Hermetia illucens Larvae Meal Enhances Immune Response by Improving Serum Immunoglobulin, Intestinal Barrier and Gut Microbiota of Sichuan White Geese After Avian Influenza Vaccination
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Ethics
2.2. Preparation of Test Subjects
2.3. Experimental Design
2.4. Growth Performance
2.5. Immunological Potency and Specific Antibody of AIV
2.6. Serum Biochemical Indicators and Jejunum SIgA
2.7. Intestinal Morphology Analysis
2.8. mRNA Expression Spleen Immune Genes and Jejunum Barrier Gene
2.9. Gut Microbiota Analysis
2.10. Data Analysis
3. Results
3.1. Effects of HILM on Growth Performance
3.2. Effects of HILM on AIV Immunological Potency and Specific Antibody
3.3. Effects of HILM on Serum Immunoglobulin, Complement c3, Complement c4 and Jejunum SIgA
3.4. Effects of HILM on Intestinal Morphology
3.5. Effects of HILM on Spleen Immune-Related Genes and Jejunum Barrier-Related Gene mRNA Expression
3.6. Effects of HILM on Microflora in Cecal Contents
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sandström, V.; Chrysafi, A.; Lamminen, M.; Troell, M.; Jalava, M.; Piipponen, J.; Siebert, S.; van Hal, O.; Virkki, V.; Kummu, M. Food System By-Products Upcycled in Livestock and Aquaculture Feeds Can Increase Global Food Supply. Nat. Food 2022, 3, 729–740. [Google Scholar] [CrossRef]
- Rathnayaka, S.D.; Selvanathan, S.; Selvanathan, E.A. Demand for Animal-Derived Food in Selected Asian Countries: A System-Wide Analysis. Agric. Econ. 2021, 52, 97–122. [Google Scholar] [CrossRef]
- De Smet, J.; Wynants, E.; Cos, P.; Van Campenhout, L. Microbial Community Dynamics during Rearing of Black Soldier Fly Larvae (Hermetia Illucens) and Impact on Exploitation Potential. Appl. Environ. Microbiol. 2018, 84, e02722-17. [Google Scholar] [CrossRef]
- Gasco, L.; Biasato, I.; Dabbou, S.; Schiavone, A.; Gai, F. Animals Fed Insect-Based Diets: State-of-the-Art on Digestibility, Performance and Product Quality. Animals 2019, 9, 170. [Google Scholar] [CrossRef] [PubMed]
- Hong, J.; Han, T.; Kim, Y.Y. Mealworm (Tenebrio Molitor Larvae) as an Alternative Protein Source for Monogastric Animal: A Review. Animals 2020, 10, 2068. [Google Scholar] [CrossRef] [PubMed]
- Selaledi, L.; Hassan, Z.; Manyelo, T.G.; Mabelebele, M. Insects’ Production, Consumption, Policy, and Sustainability: What Have We Learned from the Indigenous Knowledge Systems? Insects 2021, 12, 432. [Google Scholar] [CrossRef] [PubMed]
- Liland, N.S.; Biancarosa, I.; Araujo, P.; Biemans, D.; Bruckner, C.G.; Waagbø, R.; Torstensen, B.E.; Lock, E.-J. Modulation of Nutrient Composition of Black Soldier Fly (Hermetia Illucens) Larvae by Feeding Seaweed-Enriched Media. PLoS ONE 2017, 12, e0183188. [Google Scholar] [CrossRef]
- Barragan-Fonseca, K.B.; Dicke, M.; Van Loon, J.J.A. Nutritional Value of the Black Soldier Fly (Hermetia illucens L.) and Its Suitability as Animal Feed—A Review. J. Insects Food Feed. 2017, 3, 105–120. [Google Scholar] [CrossRef]
- Yu, M.; Li, Z.; Chen, W.; Rong, T.; Wang, G.; Ma, X. Hermetia Illucens Larvae as a Potential Dietary Protein Source Altered the Microbiota and Modulated Mucosal Immune Status in the Colon of Finishing Pigs. J. Anim. Sci. Biotechnol. 2019, 10, 50. [Google Scholar] [CrossRef]
