Effects of Exposure to Tobacco Cigarette, Electronic Cigarette and Heated Tobacco Product on Adipocyte Survival and Differentiation In Vitro
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Extract-Enriched Media
2.2. Analysis of Nicotine with Liquid Chromatography–Tandem Mass Spectrometry (LC–MS/MS)
2.3. 3T3-L1 Cell Culture
2.4. Cell viability Assay
2.5. Differentiation into Beige Adipocytes
2.6. Oil Red O Staining
2.7. RNA Isolation and Quantitative Real-Time PCR
2.8. Statistical Analysis
3. Results
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- United States, Public Health Service, Office of the Surgeon General. How Tobacco Smoke Causes Disease: The Biology and Behavioral Basis for Smoking-Attributable Disease: A Report of the Surgeon General; U.S. Dept. of Health and Human Services, Public Health Service, Office of the Surgeon General: Washington, DC, USA, 2010; ISBN 9780160840784. [Google Scholar]
- IARC Working Group on the Evaluation of Carcinogenic Risks to Humans; World Health Organization; International Agency for Research on Cancer. Tobacco Smoke and Involuntary Smoking; IARC Press: Liyon, France, 2004; ISBN 9789283212836. [Google Scholar]
- Pesch, B.; Kendzia, B.; Gustavsson, P.; Jöckel, K.-H.; Johnen, G.; Pohlabeln, H.; Olsson, A.; Ahrens, W.; Gross, I.M.; Brüske, I.; et al. Cigarette smoking and lung cancer-relative risk estimates for the major histological types from a pooled analysis of case-control studies. Int. J. Cancer 2012, 131, 1210–1219. [Google Scholar] [CrossRef] [PubMed]
- Bosetti, C.; Lucenteforte, E.; Silverman, D.T.; Petersen, G.; Bracci, P.M.; Ji, B.T.; Negri, E.; Li, D.; Risch, H.A.; Olson, S.H.; et al. Cigarette smoking and pancreatic cancer: An analysis from the International Pancreatic Cancer Case-Control Consortium (Panc4). Ann. Oncol. 2012, 23, 1880–1888. [Google Scholar] [CrossRef] [PubMed]
- Liang, P.S.; Chen, T.-Y.; Giovannucci, E. Cigarette smoking and colorectal cancer incidence and mortality: Systematic review and meta-analysis. Int. J. Cancer 2009, 124, 2406–2415. [Google Scholar] [CrossRef] [PubMed]
- Erhardt, L. Cigarette smoking: An undertreated risk factor for cardiovascular disease. Atherosclerosis 2009, 205, 23–32. [Google Scholar] [CrossRef] [PubMed]
- Csordas, A.; Bernhard, D. The biology behind the atherothrombotic effects of cigarette smoke. Nat. Rev. Cardiol. 2013, 10, 219–230. [Google Scholar] [CrossRef] [PubMed]
- Eliasson, B. Cigarette smoking and diabetes. Prog. Cardiovasc. Dis. 2003, 45, 405–413. [Google Scholar] [CrossRef]
- Raherison, C.; Girodet, P.O. Epidemiology of COPD. Eur. Respir. Rev. 2009, 18, 213–221. [Google Scholar] [CrossRef]
- An, Z.; Wang, H.; Song, P.; Zhang, M.; Geng, X.; Zou, M.-H. Nicotine-induced Activation of AMP-activated Protein Kinase Inhibits Fatty Acid Synthase in 3T3L1 Adipocytes. J. Biol. Chem. 2007, 282, 26793–26801. [Google Scholar] [CrossRef] [Green Version]
- Wu, Y.; Song, P.; Zhang, W.; Liu, J.; Dai, X.; Liu, Z.; Lu, Q.; Ouyang, C.; Xie, Z.; Zhao, Z.; et al. Activation of AMPKα2 in adipocytes is essential for nicotine-induced insulin resistance in vivo. Nat. Med. 2015, 21, 373–382. [Google Scholar] [CrossRef] [Green Version]
