An Injectable, Osteoconductive Gelatin-Enabled GelMA/HAp Hydrogel Scaffold for Minimally Invasive Bone Tissue Engineering

Abstract

Despite extensive exploration of gelatin methacryloyl (GelMA)-based hydrogels for bone tissue engineering, their clinical translation is hindered by a critical trade-off: poor precursor stability leads to rapid sedimentation of bioactive fillers like hydroxyapatite (HAp), while formulations optimized for injectability often sacrifice mechanical integrity or handling precision. To overcome this challenge, we report a rheologically engineered, injectable composite hydrogel scaffold that integrates unmodified gelatin as a thermoresponsive viscosity modulator into a GelMA/HAp matrix. The incorporation of gelatin yields a stable, paste-like precursor at physiological temperature, which effectively prevents HAp sedimentation and enables precise, filamentous extrusion. Subsequent UV crosslinking locks the homogeneous structure in place, resulting in a mechanically robust scaffold with significantly enhanced compressive modulus. In vitro studies demonstrate that this biomimetic microenvironment not only supports high viability and proliferation of bone marrow stromal cells (BMSCs) but also potently enhances their osteogenic differentiation, as evidenced by upregulated alkaline phosphatase activity, Runx2 expression, and matrix mineralization. This simple, one-step strategy successfully reconciles injectability, structural fidelity, and bioactivity, offering a highly promising and clinically translatable platform for minimally invasive bone regeneration.

1. Introduction

Irregular bone defects often lead to prolonged wound exposure and delayed tissue regeneration, severely impairing patients’ quality of life [1,2,3,4]. Conventional bone repair materials face considerable challenges in treating geometrically complex defects. While patient-specific implants fabricated via three-dimensional (3D) printing offer anatomical adaptability, their post-solidification rigidity often hinders complete conformity to irregular defect contours [5,6,7]. Although emerging 4D-printed scaffolds allow for shape reconfiguration [8], the technology remains in its infancy, often requiring complex external stimuli. Injectable alternatives such as polymethyl methacrylate (PMMA) bone cement release substantial exothermic heat during polymerization, and their high modulus may induce mechanical stress on surrounding tissues. Although osteoconductive, calcium phosphate cements exhibit slow setting kinetics and poor structural integrity under physiological conditions, making them prone to fragmentation and inflammatory responses [9,10,11]. Therefore, developing bone repair materials that combine injectability, in situ curing capacity, biocompatibility, and suitable mechanical properties remains a pressing clinical need [12,13].

Inspired by the composition and hierarchical architecture of natural bone, biomimetic organic–inorganic composites have garnered significant interest in bone tissue engineering [14,15]. Native bone consists primarily of collagenous proteins (e.g., gelatin) and hydroxyapatite (HAp), the main inorganic component. However, gelatin-based materials undergo a sol–gel transition at physiological temperature (37 °C), resulting in poor shape retention and structural stability [16,17]. Chemical crosslinking using agents such as genipin or enzymes, along with post-processing treatments, is typically required to enhance their mechanical performance. Gelatin methacryloyl (GelMA), a photocrosslinkable hydrogel derivative, offers good biocompatibility, tunable biodegradability, and inherent cell-adhesive properties [18,19,20]. Nevertheless, its multi-step synthesis and tendency toward brittleness at high concentrations limit its standalone applicability [21,22,23]. Moreover, the incorporation of external components often complicates degradation profiles and raises long-term biocompatibility concerns. Thus, fabricating cost-effective, injectable, and bioactive bone-like hydrogels remains a substantial challenge [24,25,26].

To address these limitations, we designed an injectable, in situ-curable hydrogel composite for bone repair. The system integrates a gelatin-based polymer matrix with HAp nanoparticles. GelMA forms a covalent crosslinked network, providing structural integrity and enabling photopolymerization. Glycerol was introduced as a co-solvent to significantly improve the injectability and rheological properties of the precursor solution. The incorporation of HAp mimics the mineral phase of natural bone, enhancing the osteogenic bioactivity of the composite. Sodium citrate acts not only as a dispersant to promote homogeneous HAp distribution but also as a physical crosslinker through ionic interactions, thereby improving the mechanical coherence and structural stability of the hydrogel [27,28]. Together, this composite hydrogel demonstrates suitable mechanical performance and osteogenic potential, representing a promising strategy for repairing irregular bone defects.