- Jin, X.; Yuan, B.; Liu, M.; Zhu, M.; Zhang, X.; Xie, G.; Wu, W.; Wang, Z.; Xu, H.; Lv, Y.; et al. Dietary Hermetia Illucens Larvae Replacement Alleviates Diarrhea and Improves Intestinal Barrier Function in Weaned Piglets Challenged with Enterotoxigenic Escherichia Coli K88. Front. Vet. Sci. 2021, 8, 746224. [Google Scholar] [CrossRef]
- Hartinger, K.; Greinix, J.; Thaler, N.; Ebbing, M.A.; Yacoubi, N.; Schedle, K.; Gierus, M. Effect of Graded Substitution of Soybean Meal by Hermetia Illucens Larvae Meal on Animal Performance, Apparent Ileal Digestibility, Gut Histology and Microbial Metabolites of Broilers. Animals 2021, 11, 1628. [Google Scholar] [CrossRef] [PubMed]
- Chernysh, S.; Gordya, N.; Suborova, T. Insect Antimicrobial Peptide Complexes Prevent Resistance Development in Bacteria. PLoS ONE 2015, 10, e0130788. [Google Scholar] [CrossRef]
- Xia, J.; Ge, C.; Yao, H. Antimicrobial Peptides from Black Soldier Fly (Hermetia Illucens) as Potential Antimicrobial Factors Representing an Alternative to Antibiotics in Livestock Farming. Animals 2021, 11, 1937. [Google Scholar] [CrossRef] [PubMed]
- Spranghers, T.; Michiels, J.; Vrancx, J.; Ovyn, A.; Eeckhout, M.; De Clercq, P.; De Smet, S. Gut Antimicrobial Effects and Nutritional Value of Black Soldier Fly (Hermetia Illucens L.)Prepupae for Weaned Piglets. Anim. Feed. Sci. Tech. 2018, 235, 33–42. [Google Scholar] [CrossRef]
- Karlsen, Ø.; Amlund, H.; Berg, A.; Olsen, R.E. The Effect of Dietary Chitin on Growth and Nutrient Digestibility in Farmed Atlantic Cod, Atlantic Salmon and Atlantic Halibut. Aquac. Res. 2017, 48, 123–133. [Google Scholar] [CrossRef]
- Ali, M.F.Z.; Ohta, T.; Ido, A.; Miura, C.; Miura, T. The Dipterose of Black Soldier Fly (Hermetia Illucens) Induces Innate Immune Response through Toll-Like Receptor Pathway in Mouse Macrophage RAW264.7 Cells. Biomolecules 2019, 9, 677. [Google Scholar] [CrossRef]
- Lin, Q.; Jiang, G.-T.; Dai, Q.-Z.; Zhang, X.; Huang, X.; Li, C. The Complete Mitochondrial Genome of the Sichuan White Goose and Its Phylogenetic Analyses. Mitochondrial DNA Part B 2019, 4, 754–755. [Google Scholar] [CrossRef]
- Biasato, I.; Ferrocino, I.; Dabbou, S.; Evangelista, R.; Gai, F.; Gasco, L.; Cocolin, L.; Capucchio, M.T.; Schiavone, A. Black Soldier Fly and Gut Health in Broiler Chickens: Insights into the Relationship between Cecal Microbiota and Intestinal Mucin Composition. J. Anim. Sci. Biotechnol. 2020, 11, 11. [Google Scholar] [CrossRef]
- Dabbou, S.; Gai, F.; Biasato, I.; Capucchio, M.T.; Biasibetti, E.; Dezzutto, D.; Meneguz, M.; Plachà, I.; Gasco, L.; Schiavone, A. Black Soldier Fly Defatted Meal as a Dietary Protein Source for Broiler Chickens: Effects on Growth Performance, Blood Traits, Gut Morphology and Histological Features. J. Anim. Sci. Biotechnol. 2018, 9, 49. [Google Scholar] [CrossRef]
- Liu, M.; Chen, R.; Wang, T.; Ding, Y.; Zhang, Y.; Huang, G.; Huang, J.; Qu, Q.; Lv, W.; Guo, S. Dietary Chinese Herbal Mixture Supplementation Improves Production Performance by Regulating Reproductive Hormones, Antioxidant Capacity, Immunity, and Intestinal Health of Broiler Breeders. Poult. Sci. 2024, 103, 103201. [Google Scholar] [CrossRef]
