoneum and skin were sutured closed using medical suture.
Tissue Xenografting: During the surgery, each mouse received three incisions (~3 mm) on each side of the back, as described [15]. The cryopreserved D1 calf testicular tissues were thawed in a water bath at 37 °C and cut into pieces of 1–2 mm3. One piece of tissue was inserted through each incision, and each incision was injected with 30 μL of Matrigel. In total, each recipient received 6 pieces of the tissues. The incisions were disinfected and sutured closed. After 28 days, the grafts were collected for subsequent histological and gene expression analysis.

2.3. Hematoxylin and Eosin (HE) Staining

The tissues were fixed with PBS 4% formaldehyde for 24 h and embedded in paraffin wax. Each sample was cut into 5 μm thick sections. They were deparaffinized and rehydrated with a series of ethanol and then stained with hematoxylin and eosin. Histological observation was performed.

2.4. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

RNA was isolated from the sample tissues (D1 control, D28 grafts, and D30 controls) using TRIzon reagent (CoWin Biosciences, Jiangsu, China). Isolated RNAs were reverse-transcribed by Trans-Script® All-in-One First-Strand cDNA Synthesis SuperMix (TransGen, Beijing, China) to cDNA. qRT-PCR was used to evaluate the relative mRNA levels of germline genes (Gfrα-1, C-kit, Sycp3) and somatic genes (Sox9, Acta2, Star). The primers are listed in Table 1. The reactions were performed in a 20 μL volume system. The program used for gene amplification adhered to the guidelines provided by the kit manufacturer. GAPDH was set as the reference gene, and the 2−ΔΔCt method was applied for the analysis of relative gene expression.

2.5. Statistical Analysis

The quantitative experiments were performed in triplicate. Data were presented as mean ± standard errors (SD). SPSS 22.0 and GraphPad Prism 8.3.0 software were applied for statistics. One-way ANOVA was used for significance analysis, and * p < 0.05 indicates a significant difference.

3. Results

3.1. Surgery and Angiogenesis in the Xenografts

Xenotopic transplantation of the frozen–thawed tissues is shown in Figure 1. After general anesthesia (Figure 1A) and castration (Figure 1B), the D1 testicular tissues were ectopically xenografted under the skin on the backs of the recipients (Figure 1C). The growth of the grafts was visually identified during the grafting period. After 28 days, all the grafts were enveloped by loose connective tissue, and clear vascular networks were observed around them (Figure 1D). They were collected for the following analysis.

3.2. Histological Examination of the Xenografts

Histological analysis of the tissue architecture, structural integrity, and cellular morphology was performed. Compared with the D1 control tissues (Figure 2A), microstructures of the seminiferous cords, including gonocytes/spermatogonial stem cells (SSCs), immature Sertoli cells (SCs), basement membrane, and peritubular myoid cells (PMCs), in the D28 grafts were well maintained, and the cord diameters slightly increased (Figure 2B). In the D28 graft interstitium (Figure 2B), capillaries were also observed. They are similar with those in D1 and D30 control tissues (Figure 2A–C). Gradually, vacuoles appeared in the center of the seminiferous cords in the D28 grafts, which are similar with those in the D30 tissues (Figure 2C).

3.3. Gene Expressions in the Xenografts

Next, transcriptions of the SSC marker gene Gfrα-1, differentiating spermatogenic gene C-kit, and meiosis gene Sycp3 were analyzed. The mRNA levels of Gfrα-1 in the D28 grafts were lower than those both in the D1 and D30 controls (Figure 3A). In contrast, an increased mRNA level of the C-kit was detected in the D28 grafts compared to those in the controls (Figure 3B). For Sycp3, a similar expression trend was observed as for Gfrα-1 (Figure 3C). To further investigate the graft development, the mRNA levels of SC marker Sox9, PMC marker Acta2, and Leydig cell marker Star were assayed, showing increased expressions of Sox9, Acta2, and Star in D28 grafts (p < 0.05 or 0.01 except Acta2 in D28 grafts vs. D30 control, Figure 3D–F).

