Toxicity Evaluation and Transcriptome Analysis of Yellowstripe Goby (Mugilogobius chulae) in Response to 2,7-Dibromocarbazole Exposure during Early Development
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Acute Embryotoxicity of 2,7-DBCZ
2.3. Cultivation and Sampling of M. chulae Embryos
2.4. Developmental Toxicity of M. chulae Embryos
2.5. Sample Preparation for Transcriptome Sequencing
2.6. RNA Extraction, Library Preparation, and Sequencing
2.7. Differential Expression Analysis and Functional Enrichment
2.8. Protein-Protein Interaction Networks Analysis
2.9. Quantitative Real-Time PCR (qPCR) Validation
2.10. Statistical Analyses
3. Results
3.1. Acute Embryo Toxicity of 2,7-DBCZ
3.2. Overview of Transcriptional Analysis
3.3. GO Functional Analysis of DEGs
3.4. KEGG Pathway Analysis of DEGs
3.5. PPI Analysis
3.6. qPCR Verification of Transcriptional Analyses
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- De Lin, K.; Chen, Y.Q.; Yuan, D.X. Environmental behaviors and ecotoxicology of the emerging contaminants polyhalogenated carbazoles. Huanjing Kexue/Environ. Sci. 2016, 37, 1576–1583. [Google Scholar]
- Pereira, W.E.; Rostad, C.E.; Taylor, H.E. Mount St. Helens, Washington, 1980 volcanic eruption: Characterization of organic compounds in ash samples. Geophys. Res. Lett. 1980, 7, 11. [Google Scholar] [CrossRef] [Scilit]
- Parette, R.; McCrindle, R.; McMahon, K.S.; Pena-Abaurrea, M.; Reiner, E.; Chittim, B.; Riddell, N.; Voss, G.; Dorman, F.L.; Pearson, W.N. Halogenated indigo dyes: A likely source of 1,3,6,8-tetrabromocarbazole and some other halogenated carbazoles in the environment. Chemosphere 2015, 127, 18–26. [Google Scholar] [CrossRef] [Scilit]
- Morin, J.F.; Leclere, M.; Adès, D.; Siove, A. Polycarbazoles: 25 years of progress. Macromol. Rapid Commun. 2005, 62, e202216281. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Yang, J.; Gao, S.; Hou, H.; Xiao, K.; Hu, J.; Liang, S.; Liu, B. New insight into the formation of polyhalogenated carbazoles: Aqueous chlorination of residual carbazole under bromide condition in drinking water. Water Res. 2019, 159, 252–261. [Google Scholar] [CrossRef] [Scilit]
- Du, Z.; Hou, K.; Zhou, T.; Shi, B.; Zhang, C.; Zhu, L.; Li, B.; Wang, J.; Wang, J. Polyhalogenated carbazoles (phczs) induce cardiotoxicity and behavioral changes in zebrafish at early developmental stages. Sci. Total Environ. 2022, 841, 156738. [Google Scholar] [CrossRef] [Scilit]
- Ji, C.; Chen, D.; Zhao, M. Environmental behavior and safety of polyhalogenated carbazoles (phczs): A review. Environ. Pollut. 2021, 268, 115717. [Google Scholar] [CrossRef] [Scilit]
- Tao, W.; Zhou, Z.; Shen, L.; Zhu, C.; Zhang, W.; Xu, L.; Guo, Z.; Xu, T.; Xie, H.Q.; Zhao, B. Determination of polyhalogenated carbazoles in soil using gas chromatography-triple quadrupole tandem mass spectrometry. Sci. Total Environ. 2020, 710, 135524. [Google Scholar] [CrossRef] [Scilit]
- Jin, H.; Zhao, N.; Hu, H.; Liu, W.; Zhao, M. Occurrence and partitioning of polyhalogenated carbazoles in seawater and sediment from east china sea. Water Res. 2020, 190, 116717. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Jiang, T.; Li, S.; Hou, H.; Xiao, K.; Hu, J.; Liang, S.; Liu, B.; Yang, J. Occurrence and exposure risk evaluation of polyhalogenated carbazoles (phczs) in drinking water. Sci. Total Environ. 2021, 750, 141615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Fan, X.; Mu, Y.; Wang, L.; Liang, J.; Deng, L. Distribution characteristics and risk assessment of polyhalogenated carbazoles in sea water of the yellow sea. Mar. Pollut. Bull. 2020, 161, 111656. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Tan, H.; Sutton, R.; Chen, D. From sediment to top predators: Broad exposure of polyhalogenated carbazoles in san francisco bay (U.S.A.). Environ. Sci. Technol. 2017, 51, 2038–2046. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ji, C.; Yan, L.; Chen, Y.; Yue, S.; Dong, Q.; Chen, J.; Zhao, M. Evaluation of the developmental toxicity of 2,7-dibromocarbazole to zebrafish based on transcriptomics assay. J. Hazard. Mater. 2019, 368, 514–522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Hu, M.; Li, M.; Huan, F.; Gao, R.; Wang, J. Effects of exposure to 3,6-dbcz on neurotoxicity and ahr pathway during early life stages of zebrafish (danio rerio). Ecotoxicol. Environ. Saf. 2024, 270, 115892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Bai, Y.; Meng, H.; Zhu, Y.; Yue, H.; Li, B.; Wang, J.; Wang, J.; Zhu, L.; Du, Z. Combined toxic effects of polystyrene microplastics and 3,6-dibromocarbazole on zebrafish (danio rerio) embryos. Sci. Total Environ. 2024, 913, 169787. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, M.; Hou, C.; Zhang, Q.; Yao, D.; Hu, S.; Wang, G.; Gao, S. Tissue-specific accumulation, depuration and histopathological effects of 3,6-dichlorocarbazole and 2,7-dibromocarbazole in adult zebrafish (danio rerio). Aquat. Toxicol. 2024, 266, 106803. [Google Scholar] [CrossRef] [Scilit]
- Sun, J.; Zhang, L.; Zhou, F.; Shaw, S.; Roos, A.; Berger, M.; Bäcklin, B.M.; Huang, Y.; Zheng, X.; Wang, X.; et al. Hepatic fatty acid profiles associated with exposure to emerging and legacy halogenated contaminants in two harbor seal populations across the north atlantic. Environ. Sci. Technol. 2022, 56, 1830–1840. [Google Scholar] [CrossRef] [Scilit]
- Cai, L.; Liu, G.; Wei, Y.; Zhu, Y.; Li, J.; Miao, Z.; Chen, M.; Yue, Z.; Yu, L.; Dong, Z.; et al. Whole-genome sequencing reveals sex determination and liver high-fat storage mechanisms of yellowstripe goby (Mugilogobius chulae). Commun. Biol. 2021, 4, 15. [Google Scholar] [CrossRef] [Scilit]
- Gao, C.; Lai, S.; Zeng, J. Developmental studies on embryonic and early larvae of Mugilogobius chulae. Fish. Sci. Technol. Inf. 2024, 51, 1–7. [Google Scholar]
- Guo, Z.; Ni, Z.; Ye, H.; Xiao, J.; Chen, L.; Green, I.; Zhang, L. Simultaneous uptake of cd from sediment, water and diet in a demersal marine goby Mugilogobius chulae. J. Hazard. Mater. 2019, 364, 143–150. [Google Scholar] [CrossRef] [Scilit]
- Cai, L.; Li, J.; Yu, L.; Wei, Y.; Miao, Z.; Chen, M.; Huang, R. Characterization of transcriptional responses mediated by benzo[a]pyrene stress in a new marine fish model of goby, Mugilogobius chulae. Genes Genom. 2019, 41, 113–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Chen, Z.; Huang, R.; Miao, Z.; Cai, L.; Du, Q. Toxicity assessment and histopathological analysis of nano-zno against marine fish (Mugilogobius chulae) embryos. J. Environ. Sci. 2018, 73, 78–88. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Tang, T.; Ren, J.; Zhao, Y.; Hou, Y.; Nie, X. Hypoxia aggravates the burden of yellowstripe goby (Mugilogobius chulae) under atorvastatin exposure. Aquat. Toxicol. 2023, 255, 106381. [Google Scholar] [CrossRef] [Scilit]
- Cui, Z.; Luan, X.; Li, S.; Zhao, X.; Lin, Z.; Li, J.; Gao, W.; Zheng, L.; Ma, Z.; Xie, J. Genotoxicity detection of oil-containing drill cuttings by comet assay based on a demersal marine fish Mugilogobius chulae. Ecotoxicol. Environ. Saf. 2021, 208, 111655. [Google Scholar] [CrossRef] [Scilit]