- Mwaniki, Z.; Shoveller, A.K.; Huber, L.-A.; Kiarie, E.G. Complete Replacement of Soybean Meal with Defatted Black Soldier Fly Larvae Meal in Shaver White Hens Feeding Program (28–43 Wks of Age): Impact on Egg Production, Egg Quality, Organ Weight, and Apparent Retention of Components. Poult. Sci. 2020, 99, 959–965. [Google Scholar] [CrossRef] [PubMed]
- Stejskal, V.; Tran, H.Q.; Prokesová, M.; Zare, M.; Gebauer, T.; Policar, T.; Caimi, C.; Gai, F.; Gasco, L. Defatted Black Soldier Fly (Hermetia Illucens) in Pikeperch (Sander Lucioperca) Diets: Effects on Growth Performance, Nutrient Digestibility, Fillet Quality, Economic and Environmental Sustainability. Anim. Nutr. 2023, 12, 7–19. [Google Scholar] [CrossRef] [PubMed]
- Chu, X.; Li, M.; Wang, G.; Wang, K.; Shang, R.; Wang, Z.; Li, L. Evaluation of the low inclusion of full-fatted Hermetia illucens larvae meal for layer chickens: Growth performance, nutrient digestibility, and gut health. Front Vet. Sci. 2020, 7, 585843. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Tawwab, M.; Khalil, R.H.; Metwally, A.A.; Shakweer, M.S.; Khallaf, M.A.; Abdel-Latif, H.M.R. Effects of Black Soldier Fly (Hermetia Illucens L.) Larvae Meal on Growth Performance, Organs-Somatic Indices, Body Composition, and Hemato-Biochemical Variables of European Sea Bass, Dicentrarchus Labrax. Aquaculture 2020, 522, 735136. [Google Scholar] [CrossRef]
- Li, F.; Lv, B.; Zuo, J.; Nawaz, S.; Wang, Z.; Lian, L.; Yin, H.; Chen, S.; Han, X.; Wang, H. Effect of Solid-State Fermentation Products of Lactobacillus Plantarum, Candida Utilis, and Bacillus Coagulans on Growth Performance of Broilers and Prevention of Avian Colibacillosis. Vet. Sci. 2024, 11, 468. [Google Scholar] [CrossRef] [PubMed]
- Alghamdi, M.A.; Elbaz, M.I.; Ismail, I.E.; Reda, F.M.; Alagawany, M.; El-Tarabily, K.A.; Abdelgeliel, A.S. Dietary Supplementation with a Mixture of Dunaliella Salina and Spirulina Enhances Broiler Performance by Improving Growth, Immunity, Digestive Enzymes and Gut Microbiota. Poult. Sci. 2024, 103, 103337. [Google Scholar] [CrossRef]
- Tian, Y.; Wang, Q.; Han, J.; Wen, J.; Wu, Y.; Man, C. Stress-Induced Immunosuppression Affecting Avian Influenza Virus Vaccine Immune Response through miR-20a-5p/NR4A3 Pathway in Chicken. Vet. Microbiol. 2022, 273, 109546. [Google Scholar] [CrossRef]
- Agbohessou, P.S.; Mandiki, S.N.M.; Mbondo Biyong, S.R.; Cornet, V.; Nguyen, T.M.; Lambert, J.; Jauniaux, T.; Lalèyè, P.A.; Kestemont, P. Intestinal Histopathology and Immune Responses Following Escherichia Coli Lipopolysaccharide Challenge in Nile Tilapia Fed Enriched Black Soldier Fly Larval (BSF) Meal Supplemented with Chitinase. Fish Shellfish. Immunol. 2022, 128, 620–633. [Google Scholar] [CrossRef]
- Gary, S.; Ralph, C.; Sherine, E.; McInnes, I.B.; O’Dell, J.R. Kelley’s Textbook of Rheumatology, 9th ed.; W.B. Saunders.: Philadelphia, PA, USA, 2013; Volume 14, pp. 191–214. [Google Scholar]
- Harboe, M.; Mollnes, T.E. The alternative complement pathway revisited. Cell Mol. Med. 2008, 12, 1074–1084. [Google Scholar] [CrossRef]
- Lewis, S.M.; Williams, A.; Eisenbarth, S.C. Structure and Function of the Immune System in the Spleen. Sci. Immunol. 2019, 4, eaau6085. [Google Scholar] [CrossRef]
- Zhang, S.; Mou, C.; Cao, Y.; Zhang, E.; Yang, Q. Immune Response in Piglets Orally Immunized with Recombinant Bacillus Subtilis Expressing the Capsid Protein of Porcine Circovirus Type 2. Cell Commun. Signal. 2020, 18, 23. [Google Scholar] [CrossRef] [PubMed]
- Dienz, O.; Eaton, S.M.; Bond, J.P.; Neveu, W.; Moquin, D.; Noubade, R.; Briso, E.M.; Charland, C.; Leonard, W.J.; Ciliberto, G.; et al. The Induction of Antibody Production by IL-6 Is Indirectly Mediated by IL-21 Produced by CD4+ T Cells. J. Exp. Med. 2009, 206, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Santos, R.R.; Ooosterveer-van der Doelen, M.A.M.; Tersteeg-Zijderveld, M.H.G.; Molist, F.; Gehring, R. Induction of Gut Leakage in Young Broiler Chickens Fed a Diet with Low Rye Inclusion. Heliyon 2021, 7, e08547. [Google Scholar] [CrossRef]
- Su, G.; Wang, L.; Zhou, X.; Wu, X.; Chen, D.; Yu, B.; Huang, Z.; Luo, Y.; Mao, X.; Zheng, P.; et al. Effects of Essential Oil on Growth Performance, Digestibility, Immunity, and Intestinal Health in Broilers. Poult. Sci. 2021, 100, 101242. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Cai, H.; Liu, G.; Dong, X.; Chang, W.; Zhang, S.; Zheng, A.; Chen, G. Effect of Dexamethasone on Disacchridase Activities and Mucosa Morphology in Jejunum of Broilers. Chin. J. Anim. Vet. Sci. 2008, 39, 48. [Google Scholar]
- Zhang, Z.; Zhu, T.; Zhang, L.; Xing, Y.; Yan, Z.; Li, Q. Critical Influence of Cytokines and Immune Cells in Autoimmune Gastritis. Autoimmunity 2023, 56, 2174531. [Google Scholar] [CrossRef]
- He, C.; Lei, J.; Yao, Y.; Qu, X.; Chen, J.; Xie, K.; Wang, X.; Yi, Q.; Xiao, B.; Guo, S.; et al. Black Soldier Fly (Hermetia Illucens) Larvae Meal Modulates Intestinal Morphology and Microbiota in Xuefeng Black-Bone Chickens. Front. Microbiol. 2021, 12, 706424. [Google Scholar] [CrossRef]
- Phaengphairee, P.; Boontiam, W.; Wealleans, A.; Hong, J.; Kim, Y.Y. Dietary supplementation with full-fat Hermetia illucens larvae and multi-probiotics, as a substitute for antibiotics, improves the growth performance, gut health, and antioxidative capacity of weaned pigs. BMC Vet. Res. 2023, 19, 7. [Google Scholar] [CrossRef]
- Xiao, D.; Wang, Y.; Liu, G.; He, J.; Qiu, W.; Hu, X.; Feng, Z.; Ran, M.; Nyachoti, C.M.; Kim, S.W.; et al. Effects of chitosan on intestinal inflammation in weaned pigs challenged by enterotoxigenic Escherichia coli. PLoS ONE 2014, 9, e104192. [Google Scholar] [CrossRef]
- Lee, C.G.; Da Silva, C.A.; Lee, J.Y.; Hartl, D.; Elias, J. Chitin regulation of immune responses: An old molecule with new roles. Curr. Opin. Immunol. 2008, 20, 684–689. [Google Scholar] [CrossRef]
- Lei, S.; Cheng, T.; Guo, Y.; Li, C.; Zhang, W.; Zhi, F. Somatostatin Ameliorates Lipopolysaccharide-Induced Tight Junction Damage via the ERK-MAPK Pathway in Caco2 Cells. Eur. J. Cell Biol. 2014, 93, 299–307. [Google Scholar] [CrossRef] [PubMed]
- Yanan, Z.; Xuan, L.; Huizi, C.; Kaifan, Y.; Weiyun, Z. Effects of Sodium Propionate on the Tight Junction and Inflammatory Cytokines in IPEC-J2 Cells. Nanjing Nongye Daxue Xuebao 2019, 42, 137–144. [Google Scholar]
- Yu, H.; Wang, Y.; Zhang, J.; Wang, X.; Wang, R.; Bao, J.; Zhang, R. Effects of Dustbathing Environment on Gut Microbiota and Expression of Intestinal Barrier and Immune-Related Genes of Adult Laying Hens Housed Individually in Modified Traditional Cage. Poult. Sci. 2023, 102, 103097. [Google Scholar] [CrossRef] [PubMed]
- Varyukhina, S.; Freitas, M.; Bardin, S.; Robillard, E.; Tavan, E.; Sapin, C.; Grill, J.-P.; Trugnan, G. Glycan-Modifying Bacteria-Derived Soluble Factors from Bacteroides Thetaiotaomicron and Lactobacillus Casei Inhibit Rotavirus Infection in Human Intestinal Cells. Microbes Infect. 2012, 14, 273–278. [Google Scholar] [CrossRef] [PubMed]
- Yadv, S.; Jha, R. Strategies to modulate the intestinal microbiota and their effects on nutrient utilization, performance, and health of poultry. J. Anim. Sci. Biotechnol. 2019, 10, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Saracila, M.; Criste, R.; Panaite, T.; Vlaicu, P.; Tabuc, C.; Turcu, R.; Olteanu, M. Artemisia annua as phytogenic feed additive in the diet of broilers (14–35 days) reared under heat stress (32 °C). Poult. Sci. 2018, 20, 825–832. [Google Scholar] [CrossRef]
- Zhao, N.; Wang, S.; Li, H.; Liu, S.; Li, M.; Luo, J.; Su, W.; He, H. Influence of Novel Highly Pathogenic Avian Influenza A (H5N1) Virus Infection on Migrating Whooper Swans Fecal Microbiota. Front. Cell Infect. Microbiol. 2018, 8, 46. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Gao, X.; Liu, Z.; Zhang, L.; Fang, X.; Sun, J.; Zhang, Z.; Sun, Y. Sodium Alginate Prevents Non-Alcoholic Fatty Liver Disease by Modulating the Gut-Liver Axis in High-Fat Diet-Fed Rats. Nutrients 2022, 14, 4846. [Google Scholar] [CrossRef]
- Awad, W.A.; Dublecz, F.; Hess, C.; Dublecz, K.; Khayal, B.; Aschenbach, J.R.; Hess, M. Campylobacter Jejuni Colonization Promotes the Translocation of Escherichia Coli to Extra-Intestinal Organs and Disturbs the Short-Chain Fatty Acids Profiles in the Chicken Gut. Poult. Sci. 2016, 95, 2259–2265. [Google Scholar] [CrossRef]
- Jing, Y.; Mu, C.; Wang, H.; Shen, J.; Zoetendal, E.G.; Zhu, W. Amino Acid Utilization Allows Intestinal Dominance of Lactobacillus Amylovorus. ISME J. 2022, 16, 2491–2502. [Google Scholar] [CrossRef]
- Ahmed, Z.; Vohra, M.S.; Khan, M.N.; Ahmed, A.; Khan, T.A. Antimicrobial Role of Lactobacillus Species as Potential Probiotics against Enteropathogenic Bacteria in Chickens. J. Infect. Dev. Ctries. 2019, 13, 130–136. [Google Scholar] [CrossRef] [PubMed]
- Yu, M.; Li, Z.; Chen, W.; Wang, G.; Rong, T.; Liu, Z.; Wang, F.; Ma, X. Hermetia Illucens Larvae as a Fishmeal Replacement Alters Intestinal Specific Bacterial Populations and Immune Homeostasis in Weanling Piglets. J. Anim. Sci. 2020, 98, skz395. [Google Scholar] [CrossRef] [PubMed]
Items | Content (%) |
---|---|
Crude protein | 42.69 |
Ether extract | 27.80 |
Crude fiber | 5.00 |
Calcium | 4.72 |
Total phosphorus | 0.83 |
Isoleucine | 1.63 |
Leucine | 2.56 |
Histidine | 1.33 |
Lysine | 2.40 |
Items | Content (%, Unless Otherwise Indicated) | |||
---|---|---|---|---|
Control | 1% HILM | 2% HILM | 4% HILM | |
Ingredients | ||||
Corn | 65.40 | 65.40 | 65.40 | 65.40 |
Soybean meal | 28.00 | 28.00 | 28.00 | 28.00 |
Alfalfa meal | 3.00 | 3.00 | 3.00 | 3.00 |
HILM | 0.00 | 1.00 | 2.00 | 4.00 |
Limestone | 1.20 | 1.20 | 1.20 | 1.20 |