4. Discussion

Cryopreserved testicular tissues can be used to isolate and culture SSCs or perform tissue culture. Previously, we had reported the isolation and culture of gonocytes/SSCs from frozen–thawed bovine testicular tissues [20,21]. These materials can also be cultured as tissue fragments/blocks, but it is difficult to preserve their histological structure in vitro. Compared with germ cell culture and testicular tissue culture, the transplantation of frozen–thawed testicular tissues is able to preserve the tissue structure, particularly the spermatogenic environments/niches, and determine the entire biological activity of these tissues.
Although testicular tissue transplantation was reported a decade ago and the donor germ cells can develop and differentiate into sperm in several species, some problems/questions still need to be solved for its further application. Previously, the transplantation of cryopreserved testicular pieces from several species was reported [6,22,23]. However, the survival and development possibility of frozen–thawed bovine testicular tissues after transplantation is unknown. Studies have shown that the serum testosterone concentration in normal newborn males is very low, and it does not reach a high level until late spermatogenesis [15]. Thus, castrated adult immunodeficient mice were used as recipients here to simulate the low-concentration testosterone environment. Additionally, circulation establishment between the grafts and recipients is key to the survival of testicular grafts, which involves capillary exogenesis in grafts and large angiogenesis in recipients. Currently, testicular grafts are mostly avascular anastomosis tissues [5]. Evidence shows that the graft survival rate increased after encapsulating testicular tissues with alginate hydrogel and the adoption of vascular endothelial growth factor-encapsulated nanoparticles [19,24]. Therefore, we injected Matrigel into each incision to improve the survival and development of calf testicular grafts.
Excitingly, vascular networks around the xenografts were observed, and scattered capillaries were found in the interstitium of the grafts 28 d post-grafting, implying that circulation was established between the grafts and recipients. We also observed that the diameter of the seminiferous cords slightly increased and vacuoles appeared in the center of the seminiferous cords in the grafts, suggesting that the development of the seminiferous cords in the grafts is proceeding, and these vacuoles may be fused later to become the lumen of the seminiferous tubules. Spermatogenesis in bovine testis xenografts is less efficient [16,17] than that in mice [1,6], rabbits [6], pigs [1,7,8,9,10], goats [1], and sheep [13,14]. Generally, 4~8-week-old testis tissues were used for xenotransplantation in cattle [16,17,18,19] and buffalo [15]. Particularly, all these studies grafted fresh bovine testis tissues. Here, we xenografted cryopreserved 1D calf testis tissues using mouse recipients and established successful blood circulation between the survived grafts and the recipients post-grafting.
To further investigate xenograft development, the mRNA levels of germline genes and somatic genes were examined as reported [20,25]. The increased transcriptional expressions of germline gene C-kit, and somatic genes Sox9 and Star in D28 grafts than those in normal D30 testis, suggest that the seminiferous epithelium and interstitial tissue in the xenografts are indeed developing and differentiating, which is consistent with the descriptions that spermatogenesis in most immature testicular grafts often shows a physiological status earlier than that in normal testes [26]. It is also noticed that the mRNA level of Acta2 is not significantly higher than that in the D30 control; this could be due to our small sample number and relatively high standard deviation.

5. Conclusions

Here, we initially described cryopreserved calf testicular xenografting in immunocompromised mouse recipients. As an easy-to-prepare in vivo model, it is a useful tool to reveal testicular physiology and male germ cell development and preserve and protect the germplasm of humans, excellent breeding animals, as well rare and endangered species. The limitation of this brief report is that the grafts were grown only in a limited period due to the pandemic. The fate of seminiferous cords/tubules in the grafts needs to be observed for a longer amount of time in the future.

Author Contributions

Y.Z. and W.Z.: experimental design, data acquisition and analysis, manuscript writing. R.Y. and B.Z.: data acquisition, validation, methodology. B.T.: fund raising. X.Z.: study design, analysis, manuscript writing and fund raising. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 32172803) and the Natural Science Foundation of Jilin Province, China (No. 20240101255JC).