- Chiolero, A.; Faeh, D.; Paccaud, F.; Cornuz, J. Consequences of smoking for body weight, body fat distribution, and insulin resistance. Am. J. Clin. Nutr. 2008, 87, 801–809. [Google Scholar] [CrossRef] [Green Version]
- Cancelada, L.; Sleiman, M.; Tang, X.; Russell, M.L.; Nahuel Montesinos, V.; Litter, M.I.; Gundel, L.A.; Destaillats, H. Heated tobacco products: Volatile emissions and their predicted impact on indoor air quality. Environ. Sci. Technol. 2019, 53, 7866–7876. [Google Scholar] [CrossRef] [PubMed]
- Goniewicz, M.L.; Knysak, J.; Gawron, M.; Kosmider, L.; Sobczak, A.; Kurek, J.; Prokopowicz, A.; Jablonska-Czapla, M.; Rosik-Dulewska, C.; Havel, C.; et al. Levels of selected carcinogens and toxicants in vapour from electronic cigarettes. Tob. Control 2014, 23, 133–139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- El Mubarak, M.A.; Danika, C.; Vlachos, N.S.; Farsalinos, K.; Poulas, K.; Sivolapenko, G. Development and validation of analytical methodology for the quantification of aldehydes in e-cigarette aerosols using UHPLC-UV. Food Chem. Toxicol. 2018, 116, 147–151. [Google Scholar] [CrossRef] [PubMed]
- Konstantinou, E.; Fotopoulou, F.; Drosos, A.; Dimakopoulou, N.; Zagoriti, Z.; Niarchos, A.; Makrynioti, D.; Kouretas, D.; Lagoumintzis, G.; Poulas, K. Tobacco-specific nitrosamines: A literature review. Food Chem. Toxicol. 2018, 118, 198–203. [Google Scholar] [CrossRef]
- Farsalinos, K.E.; Yannovits, N.; Sarri, T.; Voudris, V.; Poulas, K.; Leischow, S.J. Carbonyl emissions from a novel heated tobacco product (IQOS): Comparison with an e-cigarette and a tobacco cigarette. Addiction 2018, 113, 2099–2106. [Google Scholar] [CrossRef] [PubMed]
- Mallock, N.; Böss, L.; Burk, R.; Danziger, M.; Welsch, T.; Hahn, H.; Trieu, H.-L.; Hahn, J.; Pieper, E.; Henkler-Stephani, F.; et al. Levels of selected analytes in the emissions of “heat not burn” tobacco products that are relevant to assess human health risks. Arch. Toxicol. 2018, 92, 2145–2149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leigh, N.J.; Palumbo, M.N.; Marino, A.M.; O’Connor, R.J.; Goniewicz, M.L. Tobacco-specific nitrosamines (TSNA) in heated tobacco product IQOS. Tob. Control 2018, 27, s37–s38. [Google Scholar] [CrossRef] [Green Version]
- Bekki, K.; Inaba, Y.; Uchiyama, S.; Kunugita, N. Comparison of Chemicals in Mainstream Smoke in Heat-not-burn Tobacco and Combustion Cigarettes. J. UOEH 2017, 39, 201–207. [Google Scholar] [CrossRef] [Green Version]
- Farsalinos, K.E.; Yannovits, N.; Sarri, T.; Voudris, V.; Poulas, K. Nicotine Delivery to the Aerosol of a Heat-Not-Burn Tobacco Product: Comparison With a Tobacco Cigarette and E-Cigarettes. Nicotine Tob. Res. 2018, 20, 1004–1009. [Google Scholar] [CrossRef]
- Protano, C.; Manigrasso, M.; Avino, P.; Vitali, M. Second-hand smoke generated by combustion and electronic smoking devices used in real scenarios: Ultrafine particle pollution and age-related dose assessment. Environ. Int. 2017, 107, 190–195. [Google Scholar] [CrossRef] [Green Version]