2. Materials and Methods

2.1. Chemicals and Reagents

Gelatin methacryloyl (GelMA, degree of substitution ~90%) and gelatin (Bloom strength ~300) were purchased from Aladdin Reagent Co., Ltd. (Shanghai, China). Lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP, 98%), glycerol, and trisodium citrate were also obtained from Aladdin. Calcium nitrate, anhydrous diammonium hydrogen phosphate and ammonium hydroxide were supplied by Macklin Biochemical Co., Ltd. (Shanghai, China). All chemicals were used as received without further purification. Ultrapure water (18.2 MΩ·cm resistivity) was produced using a Millipore purification system.

2.2. Synthesis of HAp

A 10 mL aqueous solution of calcium nitrate (solution A, 0.15 mol/L) and a 10 mL aqueous solution of diammonium hydrogen phosphate (solution B, 0.09 mol/L) were prepared separately. Under continuous stirring at 300 rpm, solution B was slowly added dropwise into solution A. After complete addition, the pH of the mixture was adjusted to 11 using ammonium hydroxide. The reaction was allowed to proceed for 6 h at room temperature, followed by aging for 12 h. The resulting precipitate was collected by centrifugation, thoroughly washed with deionized water, and then freeze-dried to obtain HAp powder.

2.3. Preparation of Dual-Gel/HAp Hydrogels

Hydrogels were prepared by mixing polymeric components and HAp at a mass ratio of 1:1 (total polymer:HAp = 1:1). Specifically, GelMA (0.1 g), gelatin (0.1 g), HAp powder (0.2 g), trisodium citrate (10 wt% aqueous solution, 0.1 mL), and LAP photoinitiator (10 mg) were dissolved in 0.9 mL of glycerol/water (1:1) solution. Sodium citrate was explicitly incorporated into the precursor solution to serve as both a HAp dispersant and an auxiliary ionic crosslinker. The mixture was heated to 60 °C under gentle stirring to form a homogeneous precursor solution. The solution was then loaded into a syringe and injected into a mold. UV irradiation (365 nm, ~5 mW/cm²) was applied for 2 min to initiate crosslinking, yielding a bioactive hydrogel designated as Dual-Gel/HAp. A control hydrogel without HAp was prepared under identical conditions and named Dual-Gel. Additionally, a GelMA/HAp hydrogel (containing only GelMA and HAp, without gelatin) was fabricated as a comparative control group.

2.4. Characterization of Hydrogels

The morphology and surface elemental composition of the hydrogels were examined using scanning electron microscopy (Oberkochen, Germany, ZEISS GeminiSEM 360). Rheological properties were assessed with a HAAKE MARS 30 rheometer (Karlsruhe, Germany, Thermo Fisher Scientific). To evaluate shear-thinning and recovery behavior, a three-step rotational ramp test was performed at 37 °C: (i) shear rate held at 0.01 s⁻¹ for 120 s, (ii) increased to 100 s⁻¹ for 30 s to simulate rapid shear, and (iii) returned to 0.0 s⁻¹ for another 120 s. Dynamic frequency sweep measurements were conducted from 0.1 to 10 Hz at 37 °C with a fixed oscillatory strain of 1% and a sample thickness of 1 mm. Temperature sweep tests were carried out from 25 to 47 °C at a heating rate of 1 °C min⁻¹. The crystalline phase and microstructure of the materials were analyzed by X-ray diffraction (XRD, Tokyo, Japan, Rigaku D/Max-2550) over a 2θ range of 10–70°. Compressive mechanical properties of the hydrogels were determined using an electronic universal testing machine (Shenzhen, China, SANS CMT4000). Cylindrical samples (8 mm in diameter, 10 mm in height) were compressed at a crosshead speed of 10 mm min⁻¹. To evaluate the biodegradability of the hydrogels under enzymatic conditions, the initial wet weight of the samples was recorded as W₀. Subsequently, the hydrogels were immersed in a phosphate-buffered saline (PBS) solution containing 2 CDU mL⁻¹ of collagenase type I and incubated at 37 °C. Over a period of 7 days, the residual weight of the samples W_t was measured at 24 h intervals. The weight retention was then calculated from degradation ratio = (W₀ − W_t)/W₀ × 100%.