Institutional Review Board Statement

The animal study protocol was approved by the Jilin University Institutional Animal Care and Use Committee for the use of animals/tissues (SY201903002) on 8 March 2019.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Honaramooz, A.; Snedaker, A.; Boiani, M.; Schöler, H.; Dobrinski, I.; Schlatt, S. Sperm from neonatal mammalian testes grafted in mice. Nature 2002, 418, 778–781. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Kilcoyne, K.R.; Mitchell, R.T. Fertility Preservation: Testicular transplantation for fertility preservation: Clinical potential and current challenges. Reproduction 2019, 158, F1–F14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Pelzman, D.L.; Orwig, K.E.; Hwang, K. Progress in translational reproductive science: Testicular tissue transplantation and in vitro spermatogenesis. Fertil. Steril. 2020, 113, 500–509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Nikmahzar, A.; Khadivi, F.; Abbasi, M.; Mahdavinezhad, F.; Abbasi, Y.; Daneshi, E. Testicular tissue vitrification: A promising strategy for male fertility preservation. Reprod. Sci. 2023, 30, 1687–1700. [Google Scholar] [CrossRef] [Scilit]
  5. Vermeulen, M.; Poels, J.; de Michele, F.; des Rieux, A.; Wyns, C. Restoring fertility with cryopreserved prepubertal testicular tissue: Perspectives with hydrogel encapsulation, nanotechnology, and bioengineered scaffold. Ann. Biomed. Eng. 2017, 45, 1770–1781. [Google Scholar] [CrossRef] [Scilit]
  6. Shinohara, T.; Inoue, K.; Ogonuki, N.; Kanatsu-Shinohara, M.; Miki, H.; Nakata, K.; Kurome, M.; Nagashima, H.; Toyokuni, S.; Kogishi, K.; et al. Birth of offspring following transplantation of cryopreserved immature testicular pieces and in vitro microinsemination. Hum. Reprod. 2002, 17, 3039–3045. [Google Scholar] [CrossRef] [Scilit]
  7. Abrishami, M.; Anzar, M.; Yang, Y.; Honaramooz, A. Cryopreservation of immature porcine testis tissue to maintain its developmental potential after xenografting into recipient mice. Theriogenology 2010, 73, 86–96. [Google Scholar] [CrossRef] [Scilit]
  8. Kaneko, H.; Kikuchi, K.; Nakai, M.; Somfai, T.; Noguchi, J.; Tanihara, F.; Ito, J.; Kashiwazaki, N. Generation of live piglets for the first time using sperm retrieved from immature testicular tissue cryopreserved and grafted into nude mice. PLoS ONE 2013, 8, e70989. [Google Scholar] [CrossRef] [Scilit]
  9. Kaneko, H.; Kikuchi, K.; Men, N.T.; Dang-Nguyen, T.Q.; Oyadomari, M.; Touma, S.; Suzuki, N.; Katagiri, Y. Embryo production by intracytoplasmic injection of sperm retrieved from neonatal testicular tissue of Agu pigs after cryopreservation and grafting into nude mice. Anim. Sci. J. 2020, 91, e13479. [Google Scholar] [CrossRef] [Scilit]
  10. Kaneko, H.; Kikuchi, K.; Men, N.T.; Noguchi, J. Embryo production by intracytoplasmic injection of sperm retrieved from Meishan neonatal testicular tissue cryopreserved and grafted into nude mice. Anim. Sci. J. 2019, 90, 158–166. [Google Scholar] [CrossRef] [Scilit]
  11. Liu, Z.; Nie, Y.H.; Zhang, C.C.; Cai, Y.J.; Wang, Y.; Lu, H.P.; Li, Y.Z.; Cheng, C.; Qiu, Z.L.; Sun, Q. Generation of macaques with sperm derived from juvenile monkey testicular xenografts. Cell Res. 2016, 26, 139–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Ntemou, E.; Kadam, P.; Van Saen, D.; Wistuba, J.; Mitchell, R.T.; Schlatt, S.; Goossens, E. Complete spermatogenesis in intratesticular testis tissue xenotransplants from immature non-human primate. Hum. Reprod. 2019, 34, 403–413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Arregui, L.; Rathi, R.; Megee, S.O.; Honaramooz, A.; Gomendio, M.; Roldan, E.R.; Dobrinski, I. Xenografting of sheep testis tissue and isolated cells as a model for preservation of genetic material from endangered ungulates. Reproduction 2008, 136, 85–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Rodriguez-Sosa, J.R.; Foster, R.A.; Hahnel, A. Development of strips of ovine testes after xenografting under the skin of mice and co-transplantation of exogenous spermatogonia with grafts. Reproduction 2010, 139, 227–235. [Google Scholar] [CrossRef] [Scilit]