- Hiemstra, P.S.; Bals, R. Basic science of electronic cigarettes: Assessment in cell culture and in vivo models. Respir. Res. 2016, 17, 127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andrikopoulos, G.I.; Zagoriti, Z.; Topouzis, S.; Poulas, K. Oxidative stress induced by electronic nicotine delivery systems (ENDS): Focus on respiratory system. Curr. Opin. Toxicol. 2019, 13, 81–89. [Google Scholar] [CrossRef]
- Wu, J.; Boström, P.; Sparks, L.M.; Ye, L.; Choi, J.H.; Giang, A.H.; Khandekar, M.; Virtanen, K.A.; Nuutila, P.; Schaart, G.; et al. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 2012, 150, 366–376. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Petrovic, N.; Walden, T.B.; Shabalina, I.G.; Timmons, J.A.; Cannon, B.; Nedergaard, J. Chronic peroxisome proliferator-activated receptor gamma (PPARgamma) activation of epididymally derived white adipocyte cultures reveals a population of thermogenically competent, UCP1-containing adipocytes molecularly distinct from classic brown adipocytes. J. Biol. Chem. 2010, 285, 7153–7164. [Google Scholar]
- Vitali, A.; Murano, I.; Zingaretti, M.C.; Frontini, A.; Ricquier, D.; Cinti, S. The adipose organ of obesity-prone C57BL/6J mice is composed of mixed white and brown adipocytes. J. Lipid Res. 2012, 53, 619–629. [Google Scholar] [CrossRef] [Green Version]
- Lshibashi, J.; Seale, P. Beige can be slimming. Science 2010, 328, 1113–1114. [Google Scholar] [CrossRef]
- Ricquier, D. Uncoupling protein 1 of brown adipocytes, the only uncoupler: A historical perspective. Front. Endocrinol. 2011, 2, 85. [Google Scholar] [CrossRef] [Green Version]
- Villarroya, F.; Peyrou, M.; Giralt, M. Transcriptional regulation of the uncoupling protein-1 gene. Biochimie 2017, 134, 86–92. [Google Scholar] [CrossRef]
- Riss, T.L.; Moravec, R.A.; Niles, A.L.; Duellman, S.; Benink, H.A.; Worzella, T.J.; Minor, L. Cell Viability Assays; U.S. National Library of Medicine: Bethesda, MD, USA, 2004. [Google Scholar]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Green Version]
- Andersson, K.; Arner, P. Systemic nicotine stimulates human adipose tissue lipolysis through local cholinergic and catecholaminergic receptors. Int. J. Obes. 2001, 25, 1225–1232. [Google Scholar] [CrossRef] [Green Version]
- Liu, R.-H.; Mizuta, M.; Matsukura, S. The expression and functional role of nicotinic acetylcholine receptors in rat adipocytes. J. Pharmacol. Exp. Ther. 2004, 310, 52–58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cancello, R.; Zulian, A.; Maestrini, S.; Mencarelli, M.; Della Barba, A.; Invitti, C.; Liuzzi, A.; Di Blasio, A.M. The nicotinic acetylcholine receptor α7 in subcutaneous mature adipocytes: Downregulation in human obesity and modulation by diet-induced weight loss. Int. J. Obes. 2012, 36, 1552–1557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Santos-Silva, A.P.; Oliveira, E.; Pinheiro, C.R.; Nunes-Freitas, A.L.; Abreu-Villaça, Y.; Santana, A.C.; Nascimento-Saba, C.C.; Nogueira-Neto, J.F.; Reis, A.M.; Moura, E.G.; et al. Effects of tobacco smoke exposure during lactation on nutritional and hormonal profiles in mothers and offspring. J. Endocrinol. 2011, 209, 75–84. [Google Scholar] [CrossRef] [PubMed]