2.5. Cell Isolation and Culture of Rat BMSCs

BMSCs were isolated from Sprague-Dawley rats. Briefly, rats were purchased from Shanghai JSJ Laboratory Animal Co., Ltd. (Shanghai, China). After sacrifice, the femurs and tibias were aseptically harvested, and the attached soft tissues were carefully removed. The bone marrow cavity was flushed repeatedly using complete culture medium to collect bone marrow cells. The collected cell suspension was centrifuged and resuspended, then seeded into culture flasks and incubated at 37 °C in a humidified atmosphere containing 5% CO₂. Non-adherent cells were removed by replacing the culture medium after 24 h, and the medium was subsequently refreshed every 2–3 days. When the cells reached approximately 80–90% confluence, they were detached using trypsin-EDTA and passaged for further expansion. BMSCs at passages 2–4 were used for subsequent experiments. Prior to cell seeding, the fabricated hydrogel disks were sterilized by exposure to germicidal UV light (254 nm) for 30 min in a biosafety cabinet [29].

2.6. Live/Dead Staining Assay

Briefly, sterilized hydrogels were placed in 24-well plates, and BMSCs were directly seeded onto the surface of the hydrogels at a density of 1 × 10⁵ cells per well. The cells were incubated under standard culture conditions for the designated time points. After incubation, the samples were gently rinsed with phosphate-buffered saline (PBS) to remove non-adherent cells. The cells were then stained using a Live/Dead Viability Kit (Shanghai, China, Beyotime, C2015S) according to the manufacturer’s instructions. The staining solution was incubated with the samples for 30 min in the dark at room temperature. Subsequently, the stained samples were observed using a fluorescence microscope. Live cells exhibited green fluorescence, whereas dead cells showed red fluorescence.

2.7. Cell Counting Kit-8 (CCK-8) Assay

Sterilized hydrogels were placed in 24-well plates, and BMSCs were directly seeded onto the surface of the hydrogels at a density of 1 × 10⁵ cells per well. The cells were cultured under standard conditions, and the CCK-8 assay was performed at 1, 3, and 5 days. At each predetermined time point, the culture medium was replaced with fresh medium containing CCK-8 reagent (China, Beyotime, C0038), followed by incubation at 37 °C for an appropriate duration. Subsequently, the absorbance of the supernatant was measured at 450 nm using a microplate reader (Waltham, MA, USA, Thermo Fisher Scientific Multiskan FC).

2.8. ALP Staining and Activity Assay

For ALP staining, the samples were gently washed with PBS and fixed with 4% PFA (China, Beyotime, P0099). Subsequently, staining was performed according to the manufacturer’s instructions (China, Beyotime, C3206). After staining, the samples were washed with deionized water and observed under a light microscope. For quantitative analysis of ALP activity, the cells were lysed, and ALP activity was determined using a commercial ALP assay kit (China, Beyotime, P0321S) following the manufacturer’s protocol. The absorbance was measured using a microplate reader (Waltham, USA, Thermo Fisher Scientific Multiskan FC), and the ALP activity was normalized to the total protein content.

2.9. ARS Staining and Quantification

After osteogenic induction for the designated time period, the samples were washed with PBS and fixed with 4% PFA. The fixed samples were then stained with Alizarin Red S solution (China, Beyotime, C0138) at room temperature. After staining, excess dye was removed by thorough washing with deionized water, and calcium nodule formation was observed under a light microscope. For quantitative analysis, the bound ARS dye was eluted using an appropriate decalcification solution. The absorbance of the extracted solution was measured using a microplate reader to quantify mineral deposition.

