Aptamer Sensors for the Detection of Antibiotic Residues— A Mini-Review
Abstract
1. Introduction
2. Antibiotic Aptamers
3. Electrochemical-Based Antibiotic Sensors
3.1. Sensing Principle of the Electrochemical Sensor
3.2. Application of the Electrochemical Aptamer Sensor for the Detection of Antibiotics
4. Colorimetric-Based Antibiotic Sensors
4.1. Sensing Principle of the Colorimetric Sensor
4.2. Application of Colorimetric Aptamer Sensors for Antibiotic Detection

5. Fluorescent-Based Antibiotic Sensors
5.1. Sensing Principle of Fluorescent Sensors
5.2. Applications of Fluorescent Aptamer Sensors in the Detection of Antibiotics
6. Conclusions and Prospects
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Sun, P.; Li, B.; Zhen, J.; Zhao, J.; Jia, W.; Pan, L.; Gong, W.; Liang, G. An enzyme-free, ultrasensitive strategy for simultaneous screening of the p-nitrophenyl substituent organophosphorus pesticides. Food Chem. 2023, 408, 135218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Zhai, H.; Yin, J.; Guo, Q.; Zhang, Y.; Sun, X.; Guo, Y.; Yang, Q.; Li, F.; Zhan, Y. Recent Advances and Future Prospects of Aptamer-based Biosensors in Food Safety. Int. J. Electrochem. Sci. 2022, 17, 22019. [Google Scholar] [CrossRef] [Scilit]
- Seth, S.; Rathinasabapathi, P. A Short Review on Detection of Antibiotics in Milk Using Nanomaterial-Based Biosensor. Food Anal. Methods 2022, 15, 2181–2192. [Google Scholar] [CrossRef] [Scilit]
- Evtugyn, G.; Porfireva, A.; Tsekenis, G.; Oravczova, V.; Hianik, T. Electrochemical Aptasensors for Antibiotics Detection: Recent Achievements and Applications for Monitoring Food Safety. Sensors 2022, 22, 3684. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.; Zhao, J.; Liang, L. Recent development of antibiotic detection in food and environment: The combination of sensors and nanomaterials. Microchim. Acta 2021, 188, 21. [Google Scholar] [CrossRef] [Scilit]
- Jospe-Kaufman, M.; Siomin, L.; Fridman, M. The relationship between the structure and toxicity of aminoglycoside antibiotics. Bioorg. Med. Chem. Lett. 2020, 30, 127218. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Y.T.; Liu, S.Y.; Gao, Y.; Zhang, Y.; Zhang, Q.H.; Li, X.Q. Determination of antibiotic residues in aquaculture products by liquid chromatography tandem mass spectrometry: Recent trends and developments from 2010 to 2020. Separations 2022, 9, 35. [Google Scholar] [CrossRef] [Scilit]
- GB 31650-2019; National Standards for Food Safety Maximum Residue Limits for Veterinary Drugs in Food. Ministry of Agriculture and Rural Affairs of the People’s Republic of China: Beijing, China, 2019.
- Zhao, C.; Pan, B.; Wang, M.; Si, Y.; Taha, A.Y.; Liu, G.; Pan, T.; Sun, G. Improving the sensitivity of nanofibrous membrane-based ELISA for on-site antibiotics detection. ACS Sens. 2022, 7, 1458–1466. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Sang, Y.; Zhang, J.; Li, J.; Yu, W.; Zhang, F.; Wang, X. Development of a broad-specific competitive ELISA for first-generation cephalosporin antibiotics in animal-derived foods samples. Bull. Environ. Contam. Toxicol. 2021, 107, 215–220. [Google Scholar] [CrossRef] [Scilit]
- Nan, Q.; Tang, J.; Hu, Y.; Wu, T. Advances in detection of antibiotics in different environmental matrix. Chem. Res. Appl. 2017, 29, 1609–1621. [Google Scholar]
- Chiesa, L.M.; Nobile, M.; Panseri, S.; Arioli, F. Antibiotic use in heavy pigs: Comparison between urine and muscle samples from food chain animals analysed by HPLC-MS/MS. Food Chem. 2017, 235, 111–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dincel, D.; Sagirli, O.; Topcu, G. A high-performance liquid chromatographic method for the determination of meropenem in serum. J. Chromatogr. Sci. 2020, 58, 144–150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Piestansky, J.; Cizmarova, I.; Mikus, P.; Parrak, V.; Babiak, P.; Secnik, P., Jr.; Secnik, P.; Kovac, A. An ultra-high-performance liquid chromatography-tandem mass spectrometry method for simultaneous determination of 4 β-Lactam antibiotics, tazobactam, and linezolid in human plasma samples. Ther. Drug Monit. 2022, 44, 784–790. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, Y.; Wang, X.; Lu, Y.; Guo, Y.; Xie, K.; Chen, L.; Chen, J.; He, Z.; Guan, F.; Gao, P.; et al. Qualitative and quantitative determination of tilmicosin in poultry eggs by gas chromatography tandem mass spectrometry after derivatization with acetic anhydride. Food Chem. 2022, 384, 132572. [Google Scholar] [CrossRef] [Scilit]