  15. Reddy, N.; Mahla, R.S.; Thathi, R.; Suman, S.K.; Jose, J.; Goel, S. Gonadal status of male recipient mice influences germ cell development in immature buffalo testis tissue xenograft. Reproduction 2012, 143, 59–69. [Google Scholar] [CrossRef] [Scilit]
  16. Oatley, J.M.; de Avila, D.M.; Reeves, J.J.; McLean, D.J. Spermatogenesis and germ cell transgene expression in xenografted bovine testicular tissue. Biol. Reprod. 2004, 71, 494–501. [Google Scholar] [CrossRef] [Scilit]
  17. Oatley, J.M.; Reeves, J.J.; McLean, D.J. Establishment of spermatogenesis in neonatal bovine testicular tissue following ectopic xenografting varies with donor age. Biol. Reprod. 2005, 72, 358–364. [Google Scholar] [CrossRef] [Scilit]
  18. Schmidt, J.A.; de Avila, J.M.; McLean, D.J. Grafting period and donor age affect the potential for spermatogenesis in bovine ectopic testis xenografts. Biol. Reprod. 2006, 75, 160–166. [Google Scholar] [CrossRef] [Scilit]
  19. Schmidt, J.A.; de Avila, J.M.; McLean, D.J. Effect of vascular endothelial growth factor and testis tissue culture on spermatogenesis in bovine ectopic testis tissue xenografts. Biol. Reprod. 2006, 75, 167–175. [Google Scholar] [CrossRef] [Scilit]
  20. Jiang, Y.; Zhu, W.Q.; Zhu, X.C.; Cai, N.N.; Yang, R.; Cai, H.; Zhang, X.M. Cryopreservation of calf testicular tissues with knockout serum replacement. Cryobiology 2020, 92, 255–257. [Google Scholar] [CrossRef] [Scilit]
  21. Zhu, W.Q.; Cai, N.N.; Jiang, Y.; Yang, R.; Shi, J.Z.; Zhu, C.L.; Zhang, B.Y.; Tang, B.; Zhang, X.M. Survivable potential of germ cells after trehalose cryopreservation of bovine testicular tissues. Cryobiology 2021, 101, 105–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Abbasi, S.; Honaramooz, A. Xenografting of testis tissue from bison calf donors into recipient mice as a strategy for salvaging genetic material. Theriogenology 2011, 76, 607–614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Fayomi, A.P.; Peters, K.; Sukhwani, M.; Valli-Pulaski, H.; Shetty, G.; Meistrich, M.L.; Houser, L.; Robertson, N.; Roberts, V.; Ramsey, C.; et al. Autologous grafting of cryopreserved prepubertal rhesus testis produces sperm and offspring. Science 2019, 363, 1314–1319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Poels, J.; Abou-Ghannam, G.; Decamps, A.; Leyman, M.; des Rieux, A.; Wyns, C. Transplantation of testicular tissue in alginate hydrogel loaded with VEGF nanoparticles improves spermatogonial recovery. J. Control. Release 2016, 234, 79–89. [Google Scholar] [CrossRef] [Scilit]
  25. Li, H.; Bian, Y.L.; Schreurs, N.; Zhang, X.G.; Raza, S.H.A.; Fang, Q.; Wang, L.Q.; Hu, J.H. Effects of five cryoprotectants on proliferation and differentiation-related gene expression of frozen-thawed bovine calf testicular tissue. Reprod. Domest. Anim. 2018, 53, 1211–1218. [Google Scholar] [CrossRef] [Scilit]
  26. Anvari, A.; Movahedin, M.; Hamzeh, M. Optimizing immature testicular tissue and cell transplantation results: Comparing transplantation sites and scaffolds. Int. J. Fertil. Steril. 2024, 18, 12–19. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Calf testicular tissues were transplanted on the back of castrated Balb/c male nude mice. (A) Anesthesia; (B) gonadectomy; (C) transplantation of D1 calf testicular tissues and suture; (D) grafts on D28; note the blood vessels around grafts (blue arrows).