2.10. Immunofluorescence Staining

Cell samples were gently washed with PBS and fixed with 4% PFA. The fixed samples were permeabilized and blocked, followed by incubation with a primary antibody against Runx2 (Shanghai, China, Proteintech, 20700-1-AP) and then with the corresponding fluorophore-conjugated secondary antibody (USA, Thermo Fisher Scientific, A-11011). Subsequently, the cytoskeleton was stained with FITC-conjugated phalloidin (China, Proteintech, PF00001) to visualize F-actin, and the nuclei were counterstained with DAPI (China, Beyotime, C1005). All stained samples were observed using a fluorescence microscope. For quantitative analysis, the number of Runx2-positive cells was quantified using Image J v1.8.0 software based on fluorescence images.

2.11. Quantitative Real-Time PCR (qPCR)

After culturing for the designated time period, total RNA was extracted from BMSCs using TRIzol reagent (USA, Thermo Fisher Scientific, 15596018CN). The concentration and purity of RNA were determined using a spectrophotometer (USA, Thermo Fisher Scientific, SPECTRONIC 200). cDNA was synthesized from total RNA using a reverse transcription kit (Monmouth Junction, NJ, USA, MedChemExpress HY-K0510A). qPCR was performed using SYBR Green Master Mix on a real-time PCR system (USA, Thermo Fisher Scientific, VeritiPro). The expression levels of osteogenic-related genes were analyzed. GAPDH was used as the internal reference gene. Relative gene expression levels were calculated using the 2^−ΔΔCt method. Sequences are listed at

Table A1. Primer sequences used for qPCR.

Primers		Sequences
OCN	Forward	TTATTGCCCTCCTGCTTG
	Reverse	TTATTGCCCTCCTGCTTG
COL-1	Forward	GAGGGCCAAGACGAAGACATC
	Reverse	CAGATCACGTCATCGCACAAC
Runx2	Forward	GTGTCACTGCGCTGAAGAGG
	Reverse	GACCAACCGAGTCATTTAAGGC
Asterix	Forward	TCCTCCTGCGACTGCCCTAA
	Reverse	TGCGAAGCCTTGCCATACA
GAPDH	Forward	ACAACTTTGGTATCGTGGAAGG
	Reverse	GCCATCACGCCACAGTTTC

.

2.12. Statistical Analysis

Statistical analysis was performed using GraphPad Prism (version 10.0, GraphPad Software, USA). All quantitative data are presented as mean ± standard deviation (SD). Each experiment was independently repeated at least three times. Statistical comparisons between two groups were conducted using Student’s t-test. For comparisons among multiple groups, one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test was applied. A value of p < 0.05 was considered statistically significant. Significant differences are indicated by asterisks (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001), while groups with no statistically significant difference (p > 0.05) are not marked with symbols to maintain figure clarity.

3. Results

3.1. Construction of a Dual-Gel/HAp Injectable Paste with Enhanced Thixotropy and Shape Retention

We first prepared a single-component GelMA precursor solution; however, its viscosity was excessively low (Figure 1a), making it difficult to maintain shape after injection into defect sites. Moreover, the incorporation of HAp resulted in poor dispersion, accompanied by pronounced fluctuations in the thixotropic curves [30]. To address these limitations, a Dual-Gel system was constructed by introducing gelatin into the formulation. The resulting precursor exhibited a viscosity exceeding 100 Pa·s under low shear, which rapidly decreased under high shear and promptly recovered upon restoration of low shear, demonstrating excellent thixotropic behavior and injectability. In contrast, conventional aqueous formulations without glycerol displayed markedly low viscosity at 37 °C (Figure 1b), whereas the addition of glycerol substantially enhanced the viscosity and handling performance of the system under physiological conditions. Subsequently, HAp was incorporated into the Dual-Gel precursor to form a composite paste, and the solid-to-liquid ratio was systematically optimized. At a ratio of 1:1 (w/v), the initial viscosity was excessively high, remaining above 100 Pa·s even under high shear, and failed to recover after shear reduction due to irreversible structural disruption. When the ratio was adjusted to 1:2, the composite exhibited favorable thixotropy, homogeneous HAp dispersion, and a stable, uniform precursor state. Further increasing the liquid content led to an overly dilute paste with compromised processability (Figure 1c). Vial inversion tests demonstrated that the Dual-Gel/HAp system underwent rapid gelation within 30 s (Figure 1d), providing a basis for in situ solidification. Injection demonstrations revealed that the single-component GelMA/HAp precursor could only be extruded intermittently in a droplet-like manner and was prone to leakage at defect sites, whereas the Dual-Gel/HAp paste enabled continuous, filamentous extrusion (Figure 1e). Furthermore, the paste was used to write the word “Bone” (Figure 1f) and after photo-crosslinking, the patterned letters could be lifted intact, convincingly confirming its excellent shape fidelity and three-dimensional formability.