Ca(HCO3)2 | 0.80 | 0.80 | 0.80 | 0.80 |
NaCl | 0.33 | 0.33 | 0.33 | 0.33 |
Lysine | 0.19 | 0.19 | 0.19 | 0.19 |
Methionine | 0.08 | 0.08 | 0.08 | 0.08 |
Premix 1 | 1.00 | 1.00 | 1.00 | 1.00 |
Nutrient levels 2 | ||||
Metabolizable energy (kcal/kg) | 2811.00 | 2797.00 | 2800.00 | 2800.00 |
Crude protein | 18.12 | 18.03 | 18.01 | 18.00 |
Calcium | 0.80 | 0.81 | 0.80 | 0.80 |
Total phosphorus | 0.51 | 0.51 | 0.51 | 0.51 |
Available phosphorus | 0.31 | 0.31 | 0.30 | 0.30 |
Gene | Primer Sequence (5′→3′) | Product Size (bp) |
---|---|---|
ZO-1 | F: GACCATTCCAGACATTCTCCACAGC R: TCGCCTGCCACCTCTTCCATAG | 146 |
Occludin | F: ACAGCAGCAGCACTTACCTCAAC R: AGGCAGAGCAGGAGGACGATG | 109 |
Claudin-1 | F: GACCAGGTGAAGAAGATGCGGATG R: CGAGCCACTCTGTTGCCATACC | 107 |
IL-1β | F: GCACAAGGACTTCGCCGACAG R: GAAGGACTGGGAGCGGGTGTAG | 130 |
IL-2 | F: AACGGGATGCAAGATCTGTGAAGC R: ATGTGAGAAAGTTGGTCAGCTCTCG | 80 |
IL-6 | F: AAGCATCTGGCAACGACGATAAGG R: TGTGAGGAGGGATTTCTGGGTAGC | 90 |
IL-10 | F: TGCCAGTCGGTGTCGGAGATG R: CTGGTGGTGCTCGCTGTTCTTG | 81 |
TNF-α | F: CTGGCTAAGACCGTGGTCAGTTTC R: GGTGACGCTGAATGATCTGGTGAAG | 115 |
IFN-γ | F: GAAGTTCAAAGACCTCGTGGACCTG R: AACAGCTCACTCACAGCCTTGC | 81 |
CD4 | F: GCTGGTGTGTTGATGTTTGTCCTTG R: GCTGTCTTGCTCGTGCCATCC | 103 |
CD8a | F: ACGAGGCAGAGACGAGCAAGG R: CCAGGGCAATGAGAAGCAGGATG | 102 |
TGF-β | F: TTCCAACACCAGGTCCTACTCCAG R: GCAGACAGGTCCGGCAATAACAG | 86 |
β-actin | F: GCACCCAGCACGATGAAAAT R: GACAATGGAGGGTCCGGATT | 150 |
Items | Group | |||
---|---|---|---|---|
Control | 1% HILM | 2% HILM | 4% HILM | |
ADG, g/d | 42.65 ± 3.63 b | 48.13 ± 3.75 a | 45.95 ± 4.81 b | 44.71 ± 3.59 b |
ADFI, g/d | 95.94 ± 7.79 | 104.66 ± 8.94 | 103.55 ± 8.37 | 103.50 ± 7.74 |
FCR, (g:g) | 2.30 ± 0.05 | 2.15 ± 0.05 | 2.23 ± 0.07 | 2.30 ± 0.06 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, Y.; Hao, Y.; Gui, F.; Li, X.; Huang, H.; Yang, P.; Zhong, C.; Cao, L. Hermetia illucens Larvae Meal Enhances Immune Response by Improving Serum Immunoglobulin, Intestinal Barrier and Gut Microbiota of Sichuan White Geese After Avian Influenza Vaccination. Vet. Sci. 2024, 11, 615. https://doi.org/10.3390/vetsci11120615
Xie Y, Hao Y, Gui F, Li X, Huang H, Yang P, Zhong C, Cao L. Hermetia illucens Larvae Meal Enhances Immune Response by Improving Serum Immunoglobulin, Intestinal Barrier and Gut Microbiota of Sichuan White Geese After Avian Influenza Vaccination. Veterinary Sciences. 2024; 11(12):615. https://doi.org/10.3390/vetsci11120615
Chicago/Turabian StyleXie, Yufei, Yongfeng Hao, Fuxing Gui, Xifeng Li, Huan Huang, Pingrui Yang, Chonghua Zhong, and Liting Cao. 2024. "Hermetia illucens Larvae Meal Enhances Immune Response by Improving Serum Immunoglobulin, Intestinal Barrier and Gut Microbiota of Sichuan White Geese After Avian Influenza Vaccination" Veterinary Sciences 11, no. 12: 615. https://doi.org/10.3390/vetsci11120615
APA StyleXie, Y., Hao, Y., Gui, F., Li, X., Huang, H., Yang, P., Zhong, C., & Cao, L. (2024). Hermetia illucens Larvae Meal Enhances Immune Response by Improving Serum Immunoglobulin, Intestinal Barrier and Gut Microbiota of Sichuan White Geese After Avian Influenza Vaccination. Veterinary Sciences, 11(12), 615. https://doi.org/10.3390/vetsci11120615