- Liang, G.; Man, Y.; Li, A.; Jin, X.; Liu, X.; Pan, L. DNAzyme-based biosensor for detection of lead ion: A review. Microchem. J. 2017, 131, 145–153. [Google Scholar] [CrossRef] [Scilit]
- Liang, G.; Man, Y.; Li, A.; Jin, X.; Pan, L.; Liu, X. Chemiluminescence assay for detection of 2-hydroxyfluorene using the G-quadruplex DNAzyme-H2O2-luminol system. Microchim. Acta 2018, 185, 54. [Google Scholar] [CrossRef] [Scilit]
- Liang, G.; Man, Y.; Jin, X.; Pan, L.; Liu, X. Aptamer-based biosensor for label-free detection of ethanolamine by electrochemical impedance spectroscopy. Anal. Chim. Acta 2016, 936, 222–228. [Google Scholar] [CrossRef] [Scilit]
- Liang, G.; He, Z.; Zhen, J.; Tian, H.; Ai, L.; Pan, L.; Gong, W. Development of the screen-printed electrodes: A mini review on the application for pesticide detection. Environ. Technol. Innov. 2022, 28, 102922. [Google Scholar] [CrossRef] [Scilit]
- Fu, L.; Mao, S.; Chen, F.; Zhao, S.; Su, W.; Lai, G.; Yu, A.; Lin, C.T. Graphene-based electrochemical sensors for antibiotic detection in water, food and soil: A scientometric analysis in CiteSpace (2011–2021). Chemosphere 2022, 297, 134127. [Google Scholar] [CrossRef] [Scilit]
- Zahra, Q.U.; Luo, Z.; Ali, R.; Khan, M.I.; Li, F.; Qiu, B. Advances in Gold Nanoparticles-Based Colorimetric Aptasensors for the Detection of Antibiotics: An Overview of the Past Decade. Nanomaterials 2021, 11, 840. [Google Scholar] [CrossRef] [Scilit]
- de Faria, L.V.; Lisboa, T.P.; Campos, N.d.S.; Alves, G.F.; Matos, M.A.C.; Matos, R.C.; Munoz, R.A.A. Electrochemical methods for the determination of antibiotic residues in milk: A critical review. Anal. Chim. Acta 2021, 1173, 338569. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Y.; Mahapatra, C.; Chen, H.; Peng, X.; Ramakrishna, S.; Nanda, H.S. Recent developments in fluorescent aptasensors for detection of antibiotics. Curr. Opin. Biomed. Eng. 2020, 13, 16–24. [Google Scholar] [CrossRef] [Scilit]
- Luan, Y.; Wang, N.; Li, C.; Guo, X.; Lu, A. Advances in the application of aptamer biosensors to the detection of aminoglycoside antibiotics. Antibiotics 2020, 9, 787. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yue, F.; Li, F.; Kong, Q.; Guo, Y.; Sun, X. Recent advances in aptamer-based sensors for aminoglycoside antibiotics detection and their applications. Sci. Total Environ. 2021, 762, 143129. [Google Scholar] [CrossRef] [Scilit]
- Ye, H.; Yang, Z.; Khan, I.M.; Niazi, S.; Guo, Y.; Wang, Z.; Yang, H. Split aptamer acquisition mechanisms and current application in antibiotics detection: A short review. Crit. Rev. Food Sci. Nutr. 2022, 9, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Taghdisi Heidarian, S.M.; Tavanaee Sani, A.; Danesh, N.M.; Ramezani, M.; Alibolandi, M.; Gerayelou, G.; Abnous, K.; Taghdisi, S.M. A novel electrochemical approach for the ultrasensitive detection of fluoroquinolones based on a double-labelled aptamer to surpass complementary strands of aptamer lying flat. Sens. Actuators B Chem. 2021, 334, 129632. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Yang, Z.; Li, B.; Du, J. Aptamer biorecognition-triggered hairpin switch and nicking enzyme assisted signal amplification for ultrasensitive colorimetric bioassay of kanamycin in milk. Food Chem. 2021, 339, 128059. [Google Scholar] [CrossRef] [Scilit]