3.2. Gelatin-Reinforced Dual-Gel/HAp Hydrogels Exhibit Enhanced Viscoelasticity and Mechanical Stability

Mechanical stability is one of the critical criteria for evaluating bone repair implant materials [31]. Dynamic frequency sweep rheological measurements were performed to characterize the viscoelastic behavior of the hydrogels. It is noted that the Dual-Gel network discussed herein is established within the standardized glycerol/water co-solvent system to maintain consistent rheological performance. As shown in Figure 2a, all hydrogels exhibited storage moduli (G′) consistently higher than their corresponding loss moduli (G″) over the tested frequency range, indicating the formation of stable, solid-like network structures. Notably, the incorporation of gelatin further enhanced the rheological stability of the system, which may be attributed to multiple non-covalent interactions—such as hydrogen bonding and electrostatic interactions—formed among gelatin chains, the GelMA polymer network, and HAp particles. These interactions not only reinforced network integrity but also synergistically improved the mechanical performance of the composite. Compressive stress–strain curves were used to compare the compressive behavior of GelMA/HAp and Dual-Gel/HAp hydrogels (Figure 2b). GelMA/HAp exhibited brittle fracture at high compressive strains, whereas Dual-Gel/HAp maintained structural integrity throughout the entire compression process without noticeable fragmentation. This superior deformation tolerance can be attributed to the non-covalently crosslinked network, which effectively dissipates mechanical energy under loading and thereby delays structural failure. Quantitative analysis of the compressive modulus further confirmed that the addition of gelatin significantly increased the stiffness of the hydrogel (Figure 2c), in agreement with the trends observed in the frequency sweep rheological results. To evaluate fatigue resistance, cyclic compression tests were conducted on Dual-Gel/HAp hydrogels at 50% strain for 15 consecutive cycles. As shown in Figure 2d, the hydrogel retained 82.4% of its initial maximum stress at the 15th cycle, with no obvious permanent deformation or structural collapse, demonstrating excellent resilience and structural recoverability. In addition, macroscopic demonstration experiments showed that cylindrical Dual-Gel/HAp hydrogels could stably support a 500 g weight without visible failure (Figure 2e), providing intuitive validation of their outstanding mechanical stability. Temperature sweep rheological tests further revealed that although G′ exhibited a slight decrease with increasing temperature from 25 to 47 °C, it remained substantially higher than G″ throughout the entire range, and no apparent sol–gel transition was observed (Figure 2f). These results indicate that the hydrogel possesses good thermal stability within physiologically relevant temperature ranges.