- OECD. Test No. 236: Fish Embryo Acute Toxicity (FET) Test, OECD Guidelines for the Testing of Chemicals, Section 2; OECD Publishing: Paris, France, 2013. [Google Scholar]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An ultra-fast all-in-one fastq preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. Hisat: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [Scilit]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. Stringtie enables improved reconstruction of a transcriptome from rna-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from rna-seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for rna-seq data with deseq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Feng, Z.; Wang, X.; Wang, X.; Zhang, X. Degseq: An r package for identifying differentially expressed genes from rna-seq data. Bioinformatics 2009, 26, 136–138. [Google Scholar] [CrossRef] [Scilit]
- Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.Y.; Wei, L. Kobas 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2 (-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Tillitt, D.E.; Buckler, J.A.; Nicks, D.K.; Candrl, J.S.; Claunch, R.A.; Gale, R.W.; Puglis, H.J.; Little, E.E.; Linbo, T.L.; Baker, M. Sensitivity of lake sturgeon (Acipenser fulvescens) early life stages to 2,3,7,8-tetrachlorodibenzo-p-dioxin and 3,3′,4,4′,5-pentachlorobiphenyl. Environ. Toxicol. Chem. 2017, 36, 988–998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamauchi, M.; Kim, E.Y.; Iwata, H.; Shima, Y.; Tanabe, S. Toxic effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (tcdd) in developing red seabream (Pagrus major) embryo: An association of morphological deformities with ahr1, ahr2 and cyp1a expressions. Aquat. Toxicol. 2006, 80, 166–179. [Google Scholar] [CrossRef] [Scilit]
- Fang, M.; Guo, J.; Chen, D.; Li, A.; Hinton, D.E.; Dong, W. Halogenated carbazoles induce cardiotoxicity in developing zebrafish (danio rerio) embryos. Environ. Toxicol. Chem. 2016, 35, 2523–2529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, Y. 2,7-Dibromocarbazole Induces Developmental Toxicity through Alternation of Lipid Metabolism in Xenopus tropicalis Embryos. Master’s Thesis, East China Normal University, Shanghai, China, 2022. [Google Scholar]
- Guengerich, F.P.; Waterman, M.R.; Egli, M. Recent structural insights into cytochrome p450 function. Trends Pharmacol. Sci. 2016, 37, 625–640. [Google Scholar] [CrossRef] [Scilit]
- Stejskalova, L.; Pavek, P. The function of cytochrome p450 1a1 enzyme (cyp1a1) and aryl hydrocarbon receptor (ahr) in the placenta. Curr. Pharm. Biotechnol. 2012, 12, 715–730. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.Y.; Zhang, L.; Han, X.Y.; Wang, D.M.; Ding, M.L.; Cheng, D.; He, Q.L.; Liu, S.Z. 2,3′,4,4′,5-pentachlorobiphenyl induces mitochondria-dependent apoptosis mediated by ahr/cyp1a1 in mouse germ cells. J. Hazard. Mater. 2023, 445, 130547. [Google Scholar] [CrossRef] [Scilit]
- Handley-Goldstone, H.M.; Grow, M.W.; Stegeman, J.J. Cardiovascular gene expression profiles of dioxin exposure in zebrafish embryos. Toxicol. Sci. 2005, 85, 683–693. [Google Scholar] [CrossRef] [Scilit]
- Weng, W.C.; Lee, W.T.; Hsu, W.M.; Chang, B.E.; Lee, H. Role of glucose-regulated protein 78 in embryonic development and neurological disorders. J. Formos. Med. Assoc. 2011, 110, 428–437. [Google Scholar] [CrossRef] [Scilit]
- Hu, C.; Yang, J.; Qi, Z.; Wu, H.; Wang, B.; Zou, F.; Mei, H.; Liu, J.; Wang, W.; Liu, Q. Heat shock proteins: Biological functions, pathological roles, and therapeutic opportunities. MedComm 2022, 3, e161. [Google Scholar] [CrossRef] [Scilit]
- Syed, M.; Nourizadeh-Lillabadi, R.; Press, C.M.L.; Alestrøm, P. Prion protein function and the disturbance of early embryonic development in zebrafish. Prion 2011, 5, 88–92. [Google Scholar] [CrossRef] [Scilit]