- Han, X.; Zhang, Y.; Nie, J.; Zhao, S.; Tian, Y.; Zhou, N. Gold nanoparticle based photometric determination of tobramycin by using new specific DNA aptamers. Microchim. Acta 2017, 185, 4. [Google Scholar] [CrossRef] [Scilit]
- Ding, R.; Chen, Y.; Wang, Q.; Wu, Z.; Zhang, X.; Li, B.; Lin, L. Recent advances in quantum dots-based biosensors for antibiotics detection. J. Pharm. Anal. 2022, 12, 355. [Google Scholar] [CrossRef] [Scilit]
- Khoshbin, Z.; Verdian, A.; Housaindokht, M.R.; Izadyar, M.; Rouhbakhsh, Z. Aptasensors as the future of antibiotics test kits—A case study of the aptamer application in the chloramphenicol detection. Biosens. Bioelectron. 2018, 122, 263–283. [Google Scholar] [CrossRef] [Scilit]
- Nur Topkaya, S.; Cetin, A.E. Electrochemical aptasensors for biological and chemical analyte detection. Electroanalysis 2021, 33, 277–291. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.; Belmonte, I.; Sykes, K.S.; Xiao, Y.; White, R.J. Perspective on the future role of aptamers in analytical chemistry. Anal. Biochem. 2019, 91, 15335–15344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mayer, G. The chemical biology of aptamers. Angew. Chem. Int. Ed. 2009, 48, 2672–2689. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, J.; Rossi, J. Aptamers as targeted therapeutics: Current potential and challenges. Nat. Rev. Drug Discov. 2017, 16, 181–202. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Yin, S.; Li, Y.; Lu, D.; Zhang, J.; Sun, C. Application of aptamers in detection and chromatographic purification of antibiotics in different matrices. TrAC Trends Anal. Chem. 2017, 95, 1–22. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Choe, W.S. Screening of pefloxacin-binding single strand DNA aptamer. J. Biotechnol. 2008, 136, S86. [Google Scholar] [CrossRef] [Scilit]
- Han, S.R.; Yu, J.; Lee, S.W. In vitro selection of RNA aptamers that selectively bind danofloxacin. Biochem. Biophys. Res. Commun. 2014, 448, 397–402. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.H.; Wang, Z.C.; Zhang, X.B.; Xu, D.K. Screening of lomefloxacin aptamers based on polydopamine nanospheres. Chin. J. Anal. Chem. 2017, 45, 1971–1979. [Google Scholar]
- You, Y.D. Screening of Antibiotics-Specific Aptamer and Fabrication of Antibiotics Aptasensor Based on Graphene. Master’s Thesis, Jiangnan University, Wuxi, China, 2015. [Google Scholar]
- Li, F.; Yu, Z.; Han, X.; Lai, R.Y. Electrochemical aptamer-based sensors for food and water analysis: A review. Anal. Chim. Acta 2019, 1051, 1–23. [Google Scholar] [CrossRef] [Scilit]
- Bahadır, E.B.; Sezgintürk, M.K. Applications of graphene in electrochemical sensing and biosensing. TrAC Trends Anal. Chem. 2016, 76, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Lin, L.; Chang, X.; Si, Z.; Plaxco, K.W.; Khine, M.; Li, H.; Xia, F. A wrinkled structure of gold film greatly improves the signaling of electrochemical aptamer-based biosensors. RSC Adv. 2020, 11, 671–677. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, Y.; Chandra, P.; Song, K.-M.; Ban, C.; Shim, Y.B. Label-free detection of kanamycin based on the aptamer-functionalized conducting polymer/gold nanocomposite. Biosens. Bioelectron. 2012, 36, 29–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, K.-M.; Cho, M.; Jo, H.; Min, K.; Jeon, S.H.; Kim, T.; Han, M.S.; Ku, J.K.; Ban, C. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer. Anal. Biochem. 2011, 415, 175–181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Niazi, J.H.; Lee, S.J.; Gu, M.B. Single-stranded DNA aptamers specific for antibiotics tetracyclines. Bioorg. Med. Chem. 2008, 16, 7245–7253. [Google Scholar] [CrossRef] [Scilit]
- Berensy, C.; Thainy, A.; Schroeder, R. A Tetracycline-binding RNA Aptamer. Bioorg. Med. Chem. 2001, 9, 2549–2556. [Google Scholar] [CrossRef] [Scilit]
- Niazi, J.H.; Lee, S.J.; Kim, Y.S.; Gu, M.B. ssDNA aptamers that selectively bind oxytetracycline. Bioorg. Med. Chem. 2008, 16, 1254–1261. [Google Scholar] [CrossRef] [Scilit]