3.3. Microstructural and Compositional Characterization of Dual-Gel/HAp Hydrogels

Scanning electron microscopy (SEM) was employed to examine the microstructures of GelMA, Dual-Gel, GelMA/HAp, and Dual-Gel/HAp hydrogels (Figure 3a). Pure GelMA hydrogels exhibited a porous network with relatively large pore sizes, whereas Dual-Gel hydrogels displayed a denser and more compact morphology, which is favorable for improving mechanical toughness. Compared with GelMA/HAp, HAp particles were more uniformly distributed within the gel matrix of Dual-Gel/HAp, indicating the formation of a more integrated organic–inorganic composite system. Further energy-dispersive spectroscopy (EDS) elemental mapping (Figure 3b) confirmed a homogeneous distribution of Ca and P elements throughout the Dual-Gel/HAp hydrogel, demonstrating effective dispersion of HAp within the network formed through the synergistic interplay of covalent and non-covalent interactions. X-ray diffraction (XRD) patterns (Figure 3c) revealed distinct characteristic peaks corresponding to HAp in the Dual-Gel/HAp composite. The slight shifts in peak positions can be attributed to the involvement of sodium citrate in the HAp lattice and its interactions with the gelatin-based polymer network. The swelling and degradation behaviors of the hydrogels were evaluated as key indicators of their in vivo applicability. As shown in Figure 3d, owing to its more homogeneous composite structure, the Dual-Gel/HAp system exhibited a lower swelling ratio than GelMA/HAp, thereby better preserving structural integrity. In collagenase-containing environments, all hydrogels underwent gradual degradation (Figure 3e); however, Dual-Gel/HAp displayed a slower degradation rate, likely resulting from the stronger intermolecular interactions within the composite network. This characteristic is advantageous for providing prolonged mechanical support and maintaining structural stability during in vivo bone regeneration.

3.4. In Vitro Cytocompatibility of Injectable Hydrogels

To further evaluate the practical applicability of the injectable hydrogel, live/dead cell staining (Figure 4) was performed to assess cell growth on the hydrogel surfaces. Even in the absence of gelatin incorporation, the hydrogels were able to support cell adhesion and survival. Importantly, the introduction of gelatin did not increase cytotoxicity; instead, it promoted more rapid cell growth on the hydrogel surface. This enhanced proliferation can be attributed to the synergistic bioactivity of the Dual-Gel system. Unlike GelMA, where a portion of amino groups are substituted by methacryloyl groups, the unmodified gelatin component retains a higher density of native bioactive motifs, particularly the RGD (arginine-glycine-aspartic acid) sequences [18]. These motifs serve as critical binding sites for cell-surface integrins, thereby facilitating superior initial cell adhesion and spreading compared to pure GelMA networks, a phenomenon consistent with findings reported in previous studies [16]. Furthermore, comparison with the Dual-Gel control group (Figure S1) confirmed that the incorporation of HAp did not induce observable cellular stress. Cell proliferation on the hydrogels was quantitatively evaluated at different time points using the CCK-8 assay (Figure 5a). As compared with the ctrl group, no statistically significant differences were observed for either hydrogel formulation. Nevertheless, a pronounced proliferation trend was evident for cells cultured on both hydrogels over time, indicating good cytocompatibility and the absence of inhibitory effects on cell growth.

3.5. ALP and Alizarin Red S Analyses Reveal Superior Osteogenic Tendency of Dual-Gel/HAp Constructs

During the early phase of osteogenic differentiation, bone marrow mesenchymal stem cells (BMSCs) typically exhibit elevated alkaline phosphatase (ALP) activity, which later gives way to the deposition of mineralized calcium nodules. The expression of these two osteogenic markers was assessed in BMSCs cultured on different hydrogel formulations (Figure 5b). Compared to the GelMA/HAp group, the Dual-Gel/HAp group demonstrated a more pronounced tendency toward osteogenic differentiation. This enhancement can be attributed to the increased viscosity resulting from gelatin incorporation, which promoted a more uniform distribution of high-density HAp particles within the hydrogel matrix. Such spatial homogeneity of HAp is considered crucial for sustaining continuous osteogenic signaling and cellular differentiation. Quantitative ALP analysis (Figure 5c) revealed statistically significant differences in the osteoinductive capacity between the two hydrogel groups, while quantitative Alizarin Red S (ARS) staining (Figure 5d) indicated that the Dual-Gel/HAp hydrogel induced mineralization levels comparable to those of the control [32]. The improved osteogenic performance of the Dual-Gel/HAp hydrogel likely stems from the synergistic effects provided by gelatin: its addition increases precursor viscosity, facilitating homogeneous dispersion of HAp nanoparticles and preventing nonuniform aggregation; in addition, gelatin contains inherent bioactive peptide sequences that offer cell-adhesive motifs and signaling cues, which act in concert with the osteoconductive properties of HAp. Together, this spatially uniform and biochemically active microenvironment supports both early ALP upregulation and subsequent matrix mineralization. Moreover, the enhanced mechanical modulus of the composite may further promote osteogenic lineage commitment.

3.6. Dual-Gel/HAp Hydrogels Promote Osteogenic Differentiation

Immunofluorescence staining was subsequently performed to evaluate the expression of the osteogenic marker protein Runx2 (Figure 6a). Nuclear colocalization of Runx2 indicates its activated transcriptional state. As shown in the immunofluorescence images, the Dual-Gel/HAp group exhibited abundant Runx2 expression, whereas only a limited number of Runx2-positive signals were observed in the GelMA/HAp group. Quantitative analysis further confirmed a significantly higher proportion of Runx2-positive cells in the Dual-Gel/HAp group (Figure 6b).

To further verify the osteogenic differentiation-promoting capability of the hydrogels at the transcriptional level, quantitative real-time PCR (qPCR) was conducted to assess the expression of osteogenesis-related genes (Figure 7a–d), including osteocalcin (OCN), collagen type I (COL-1), Runx2, and Osterix. All evaluated genes exhibited similar expression trends, demonstrating that the injectable hydrogel significantly upregulated osteogenic gene expression. It should be noted that due to the temporal sequence of gene expression during osteogenic differentiation, the magnitude of upregulation was not uniformly positive at all time points. Collectively, these results indicate that the designed injectable hydrogel holds promising potential for preliminary application in bone repair therapies.

4. Discussion

The clinical application of GelMA-based hydrogels is often restricted by a critical trade-off between injectability and structural stability [2]. In this study, we addressed this challenge by engineering a Dual-Gel/HAp system. The incorporation of unmodified gelatin and glycerol transformed the precursor into a thixotropic paste, effectively preventing HAp sedimentation—a common failure mode in lower-viscosity bio-inks that leads to heterogeneous mineralization [27]. Unlike traditional formulations that extrude in droplets, the Dual-Gel/HAp paste enabled continuous, filamentous extrusion with high shape fidelity.

Mechanically, the Dual-Gel/HAp group significantly outperformed the GelMA/HAp control. This reinforcement is attributed to a synergistic crosslinking network: UV-initiated covalent bonds in GelMA provide basic structural stability, while gelatin and sodium citrate introduce extensive non-covalent interactions (hydrogen bonding and ionic bridging) that facilitate energy dissipation. This dual-network strategy explains the scaffold’s superior fatigue resistance and ability to maintain structural integrity under high compressive strains, addressing the brittleness typically associated with high-concentration GelMA. Biologically, the Dual-Gel/HAp scaffold provided a superior niche for BMSC osteogenesis [27]. The increased viscosity ensured a more uniform distribution of HAp nanoparticles, providing continuous osteoconductive signaling throughout the matrix.

However, several limitations must be acknowledged. This work represents a preliminary evaluation focusing on physicochemical characterization and in vitro BMSC responses. Although the results provide a solid foundation for minimally invasive bone regeneration, the lack of in vivo data limits the direct assessment of bone repair efficacy in a complex physiological environment. Furthermore, the interaction between the composite material and the host immune system, as well as the long-term degradation kinetics in vivo, remain to be clarified. Addressing these translational gaps using orthotopic animal models will be the primary focus of our future research.

5. Conclusions

In this work, an injectable and in situ-curable biomimetic hydrogel composite was successfully developed for bone repair by constructing a synergistically crosslinked Dual-Gel system composed of gelatin, GelMA, HAp, glycerol, and sodium citrate. The hydrogel exhibited excellent injectability, rapid gelation, and shape fidelity, enabling effective adaptation to irregular bone defects. The incorporation of gelatin and sodium citrate improved HAp dispersion and reinforced the organic–inorganic network, resulting in enhanced mechanical stability, fatigue resistance, and thermal robustness under physiologically relevant conditions. In vitro studies confirmed good cytocompatibility and demonstrated that the Dual-Gel/HAp hydrogel significantly promoted osteogenic differentiation of BMSCs, as evidenced by increased osteogenic marker expression and mineralization. Overall, this cost-effective and bioactive injectable hydrogel shows strong potential as a minimally invasive strategy for irregular bone defect repair and provides a promising platform for future translational applications in bone tissue engineering.