- Coulthard, L.G.; Hawksworth, O.A.; Li, R.; Balachandran, A.; Lee, J.D.; Sepehrband, F.; Kurniawan, N.; Jeanes, A.; Simmons, D.G.; Wolvetang, E.; et al. Complement c5ar1 signaling promotes polarization and proliferation of embryonic neural progenitor cells through pkcζ. J. Neurosci. 2017, 37, 5395–5407. [Google Scholar] [CrossRef] [Scilit]
- Pouw, R.B.; Ricklin, D. Tipping the balance: Intricate roles of the complement system in disease and therapy. Semin. Immunopathol. 2021, 43, 757–771. [Google Scholar] [CrossRef] [Scilit]
- Corvillo, F.; Akinci, B. An overview of lipodystrophy and the role of the complement system. Mol. Immunol. 2019, 112, 223–232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zarantonello, A.; Revel, M.; Grunenwald, A.; Roumenina, L.T. C3-dependent effector functions of complement. Immunol. Rev. 2023, 313, 120–138. [Google Scholar] [CrossRef] [Scilit]
- Barnum, S.R.; Bubeck, D.; Schein, T.N. Soluble membrane attack complex: Biochemistry and immunobiology. Front. Immunol. 2020, 11, 585108. [Google Scholar] [CrossRef] [Scilit]
- Loeffler, D.A.; Camp, D.M.; Bennett, D.A. Plaque complement activation and cognitive loss in alzheimer’s disease. J. Neuroinflammation 2008, 5, 9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loeffler, D.A.; Camp, D.M.; Conant, S.B. Complement activation in the parkinson’s disease substantia nigra: An immunocytochemical study. J. Neuroinflammation 2006, 3, 29. [Google Scholar] [CrossRef] [Scilit]
- Zhou, L.; Chu, L.; Du, J.; Nie, Z.; Cao, L.; Gao, J.; Xu, G. Oxidative stress and immune response of hepatopancreas in chinese mitten crab eriocheir sinensis under lipopolysaccharide challenge. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2023, 263, 109495. [Google Scholar] [CrossRef] [Scilit]
- Montell, C. Drosophila visual transduction. Trends Neurosci. 2012, 35, 356–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, M.; Has, C.; Lam-Kamath, K.; Ayciriex, S.; Dewett, D.; Bashir, M.; Poupault, C.; Schuhmann, K.; Knittelfelder, O.; Raghuraman, B.K.; et al. Vitamin a deficiency alters the phototransduction machinery and distinct non-vision-specific pathways in the drosophila eye proteome. Biomolecules 2022, 12, 8. [Google Scholar] [CrossRef] [Scilit]
- Hofmann, K.P.; Lamb, T.D. Rhodopsin, light-sensor of vision. Prog. Retin. Eye Res. 2023, 93, 101116. [Google Scholar] [CrossRef] [Scilit]
- Yau, K.W.; Hardie, R.C. Phototransduction motifs and variations. Cell 2009, 139, 246–264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qu, J.; Ko, C.W.; Tso, P.; Bhargava, A. Apolipoprotein a-iv: A multifunctional protein involved in protection against atherosclerosis and diabetes. Cells 2019, 8, 319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, W.; Wang, C.; Qin, K.; Shi, H.; Yang, X.; Yang, X. Lactobacillus plantarum injection at the embryonic stage alters the early growth performance and lipid metabolism of broilers by specific genera of bacteria. Poult. Sci. 2023, 102, 102522. [Google Scholar] [CrossRef] [Scilit]
- Jiang, Y.; Geng, N.; Wang, M.; Wu, W.; Feng, N.; Zhang, X. 5-hmf affects cardiovascular development in zebrafish larvae via reactive oxygen species and wnt signaling pathways. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2022, 262, 109452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martini, D.; Pucci, C.; Gabellini, C.; Pellegrino, M.; Andreazzoli, M. Exposure to the natural alkaloid berberine affects cardiovascular system morphogenesis and functionality during zebrafish development. Sci. Rep. 2020, 10, 17358. [Google Scholar] [CrossRef] [Scilit]







| Gene Name | Gene Name | Sequence | Gene Number |
|---|---|---|---|
| Reference gene | β-Actin | F: GGCTACTCCTTCACCACCACAG | -- |
| R: TTCCGCAAGATTCCATACCG | |||
| Up-regulated | CYP1A | F: TGCCACATTCAAGCCACATTACG | PB.21006 |
| R: ACAGTGGTATCGGGTATGGATTGC | |||
| CYP1C | F: CATCAGTGCTGCTTTGAGAGTGAC | PB.17128 | |
| R: TTGGCTCGGAGACAGAAGTGAAC | |||
| GST | F: TTGCTTTCCTCGTCCGAATGGG | PB.1965 | |
| R: GGGCGACTCTTTAGGTGGTTGTAG | |||
| C3 | F: ATGCTCTTCTGGCTCTCGTCAAG | PB.7408 | |
| R: CTCGGACACTGCCTGATACACC | |||
| SQSTM1 | F: CCGCTCGTCCAGAGTTCAGTG | PB.8379 | |
| R: ACGGCAGGCAGCAGAAGATTC | |||
| IMPA | F: TGCATCCTAACAGACGAACCTACC | PB.7771 | |
| R:TAGACACTGCCACAAAGGGAATCC | |||
| Down-regulated | KRT1 | F: ACATGCGTCAGTCCGTAGAAGC | PB.4747 |
| R: GTCCTCCTCGTGGTTGGTCTTG | |||
| RHO | F: TGTAGGTCCCTCTCCATCTCTGTC | PB.13668 | |
| R:GGTCCCTCTGTGCCGTTCATG | |||
| KRT2 | F: GGTGGTGGTGGAAGCCGTATG | PB.18903 | |
| R: GCACCTCCGCCTGATCTGAAG | |||
| LEG1 | F: TTCTCTGGTGCTGCTGCTGTG | PB.12502 | |
| R: ACATGATCGGACCGCCATTCTC |
| Sample | Raw Reads | Raw Bases | Clean Reads | Clean Bases | Error Rate (%) | Q20 (%) * | Q30 (%) * | GC Content (%) |
|---|---|---|---|---|---|---|---|---|
| 2,7-DBCZ_1 | 44,405,146 | 6,705,177,046 | 44,178,282 | 6,605,033,687 | 0.0247 | 98.18 | 94.4 | 48.29 |
| 2,7-DBCZ_2 | 43,911,458 | 6,630,630,158 | 43,682,736 | 6,530,441,432 | 0.0246 | 98.24 | 94.58 | 48.28 |
| 2,7-DBCZ_3 | 46,485,840 | 7,019,361,840 | 46,222,348 | 6,922,762,351 | 0.0243 | 98.31 | 94.79 | 48.95 |
| control_1 | 45,950,398 | 6,938,510,098 | 45,659,470 | 6,828,622,487 | 0.0248 | 98.13 | 94.33 | 49.47 |
| control_2 | 51,691,138 | 7,805,361,838 | 51,434,326 | 7,679,874,890 | 0.0244 | 98.31 | 94.75 | 48.53 |
| control_3 | 44,086,104 | 6,657,001,704 | 43,833,164 | 6,559,226,539 | 0.0244 | 98.3 | 94.77 | 48.71 |
| Sample | Total Reads | Total Mapped | Multiple Mapped | Uniquely Mapped |
|---|---|---|---|---|
| 2,7-DBCZ_1 | 44,178,282 | 36,539,927 (82.71%) | 1,711,824 (3.87%) | 34,828,103 (78.84%) |
| 2,7-DBCZ_2 | 43,682,736 | 36,129,159 (82.71%) | 1,600,659 (3.66%) | 34,528,500 (79.04%) |
| 2,7-DBCZ_3 | 46,222,348 | 38,521,041 (83.34%) | 1,760,256 (3.81%) | 36,760,785 (79.53%) |
| control_1 | 45,659,470 | 38,647,959 (84.64%) | 1,947,722 (4.27%) | 36,700,237 (80.38%) |
| control_2 | 51,434,326 | 42,871,351 (83.35%) | 2,177,718 (4.23%) | 40,693,633 (79.12%) |
| control_3 | 43,833,164 | 36,681,621 (83.68%) | 1,884,808 (4.3%) | 34,796,813 (79.38%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, C.; Lai, S.; Zeng, J.; Peng, Y.; Li, J. Toxicity Evaluation and Transcriptome Analysis of Yellowstripe Goby (Mugilogobius chulae) in Response to 2,7-Dibromocarbazole Exposure during Early Development. Toxics 2024, 12, 609. https://doi.org/10.3390/toxics12080609
Gao C, Lai S, Zeng J, Peng Y, Li J. Toxicity Evaluation and Transcriptome Analysis of Yellowstripe Goby (Mugilogobius chulae) in Response to 2,7-Dibromocarbazole Exposure during Early Development. Toxics. 2024; 12(8):609. https://doi.org/10.3390/toxics12080609
Chicago/Turabian StyleGao, Caixia, Suqun Lai, Jin Zeng, Ying Peng, and Jianjun Li. 2024. "Toxicity Evaluation and Transcriptome Analysis of Yellowstripe Goby (Mugilogobius chulae) in Response to 2,7-Dibromocarbazole Exposure during Early Development" Toxics 12, no. 8: 609. https://doi.org/10.3390/toxics12080609
APA StyleGao, C., Lai, S., Zeng, J., Peng, Y., & Li, J. (2024). Toxicity Evaluation and Transcriptome Analysis of Yellowstripe Goby (Mugilogobius chulae) in Response to 2,7-Dibromocarbazole Exposure during Early Development. Toxics, 12(8), 609. https://doi.org/10.3390/toxics12080609