Figure 1. Calf testicular tissues were transplanted on the back of castrated Balb/c male nude mice. (A) Anesthesia; (B) gonadectomy; (C) transplantation of D1 calf testicular tissues and suture; (D) grafts on D28; note the blood vessels around grafts (blue arrows).
Vetsci 12 00247 g001
Figure 2. HE staining of the transplanted calf testicular tissues. (A) Ungrafted D1 calf testicular tissues; (B) D28 xenografted tissues; (C) ungrafted D30 calf testicular tissues. Green arrows: gonocytes, blue triangles: spermatogonial stem cells (SSCs), green triangles: Sertoli cells (SCs), yellow arrows: peritubular myoid cells (PMCs), red stars: vacuoles, yellow stars: basement membrane, blue arrows: capillaries. Scale bar = 50 μm in (AC).
Figure 2. HE staining of the transplanted calf testicular tissues. (A) Ungrafted D1 calf testicular tissues; (B) D28 xenografted tissues; (C) ungrafted D30 calf testicular tissues. Green arrows: gonocytes, blue triangles: spermatogonial stem cells (SSCs), green triangles: Sertoli cells (SCs), yellow arrows: peritubular myoid cells (PMCs), red stars: vacuoles, yellow stars: basement membrane, blue arrows: capillaries. Scale bar = 50 μm in (AC).
Vetsci 12 00247 g002
Figure 3. qRT-PCR analysis of the gene expressions in the xenografts. (A) SSC marker Gfrα-1; (B) spermatogenic differentiating gene C-kit; (C) meiotic gene Sycp3; (D) SC marker Sox9; (E) PMC marker Acta2; (F) Leydig cell marker Star; data were presented as mean ± SD, * p  <  0.05, ** p  <  0.01, *** p  <  0.001, and ns = no statistical significance.
Figure 3. qRT-PCR analysis of the gene expressions in the xenografts. (A) SSC marker Gfrα-1; (B) spermatogenic differentiating gene C-kit; (C) meiotic gene Sycp3; (D) SC marker Sox9; (E) PMC marker Acta2; (F) Leydig cell marker Star; data were presented as mean ± SD, * p  <  0.05, ** p  <  0.01, *** p  <  0.001, and ns = no statistical significance.
Vetsci 12 00247 g003
Table 1. Primer sequences for qRT-PCR analysis.
Table 1. Primer sequences for qRT-PCR analysis.
Gene Forward Primer (5′-3′)Reverse Primer (5′-3′)
GAPDHCGGCACAGTCAAGGCAGAGAACCGGCACAGTCAAGGCAGAGAAC
GFRα-1TGGCCCTGCTTGTTTTCCTCTACAGGTATGCACGCTTGTGT
C-KitTGTCTGCACTGCTCAGCGAATCTTGATGGCTGCCCGCACTTTC
Sycp3CCGGGAAGTTGGCAAAACCA GGCATCCTCCTCTGAACCACT
Sox9AGGAGAGCGAGGAGGACAAGTTCACCAGCGTCCAGTCGTAGCC
Acta2GATGGTGGGAATGGGACAGAAAGACGGTGATGATGCCGTGCTCTATCG
StarAAGACCCTCTCTACAGCGACCAAGGGATCACTTTACTCAGCACCTCGTC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, Y.; Zhu, W.; Yang, R.; Zhang, B.; Tang, B.; Zhang, X. Xenotransplantation of Cryopreserved Calf Testicular Tissues. Vet. Sci. 2025, 12, 247. https://doi.org/10.3390/vetsci12030247

AMA Style

Zhao Y, Zhu W, Yang R, Zhang B, Tang B, Zhang X. Xenotransplantation of Cryopreserved Calf Testicular Tissues. Veterinary Sciences. 2025; 12(3):247. https://doi.org/10.3390/vetsci12030247

Chicago/Turabian Style

Zhao, Yansen, Wenqian Zhu, Rui Yang, Boyang Zhang, Bo Tang, and Xueming Zhang. 2025. "Xenotransplantation of Cryopreserved Calf Testicular Tissues" Veterinary Sciences 12, no. 3: 247. https://doi.org/10.3390/vetsci12030247

APA Style

Zhao, Y., Zhu, W., Yang, R., Zhang, B., Tang, B., & Zhang, X. (2025). Xenotransplantation of Cryopreserved Calf Testicular Tissues. Veterinary Sciences, 12(3), 247. https://doi.org/10.3390/vetsci12030247

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop