Exploring Gene Expression and Alternative Splicing in Duck Embryonic Myoblasts via Full-Length Transcriptome Sequencing
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Culture of Cells, Along with Sample Collection
2.2. Construction and Sequencing of Full-Length cDNA Libraries
2.3. Quality Control for Sequencing Data
2.4. Sample Consistency Analysis
2.5. Alternative Splicing Analysis
2.6. Simple Sequence Repeat (SSR) Analysis
2.7. LncRNA Analysis
2.8. Differential Expression Analysis and Functional Annotation
2.9. Protein–Protein Interaction Network (PPI)
2.10. Real-Time Quantitative PCR(RT-qPCR) Validation
3. Results
3.1. Duck Primary Myoblast Differentiation
3.2. Summary of Full-Length Transcriptome Data
3.3. Functional Annotation of Novel Transcript
3.4. Alternative Splicing
3.5. SSR Analysis
3.6. LncRNA Identification
3.7. Functional Annotation and Enrichment Analysis of Differentially Expressed Genes
3.8. PPI Network Analysis and Central Gene Identification
3.9. RT-qPCR Validation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Khalid, T.; Hdaifeh, A.; Federighi, M.; Cummins, E.; Boué, G.; Guillou, S.; Tesson, V. Review of Quantitative Microbial Risk Assessment in Poultry Meat: The Central Position of Consumer Behavior. Foods 2020, 9, 1661. [Google Scholar] [CrossRef] [PubMed]
- Hitosugi, S.; Tsuda, K.; Okabayashi, H.; Tanabe, Y. Phylogenetic Relationships of Mitochondrial DNA Cytochrome b Gene in East Asian Ducks. J. Poult. Sci. 2007, 44, 141–145. [Google Scholar] [CrossRef]
- Payne, G.W.; Bearden, S.E. The Microcirculation of Skeletal Muscle in Aging. Microcirculation 2006, 13, 275–277. [Google Scholar] [CrossRef] [PubMed]
- Hu, Z.; Liu, X. Integration of Transcriptomics and Non-Targeted Metabolomics Reveals the Underlying Mechanism of Skeletal Muscle Development in Duck during Embryonic Stage. Int. J. Mol. Sci. 2023, 24, 5214. [Google Scholar] [CrossRef]
- Wigmore, P.M.; Stickland, N.C. Muscle Development in Large and Small Pig Fetuses. J. Anat. 1983, 137, 235–245. [Google Scholar]
- Zhang, X.; Li, Y.; Zhu, C.; Li, F.; Liu, Z.; Li, X.; Shen, X.; Wu, Z.; Fu, M.; Xu, D.; et al. DNA Demethylation of Myogenic Genes May Contribute to Embryonic Leg Muscle Development Differences between Wuzong and Shitou Geese. Int. J. Mol. Sci. 2023, 24, 7188. [Google Scholar] [CrossRef]
- Sun, L.; Bai, M.; Xiang, L.; Zhang, G.; Ma, W.; Jiang, H. Comparative Transcriptome Profiling of Longissimus Muscle Tissues from Qianhua Mutton Merino and Small Tail Han Sheep. Sci. Rep. 2016, 6, 33586. [Google Scholar] [CrossRef]
- Li, H.; Zhu, C.; Tao, Z.; Xu, W.; Song, W.; Hu, Y.; Zhu, W.; Song, C. MyoD and Myf6 Gene Expression Patterns in Skeletal Muscle during Embryonic and Posthatch Development in the Domestic Duck (Anas platyrhynchos Domestica). J. Anim. Breed. Genet. = Z. Fur Tierz. Und Zucht. 2014, 131, 194–201. [Google Scholar] [CrossRef]
- Zhang, W.; Liu, J.; Zhou, Y.; Liu, S.; Wu, J.; Jiang, H.; Xu, J.; Mao, H.; Liu, S.; Chen, B. Signaling Pathways and Regulatory Networks in Quail Skeletal Muscle Development: Insights from Whole Transcriptome Sequencing. Poult. Sci. 2024, 103, 103603. [Google Scholar] [CrossRef]
- Yang, Y.; Fan, X.; Yan, J.; Chen, M.; Zhu, M.; Tang, Y.; Liu, S.; Tang, Z. A Comprehensive Epigenome Atlas Reveals DNA Methylation Regulating Skeletal Muscle Development. Nucleic Acids Res. 2021, 49, 1313–1329. [Google Scholar] [CrossRef]
- Chen, J.; Li, Q. Emerging Role of HDAC11 in Skeletal Muscle Biology. Front. Cell Dev. Biol. 2024, 12, 1368171. [Google Scholar] [CrossRef] [PubMed]
- Deamer, D.; Akeson, M.; Branton, D. Three Decades of Nanopore Sequencing. Nat. Biotechnol. 2016, 34, 518–524. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Wu, J.; Li, M.; Zuo, F.; Zhang, G. A Comparative Full-Length Transcriptome Analysis Using Oxford Nanopore Technologies (ONT) in Four Tissues of Bovine Origin. Animals 2024, 14, 1646. [Google Scholar] [CrossRef] [PubMed]
- Jain, M.; Olsen, H.E.; Paten, B.; Akeson, M. The Oxford Nanopore MinION: Delivery of Nanopore Sequencing to the Genomics Community. Genome Biol. 2016, 17, 239. [Google Scholar] [CrossRef]
- Li, Y.; Fang, C.; Fu, Y.; Hu, A.; Li, C.; Zou, C.; Li, X.; Zhao, S.; Zhang, C.; Li, C. A Survey of Transcriptome Complexity in Sus Scrofa Using Single-Molecule Long-Read Sequencing. DNA Res. 2018, 25, 421–437. [Google Scholar] [CrossRef]
- Li, D.; Zhong, C.; Sun, Y.; Kang, L.; Jiang, Y. Identification of Genes Involved in Chicken Follicle Selection by ONT Sequencing on Granulosa Cells. Front. Genet. 2022, 13, 1090603. [Google Scholar] [CrossRef]
- Liu, H.; Li, L.; Chen, X.; Cao, W.; Zhang, R.; Yu, H.; Xu, F.; He, H.; Wang, J. Characterization of in Vitro Cultured Myoblasts Isolated from Duck (Anas platyrhynchos) Embryo. Cytotechnology 2011, 63, 399–406. [Google Scholar] [CrossRef]
- Liu, S.; Wu, J.; Zhang, W.; Jiang, H.; Zhou, Y.; Liu, J.; Mao, H.; Liu, S.; Chen, B. Whole-Transcriptome RNA Sequencing Uncovers the Global Expression Changes and RNA Regulatory Networks in Duck Embryonic Myogenesis. Int. J. Mol. Sci. 2023, 24, 16387. [Google Scholar] [CrossRef]
- Bowler, E.; Oltean, S. Alternative Splicing in Angiogenesis. Int. J. Mol. Sci. 2019, 20, 2067. [Google Scholar] [CrossRef]
- Trincado, J.L.; Entizne, J.C.; Hysenaj, G.; Singh, B.; Skalic, M.; Elliott, D.J.; Eyras, E. SUPPA2: Fast, Accurate, and Uncertainty-Aware Differential Splicing Analysis across Multiple Conditions. Genome Biol. 2018, 19, 40. [Google Scholar] [CrossRef]
- Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-Web: A Web Server for Microsatellite Prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Luo, H.; Bu, D.; Zhao, G.; Yu, K.; Zhang, C.; Liu, Y.; Chen, R.; Zhao, Y. Utilizing Sequence Intrinsic Composition to Classify Protein-Coding and Long Non-Coding Transcripts. Nucleic Acids Res. 2013, 41, e166. [Google Scholar] [CrossRef] [PubMed]
- Kang, Y.-J.; Yang, D.-C.; Kong, L.; Hou, M.; Meng, Y.-Q.; Wei, L.; Gao, G. CPC2: A Fast and Accurate Coding Potential Calculator Based on Sequence Intrinsic Features. Nucleic Acids Res. 2017, 45, W12–W16. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. clusterProfiler: An R Package for Comparing Biological Themes among Gene Clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Zhang, X.; Tang, B.; Li, J.; Ouyang, Q.; Hu, S.; Hu, J.; Liu, H.; Li, L.; He, H.; Wang, J. Comparative Transcriptome Analysis Reveals Mechanisms of Restriction Feeding on Lipid Metabolism in Ducks. Poult. Sci. 2023, 102, 102963. [Google Scholar] [CrossRef]
- Hu, Z.; Cao, J.; Zhang, J.; Ge, L.; Zhang, H.; Liu, X. Skeletal Muscle Transcriptome Analysis of Hanzhong Ma Duck at Different Growth Stages Using RNA-Seq. Biomolecules 2021, 11, 315. [Google Scholar] [CrossRef]
- Hoa, V.B.; Seong, P.-N.; Cho, S.-H.; Kang, S.-M.; Kim, Y.-S.; Moon, S.-S.; Choi, Y.-M.; Kim, J.-H.; Seol, K.-H. Quality Characteristics and Flavor Compounds of Pork Meat as a Function of Carcass Quality Grade. Asian Australas. J. Anim. Sci. 2019, 32, 1448–1457. [Google Scholar] [CrossRef]
- Cenik, B.K.; Liu, N.; Chen, B.; Bezprozvannaya, S.; Olson, E.N.; Bassel-Duby, R. Myocardin-Related Transcription Factors Are Required for Skeletal Muscle Development. Development 2016, 143, 2853–2861. [Google Scholar] [CrossRef]
- Kovanda, A.; Režen, T.; Rogelj, B. MicroRNA in Skeletal Muscle Development, Growth, Atrophy, and Disease. Wiley Interdiscip. Rev. RNA 2014, 5, 509–525. [Google Scholar] [CrossRef]
- Zheng, T.; Gan, M.L.; Shen, L.Y.; Niu, L.L.; Guo, Z.Y.; Wang, J.Y.; Zhang, S.H.; Zhu, L. circRNA on Animal Skeletal Muscle Development Regulation. Yi Chuan 2020, 42, 1178–1191. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Chen, W.; Liu, P.; Qian, S.; Tao, S.; Huang, M.; Xu, W.; Li, C.; Chen, X.; Lin, H.; et al. Role of lncRNA Has2os in Skeletal Muscle Differentiation and Regeneration. Cells 2022, 11, 3497. [Google Scholar] [CrossRef] [PubMed]
- Buonanno, A.; Fields, R.D. Gene Regulation by Patterned Electrical Activity during Neural and Skeletal Muscle Development. Curr. Opin. Neurobiol. 1999, 9, 110–120. [Google Scholar] [CrossRef]
- Chen, W.; Tangara, M.; Xu, J.; Peng, J. Developmental Transition of Pectoralis Muscle from Atrophy in Late-Term Duck Embryos to Hypertrophy in Neonates. Exp. Physiol. 2012, 97, 861–872. [Google Scholar] [CrossRef]
- Ran, J.; Li, J.; Yin, L.; Zhang, D.; Yu, C.; Du, H.; Jiang, X.; Yang, C.; Liu, Y. Comparative Analysis of Skeletal Muscle DNA Methylation and Transcriptome of the Chicken Embryo at Different Developmental Stages. Front. Physiol. 2021, 12, 697121. [Google Scholar] [CrossRef]
- Song, Q.; Li, J.; Li, S.; Cao, H.; Jin, X.; Zeng, Y.; Chen, W. Full-Length Transcriptome Analysis of Skeletal Muscle of Jiangquan Black Pig at Different Developmental Stages. Int. J. Mol. Sci. 2024, 25, 6095. [Google Scholar] [CrossRef]
- Yang, C.; Zhou, X.; Xue, Y.; Li, D.; Wang, L.; Zhong, T.; Dai, D.; Cao, J.; Guo, J.; Li, L.; et al. Transcriptome Analysis Reveals the Profile of Long Non-Coding RNAs during Myogenic Differentiation in Goats. Int. J. Mol. Sci. 2023, 24, 6370. [Google Scholar] [CrossRef]
- Ma, Y.; Zhao, T.; Wu, X.; Yang, Z.; Sun, Y. Identification Cloning and Functional Analysis of Novel Natural Antisense lncRNA CFL1-AS1 in Cattle. Epigenetics 2023, 18, 2231707. [Google Scholar] [CrossRef]
- Yao, Y.; Wang, Z.; Chen, Y.; Liu, L.; Wang, L.; Yi, G.; Yang, Y.; Wang, D.; Li, K.; Tang, Z. Single-Cell Analysis Reveals the lncRNA-MEG3/miRNA-133a-3p/PRRT2 Axis Regulates Skeletal Muscle Regeneration and Myogenesis. Genes. Dis. 2023, 10, 359–362. [Google Scholar] [CrossRef]
- Kang, X.; Zhao, Y.; Van Arsdell, G.; Nelson, S.F.; Touma, M. Ppp1r1b-lncRNA Inhibits PRC2 at Myogenic Regulatory Genes to Promote Cardiac and Skeletal Muscle Development in Mouse and Human. RNA 2020, 26, 481–491. [Google Scholar] [CrossRef]
- Lau, L.Y.; Nguyen, L.T.; Reverter, A.; Moore, S.S.; Lynn, A.; McBride-Kelly, L.; Phillips-Rose, L.; Plath, M.; Macfarlane, R.; Vasudivan, V.; et al. Gene Regulation Could Be Attributed to TCF3 and Other Key Transcription Factors in the Muscle of Pubertal Heifers. Vet. Med. Sci. 2020, 6, 695–710. [Google Scholar] [CrossRef] [PubMed]
- Marasco, L.E.; Kornblihtt, A.R. The Physiology of Alternative Splicing. Nat. Rev. Mol. Cell Biol. 2023, 24, 242–254. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Xu, Y.; Lin, Y. Transcriptome Analyses Reveal Genes of Alternative Splicing Associated with Muscle Development in Chickens. Gene 2018, 676, 146–155. [Google Scholar] [CrossRef]
- Chen, G.; Chen, J.; Qi, L.; Yin, Y.; Lin, Z.; Wen, H.; Zhang, S.; Xiao, C.; Bello, S.F.; Zhang, X.; et al. Bulk and Single-Cell Alternative Splicing Analyses Reveal Roles of TRA2B in Myogenic Differentiation. Cell Prolif. 2024, 57, e13545. [Google Scholar] [CrossRef]
- Neininger-Castro, A.C.; Hayes, J.B.; Sanchez, Z.C.; Taneja, N.; Fenix, A.M.; Moparthi, S.; Vassilopoulos, S.; Burnette, D.T. Independent Regulation of Z-Lines and M-Lines during Sarcomere Assembly in Cardiac Myocytes Revealed by the Automatic Image Analysis Software sarcApp. eLife 2023, 12, RP87065. [Google Scholar] [CrossRef]
- Lamber, E.P.; Guicheney, P.; Pinotsis, N. The Role of the M-Band Myomesin Proteins in Muscle Integrity and Cardiac Disease. J. Biomed. Sci. 2022, 29, 18. [Google Scholar] [CrossRef]
- Schöck, F.; González-Morales, N. The Insect Perspective on Z-Disc Structure and Biology. J. Cell Sci. 2022, 135, jcs260179. [Google Scholar] [CrossRef]
- Kizilaslan, M.; Arzik, Y.; White, S.N.; Piel, L.M.W.; Cinar, M.U. Genetic Parameters and Genomic Regions Underlying Growth and Linear Type Traits in Akkaraman Sheep. Genes 2022, 13, 1414. [Google Scholar] [CrossRef]
- Chen, B.; Yue, Y.; Li, J.; Liu, J.; Yuan, C.; Guo, T.; Zhang, D.; Yang, B.; Lu, Z. Transcriptome-Metabolome Analysis Reveals How Sires Affect Meat Quality in Hybrid Sheep Populations. Front. Nutr. 2022, 9, 967985. [Google Scholar] [CrossRef]
- Gu, S.; Huang, Q.; Sun, C.; Wen, C.; Yang, N. Transcriptomic and Epigenomic Insights into Pectoral Muscle Fiber Formation at the Late Embryonic Development in Pure Chicken Lines. Poult. Sci. 2024, 103, 103882. [Google Scholar] [CrossRef]
- Sheikh, F.; Lyon, R.C.; Chen, J. Functions of Myosin Light Chain-2 (MYL2) in Cardiac Muscle and Disease. Gene 2015, 569, 14–20. [Google Scholar] [CrossRef] [PubMed]
- Edmondson, D.G.; Lyons, G.E.; Martin, J.F.; Olson, E.N. Mef2 Gene Expression Marks the Cardiac and Skeletal Muscle Lineages during Mouse Embryogenesis. Development 1994, 120, 1251–1263. [Google Scholar] [CrossRef] [PubMed]
- Nabeshima, Y.; Hanaoka, K.; Hayasaka, M.; Esumi, E.; Li, S.; Nonaka, I.; Nabeshima, Y. Myogenin Gene Disruption Results in Perinatal Lethality Because of Severe Muscle Defect. Nature 1993, 364, 532–535. [Google Scholar] [CrossRef]
- Zhang, Y.; Sun, Z.W.; Iratni, R.; Erdjument-Bromage, H.; Tempst, P.; Hampsey, M.; Reinberg, D. SAP30, a Novel Protein Conserved between Human and Yeast, Is a Component of a Histone Deacetylase Complex. Mol. Cell 1998, 1, 1021–1031. [Google Scholar] [CrossRef]
- Li, F.; Yang, C.; Xie, Y.; Gao, X.; Zhang, Y.; Ning, H.; Liu, G.; Chen, Z.; Shan, A. Maternal Nutrition Altered Embryonic MYOD1, MYF5, and MYF6 Gene Expression in Genetically Fat and Lean Lines of Chickens. Anim. Biosci. 2022, 35, 1223–1234. [Google Scholar] [CrossRef]
- Jm, H.-H.; Eg, G.-G.; Ce, B.; Ma, R. The Myogenic Regulatory Factors, Determinants of Muscle Development, Cell Identity and Regeneration. Semin. Cell Dev. Biol. 2017, 72, 10–18. [Google Scholar] [CrossRef]
- Sjöblom, B.; Salmazo, A.; Djinović-Carugo, K. Alpha-Actinin Structure and Regulation. Cell. Mol. Life Sci. 2008, 65, 2688–2701. [Google Scholar] [CrossRef]
- Blondelle, J.; Tallapaka, K.; Seto, J.T.; Ghassemian, M.; Clark, M.; Laitila, J.M.; Bournazos, A.; Singer, J.D.; Lange, S. Cullin-3 Dependent Deregulation of ACTN1 Represents a New Pathogenic Mechanism in Nemaline Myopathy. JCI Insight 2019, 5, e125665. [Google Scholar] [CrossRef]
- Xie, S.; Liu, Q.; Fu, C.; Chen, Y.; Li, M.; Tian, C.; Li, J.; Han, M.; Li, C. Molecular Regulation of Porcine Skeletal Muscle Development: Insights from Research on CDC23 Expression and Function. Int. J. Mol. Sci. 2024, 25, 3664. [Google Scholar] [CrossRef]
- Chen, Z.; Li, X.-Y.; Guo, P.; Wang, D.-L. MYBPC2 and MYL1 as Significant Gene Markers for Rhabdomyosarcoma. Technol. Cancer Res. Treat. 2021, 20, 1533033820979669. [Google Scholar] [CrossRef]
- Burguière, A.C.; Nord, H.; von Hofsten, J. Alkali-like Myosin Light Chain-1 (Myl1) Is an Early Marker for Differentiating Fast Muscle Cells in Zebrafish. Dev. Dyn. 2011, 240, 1856–1863. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.; Wei, Y.; Kang, Z.; Zhang, W.; Wu, Y. Research Note: Transcriptome Analysis of Skeletal Muscles of Black-Boned Chickens, Including 2 Types (Wild and Mutated) of Taihe Black-Boned Silky Fowl and 1 Type (Wild) of Yugan Black-Boned Chicken. Poult. Sci. 2024, 103, 103240. [Google Scholar] [CrossRef]







| Gene ID | Gene Symbols in NCBI | Gene Description | Sequence (5′-3′) | Tm (°C) | Product Length (bp) |
|---|---|---|---|---|---|
| ENSAPLG00000024464 | JCHAIN | immunoglobulin J chain | F:CATACGCATCACGGTCC R:GCCATGCGGTAGACAAAA | 55.0 | 87 |
| ENSAPLG00000010425 | F9 | coagulation factor IX | F:CGGATCCATCGTCAACGAGA R:TGTTGTATTCACCTGCCACG | 59.0 | 92 |
| ENSAPLG00000002251 | LOC101800358 | extracellular fatty acid-binding protein-like | F:ACCAGAGGGGTGTAGGAGAC R:CTATCGCCTCCCTCTGAGAC | 59.0 | 84 |
| ENSAPLG00000016183 | CA13 | carbonic anhydrase 13 isoform X2 | F:AGTATGACCCCTCTCTCCGT R:CCCGGTCAGCACTGATTTG | 59.0 | 128 |
| ENSAPLG00000016444 | LOC101796443 | cystine/glutamate transporter isoform X1 | F:GAGACCCTGGAGAGGATGTTC R:TCTTGCCATGGGCCTTGAT | 59.0 | 103 |
| ENSAPLG00000016406 | LOC101792412 | hemoglobin subunit alpha-A | F:CTGCTGTCATGTTAATGTTCCCT R:CCTATGAAGAGCCATCGGGA | 59.0 | 103 |
| ENSAPLG00030031700 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | F: AAGGCTGAGAATGGGAAAC R: TTCAGGGACTTGTCATACTTC | 60.0 | 254 |
| Sample Name | Mean Length (bp) | N50 (bp) | Max Length (bp) |
|---|---|---|---|
| GM1 | 1353.03 | 1970 | 19,387 |
| GM2 | 1488.22 | 2113 | 21,494 |
| GM3 | 1437.33 | 2101 | 21,354 |
| DM1 | 1392.21 | 1933 | 20,896 |
| DM2 | 1421.12 | 1971 | 21,953 |
| DM3 | 1423.39 | 1978 | 21,434 |
| Average | 1419.22 | 2011 | 21,086 |
| Sample Name | Number of Clean Reads | Number of Full-Length Reads | Full-Length Percentage (FL%) | Mapped Reads | Mapped Rates Percent (%) |
|---|---|---|---|---|---|
| GM1 | 3,749,774 | 2,824,768 | 75.33 | 2,676,745 | 94.76 |
| GM2 | 3,489,276 | 2,898,884 | 83.08 | 2,502,554 | 95.7 |
| GM3 | 3,543,096 | 2,905,954 | 82.02 | 2,538,497 | 95.18 |
| DM1 | 3,725,557 | 2,885,824 | 77.46 | 2,748,907 | 95.26 |
| DM2 | 3,762,645 | 2,898,884 | 77.04 | 2,776,026 | 95.76 |
| DM3 | 3,725,133 | 2,905,954 | 78.01 | 2,782,866 | 95.76 |
| Item | Count | Percentage (%) |
|---|---|---|
| All | 5797 | 100.00 |
| Annotation | 1229 | 21.20 |
| KEGG | 997 | 17.20 |
| Pathway | 557 | 9.61 |
| Nr | 1197 | 20.65 |
| Uniprot | 1216 | 20.98 |
| GO | 591 | 10.19 |
| KOG | 25 | 0.43 |
| Pfam | 872 | 15.04 |
| Types of Alternative Splicing | Differential Variable Splicing Quantity | Significant Differential Variable Splicing Quantity |
|---|---|---|
| Alternative 3′ splice site (A3) | 70 | 8 |
| Alternative 5′ splice site (A5) | 83 | 6 |
| Alternative first exon (AF) | 576 | 57 |
| Alternative last exon (AL) | 353 | 36 |
| Mutually exclusive exon (MX) | 60 | 6 |
| Retained intron (RI) | 165 | 15 |
| Skipping exon (SE) | 939 | 75 |
| Item | Number |
|---|---|
| Total length of sequence examined (bp) | 85,085,181 |
| Total number of SSR | 28,677 |
| Total length of SSR (bp) | 46,317 |
| Relative abundance (SSR/Mb) | 337.04 |
| Relative density (bp/Mb) | 544.36 |
| Number of SSR containing sequences | 15,739 |
| Number of sequences containing more than 1 SSR | 6588 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, J.; Liu, S.; Jiang, D.; Zhou, Y.; Jiang, H.; Xiao, X.; Zha, B.; Fang, Y.; Huang, J.; Hu, X.; et al. Exploring Gene Expression and Alternative Splicing in Duck Embryonic Myoblasts via Full-Length Transcriptome Sequencing. Vet. Sci. 2024, 11, 601. https://doi.org/10.3390/vetsci11120601
Wu J, Liu S, Jiang D, Zhou Y, Jiang H, Xiao X, Zha B, Fang Y, Huang J, Hu X, et al. Exploring Gene Expression and Alternative Splicing in Duck Embryonic Myoblasts via Full-Length Transcriptome Sequencing. Veterinary Sciences. 2024; 11(12):601. https://doi.org/10.3390/vetsci11120601
Chicago/Turabian StyleWu, Jintao, Shuibing Liu, Dongcheng Jiang, Ya’nan Zhou, Hongxia Jiang, Xiaoyun Xiao, Boqian Zha, Yukai Fang, Jie Huang, Xiaolong Hu, and et al. 2024. "Exploring Gene Expression and Alternative Splicing in Duck Embryonic Myoblasts via Full-Length Transcriptome Sequencing" Veterinary Sciences 11, no. 12: 601. https://doi.org/10.3390/vetsci11120601
APA StyleWu, J., Liu, S., Jiang, D., Zhou, Y., Jiang, H., Xiao, X., Zha, B., Fang, Y., Huang, J., Hu, X., Mao, H., Liu, S., & Chen, B. (2024). Exploring Gene Expression and Alternative Splicing in Duck Embryonic Myoblasts via Full-Length Transcriptome Sequencing. Veterinary Sciences, 11(12), 601. https://doi.org/10.3390/vetsci11120601