- Somm, E.; Schwitzgebel, V.M.; Vauthay, D.M.; Camm, E.J.; Chen, C.Y.; Giacobino, J.-P.; Sizonenko, S.V.; Aubert, M.L.; Hüppi, P.S. Prenatal nicotine exposure alters early pancreatic islet and adipose tissue development with consequences on the control of body weight and glucose metabolism later in life. Endocrinology 2008, 149, 6289–6299. [Google Scholar] [CrossRef] [Green Version]
- Peixoto, T.C.; Moura, E.G.; Oliveira, E.; Younes-Rapozo, V.; Soares, P.N.; Rodrigues, V.S.T.; Santos, T.R.; Peixoto-Silva, N.; Carvalho, J.C.; Calvino, C.; et al. Neonatal tobacco smoke reduces thermogenesis capacity in brown adipose tissue in adult rats. Braz. J. Med. Biol. Res. 2018, 51. [Google Scholar] [CrossRef]
- Chen, H.-J.; Xiang, J.; Zhang, W.-X.; Sun, A.; Li, G.-L.; Yan, Y. Nicotine induces a dual effect on the beige-like phenotype in adipocytes. Arch. Biol. Sci. 2019, 71, 533–540. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.; Lee, Y.J.; Choi, H.; Ko, E.H.; Kim, J.-W. Reactive oxygen species facilitate adipocyte differentiation by accelerating mitotic clonal expansion. J. Biol. Chem. 2009, 284, 10601–10609. [Google Scholar] [CrossRef] [Green Version]
- Hanssen, M.J.W.; Hoeks, J.; Brans, B.; van der Lans, A.A.J.J.; Schaart, G.; van den Driessche, J.J.; Jörgensen, J.A.; Boekschoten, M.V.; Hesselink, M.K.C.; Havekes, B.; et al. Short-term cold acclimation improves insulin sensitivity in patients with type 2 diabetes mellitus. Nat. Med. 2015, 21, 863–865. [Google Scholar] [CrossRef]
- Lee, P.; Smith, S.; Linderman, J.; Courville, A.B.; Brychta, R.J.; Dieckmann, W.; Werner, C.D.; Chen, K.Y.; Celi, F.S. Temperature-acclimated brown adipose tissue modulates insulin sensitivity in humans. Diabetes 2014, 63, 3686–3698. [Google Scholar] [CrossRef] [Green Version]
- Chondronikola, M.; Volpi, E.; Børsheim, E.; Porter, C.; Annamalai, P.; Enerbäck, S.; Lidell, M.E.; Saraf, M.K.; Labbe, S.M.; Hurren, N.M.; et al. Brown adipose tissue improves whole-body glucose homeostasis and insulin sensitivity in humans. Diabetes 2014, 63, 4089–4099. [Google Scholar] [CrossRef] [Green Version]
- Bartelt, A.; Bruns, O.T.; Reimer, R.; Hohenberg, H.; Ittrich, H.; Peldschus, K.; Kaul, M.G.; Tromsdorf, U.I.; Weller, H.; Waurisch, C.; et al. Brown adipose tissue activity controls triglyceride clearance. Nat. Med. 2011, 17, 200–206. [Google Scholar] [CrossRef] [PubMed]
- Aldiss, P.; Davies, G.; Woods, R.; Budge, H.; Sacks, H.S.; Symonds, M.E. ‘Browning’ the cardiac and peri-vascular adipose tissues to modulate cardiovascular risk. Int. J. Cardiol. 2017, 228, 265–274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oliver, P.; Picó, C.; Serra, F.; Palou, A. Resistin expression in different adipose tissue depots during rat development. Mol. Cell. Biochem. 2003, 252, 397–400. [Google Scholar] [CrossRef] [PubMed]
- Shaito, A.; Saliba, J.; Husari, A.; El-Harakeh, M.; Chhouri, H.; Hashem, Y.; Shihadeh, A.; El-Sabban, M. Electronic Cigarette Smoke Impairs Normal Mesenchymal Stem Cell Differentiation. Sci. Rep. 2017, 7, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Cyprus, G.N.; Overlin, J.W.; Hotchkiss, K.M.; Kandalam, S.; Olivares-Navarrete, R. Cigarette smoke increases pro-inflammatory markers and inhibits osteogenic differentiation in experimental exposure model. Acta Biomater. 2018, 76, 308–318. [Google Scholar] [CrossRef] [PubMed]
- Sun, K.; Liu, J.; Ning, G. Active Smoking and Risk of Metabolic Syndrome: A Meta-Analysis of Prospective Studies. PLoS ONE 2012, 7, e47791. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weitzman, M.; Cook, S.; Auinger, P.; Florin, T.A.; Daniels, S.; Nguyen, M.; Winickoff, J.P. Tobacco smoke exposure is associated with the metabolic syndrome in adolescents. Circulation 2005, 112, 862–869. [Google Scholar] [CrossRef] [Green Version]
- Stevens, D.R.; Malek, A.M.; Laggis, C.; Hunt, K.J. In utero exposure to tobacco smoke, subsequent cardiometabolic risks, and metabolic syndrome among U.S. adolescents. Ann. Epidemiol. 2018, 28, 619–624. [Google Scholar] [CrossRef]
- Omaiye, E.E.; McWhirter, K.J.; Luo, W.; Pankow, J.F.; Talbot, P. High-Nicotine Electronic Cigarette Products: Toxicity of JUUL Fluids and Aerosols Correlates Strongly with Nicotine and Some Flavor Chemical Concentrations. Chem. Res. Toxicol. 2019, 32, 1058–1069. [Google Scholar] [CrossRef] [Green Version]
- Romagna, G.; Allifranchini, E.; Bocchietto, E.; Todeschi, S.; Esposito, M.; Farsalinos, K.E. Cytotoxicity evaluation of electronic cigarette vapor extract on cultured mammalian fibroblasts (ClearStream-LIFE): Comparison with tobacco cigarette smoke extract. Inhal. Toxicol. 2013, 25, 354–361. [Google Scholar] [CrossRef]
- Farsalinos, K.E.; Romagna, G.; Allifranchini, E.; Ripamonti, E.; Bocchietto, E.; Todeschi, S.; Tsiapras, D.; Kyrzopoulos, S.; Voudris, V. Comparison of the cytotoxic potential of cigarette smoke and electronic cigarette vapour extract on cultured myocardial cells. Int. J. Environ. Res. Public Health 2013, 10, 5146–5162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eddingsaas, N.; Pagano, T.; Cummings, C.; Rahman, I.; Robinson, R.; Hensel, E. Qualitative analysis of e-liquid emissions as a function of flavor additives using two aerosol capture methods. Int. J. Environ. Res. Public Health 2018, 15, 323. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marian, C.; O’Connor, R.J.; Djordjevic, M.V.; Rees, V.W.; Hatsukami, D.K.; Shields, P.G. Reconciling human smoking behavior and machine smoking patterns: Implications for understanding smoking behavior and the impact on laboratory studies. Cancer Epidemiol. Biomark. Prev. 2009, 18, 3305–3320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Farsalinos, K.E.; Gillman, G. Carbonyl Emissions in E-cigarette Aerosol: A Systematic Review and Methodological Considerations. Front. Physiol. 2018, 8, 1119. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Ojeda, F.J.; Rupérez, A.I.; Gomez-Llorente, C.; Gil, A.; Aguilera, C.M. Cell models and their application for studying adipogenic differentiation in relation to obesity: A review. Int. J. Mol. Sci. 2016, 17, 1040. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gupta, R.K.; Arany, Z.; Seale, P.; Mepani, R.J.; Ye, L.; Conroe, H.M.; Roby, Y.A.; Kulaga, H.; Reed, R.R.; Spiegelman, B.M. Transcriptional control of preadipocyte determination by Zfp423. Nature 2010, 464, 619–623. [Google Scholar] [CrossRef] [Green Version]
- Public Health Consequences of E-Cigarettes; National Academies Press: Washington, DC, USA, 2018.
- Mcneill, A.; Brose, L.S.; Calder, R.; Bauld, L.; Robson, D. Evidence Review of E-Cigarettes and Heated Tobacco Products 2018 A Report Commissioned by Public Health England; Public Health England: London, UK, 2018. [Google Scholar]
- Leigh, N.J.; Tran, P.L.; O’Connor, R.J.; Goniewicz, M.L. Cytotoxic effects of heated tobacco products (HTP) on human bronchial epithelial cells. Tob. Control 2018, 27, s26–s29. [Google Scholar] [CrossRef] [Green Version]
- Chung, S.; Baumlin, N.; Dennis, J.S.; Moore, R.; Salathe, S.F.; Whitney, P.L.; Sabater, J.; Abraham, W.M.; Kim, M.D.; Salathe, M. Electronic cigarette vapor with nicotine causes airway mucociliary dysfunction preferentially via TRPA1 receptors. Am. J. Respir. Crit. Care Med. 2019, 200, 1134–1145. [Google Scholar] [CrossRef] [Green Version]
- George, J.; Hussain, M.; Vadiveloo, T.; Ireland, S.; Hopkinson, P.; Struthers, A.D.; Donnan, P.T.; Khan, F.; Lang, C.C. Cardiovascular Effects of Switching From Tobacco Cigarettes to Electronic Cigarettes. J. Am. Coll. Cardiol. 2019, 74, 3112–3120. [Google Scholar] [CrossRef]
- Polosa, R.; Morjaria, J.B.; Caponnetto, P.; Caruso, M.; Campagna, D.; Amaradio, M.D.; Ciampi, G.; Russo, C.; Fisichella, A. Persisting long term benefits of smoking abstinence and reduction in asthmatic smokers who have switched to electronic cigarettes. Discov. Med. 2016, 21, 99–108. [Google Scholar]
- Wang, Z.; Wang, D.; Wang, Y. Cigarette Smoking and Adipose Tissue: The Emerging Role in Progression of Atherosclerosis. Mediat. Inflamm. 2017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Primer Sequence (5’→3’) |
---|---|
Rps18 | F: GCCATGTCTCTAGTGATCCC |
R: GAGGTCGATGTCTGCTTTCC | |
Ucp1 | F: ACTGCCACACCTCCAGTCATT |
R: CTTTGCCTCACTCAGGATTGG | |
Pgc-1α> | F: AGCCGTGACCACTGACAACGAG |
R: GCTGCATGGTTCTGAGTGCTAAG | |
Pparg | F: GATGCACTGCCTATGAGCACTT |
R: AGAGGTCCACAGAGCTGATTCC | |
Resistin | F: AAACAAGACTTCAACTCCCTG |
R: TTTCTTCACGAATGTCCCACG |
Type of Extract | Nicotine Concentration (μg/mL) |
---|---|
CS extract | 87.35 ± 3.65 |
HTP extract | 92.73 ± 3.08 |
ΕCIG extract | 51.50 ± 1.29 |
Ambient air extract | 1.04 ± 0.08 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zagoriti, Z.; El Mubarak, M.A.; Farsalinos, K.; Topouzis, S. Effects of Exposure to Tobacco Cigarette, Electronic Cigarette and Heated Tobacco Product on Adipocyte Survival and Differentiation In Vitro. Toxics 2020, 8, 9. https://doi.org/10.3390/toxics8010009
Zagoriti Z, El Mubarak MA, Farsalinos K, Topouzis S. Effects of Exposure to Tobacco Cigarette, Electronic Cigarette and Heated Tobacco Product on Adipocyte Survival and Differentiation In Vitro. Toxics. 2020; 8(1):9. https://doi.org/10.3390/toxics8010009
Chicago/Turabian StyleZagoriti, Zoi, Mohamed A. El Mubarak, Konstantinos Farsalinos, and Stavros Topouzis. 2020. "Effects of Exposure to Tobacco Cigarette, Electronic Cigarette and Heated Tobacco Product on Adipocyte Survival and Differentiation In Vitro" Toxics 8, no. 1: 9. https://doi.org/10.3390/toxics8010009
APA StyleZagoriti, Z., El Mubarak, M. A., Farsalinos, K., & Topouzis, S. (2020). Effects of Exposure to Tobacco Cigarette, Electronic Cigarette and Heated Tobacco Product on Adipocyte Survival and Differentiation In Vitro. Toxics, 8(1), 9. https://doi.org/10.3390/toxics8010009