- Kwon, Y.S.; Ahmad Raston, N.H.; Gu, M.B. An ultra-sensitive colorimetric detection of tetracyclines using the shortest aptamer with highly enhanced affinity. Chem. Commun. 2014, 50, 40–42. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, V.T.; Lee, B.H.; Kim, S.H.; Gu, M.B. Aptamer-aptamer linkage based aptasensor for highly enhanced detection of small molecules. Biotechnol. J. 2016, 11, 843–849. [Google Scholar] [CrossRef] [Scilit]
- Burke, D.H.; Hoffman, D.C.; Brown, A.; Hansen, M.; Pardi, A.; Gold, L. RNA aptamers to the peptidyl transferase inhibitor chloramphenicol. Chem. Biol. 1997, 4, 833–843. [Google Scholar] [CrossRef] [Scilit]
- Spiga, F.M.; Maietta, P.; Guiducci, C. More DNA-aptamers for small drugs: A capture–SELEX coupled with surfaceplasmon resonance and high-throughput sequencing. ACS Comb. Sci. 2015, 17, 326–333. [Google Scholar] [CrossRef] [Scilit]
- Mehta, J.; Van Dorst, B.; Rouah-Martin, E.; Herrebout, W.; Scippo, M.-L.; Blust, R.; Robbens, J. In vitro selection and characterization of DNA aptamers recognizing chloramphenicol. J. Biotechnol. 2011, 155, 361–369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, N.; Wang, J.; Zhang, J.; Li, C.; Tian, Y.; Wang, J. Selection and identification of streptomycin-specific single-stranded DNA aptamers and the application in the detection of streptomycin in honey. Talanta 2013, 108, 109–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.; Zhang, Y.; Xie, Y.; Sun, Y.; Bi, K.; Cui, Z.; Zhao, L.; Fan, W. An aptamer-based colorimetric sensor for streptomycin and its application in food inspection. Chem. Res. Chin. Univ. 2017, 33, 714–720. [Google Scholar] [CrossRef] [Scilit]
- Soheili, V.; Taghdisi, S.M.; Hassanzadeh Khayyat, M.; Fazly Bazzaz, B.S.; Ramezani, M.; Abnous, K. Colorimetric and ratiometric aggregation assay for streptomycin using gold nanoparticles and a new and highly specific aptamer. Microchim. Acta 2016, 183, 1687–1697. [Google Scholar] [CrossRef] [Scilit]
- Zhao, J.; Guo, W.; Pei, M.; Ding, F. GR-Fe3O4NPs and PEDOT-AuNPs composite based electrochemical aptasensor for the sensitive detection of penicillin. Anal. Methods 2016, 8, 4391–4397. [Google Scholar] [CrossRef] [Scilit]
- Paniel, N.; Istamboulié, G.; Triki, A.; Lozano, C.; Barthelmebs, L.; Noguer, T. Selection of DNA aptamers against penicillin G using Capture-SELEX for the development of an impedimetric sensor. Talanta 2017, 162, 232–240. [Google Scholar] [CrossRef] [Scilit]
- Guan, J.; He, K.; Gunasekaran, S. Selection of ssDNA aptamer using GO-SELEX and development of DNA nanostructure-based electrochemical aptasensor for penicillin. Biosens. Bioelectron. 2022, 12, 100220. [Google Scholar] [CrossRef] [Scilit]
- Song, K.-M.; Jeong, E.; Jeon, W.; Cho, M.; Ban, C. Aptasensor for ampicillin using gold nanoparticle based dual fluorescence–colorimetric methods. Anal. Bioanal. Chem. 2012, 402, 2153–2161. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Dong, S.; Gai, P.; Duan, R.; Li, F. Highly sensitive homogeneous electrochemical aptasensor for antibiotic residues detection based on dual recycling amplification strategy-ampicillin. Biosens. Bioelectron. 2016, 82, 49–54. [Google Scholar] [CrossRef] [Scilit]
- Lee, A.Y.; Ha, N.-R.; Jung, I.-P.; Kim, S.-H.; Kim, A.R.; Yoon, M.-Y. Development of a ssDNA aptamer for detection of residual benzylpenicillin. Anal. Biochem. 2017, 531, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Yu, Z.G.; Lai, R.Y. A reagentless and reusable electrochemical aptamer-based sensor for rapid detection of ampicillin in complex samples. Talanta 2018, 176, 619–624. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ni, H.; Zhang, S.; Ding, X.; Mi, T.; Wang, Z.; Liu, M. Determination of enrofloxacin in bovine milk by a novel single-stranded DNA aptamer chemiluminescent enzyme immunoassay. Anal. Lett. 2014, 47, 2844–2856. [Google Scholar] [CrossRef] [Scilit]
- Dolati, S.; Ramezani, M.; Nabavinia, M.S.; Soheili, V.; Abnous, K.; Taghdisi, S.M. Selection of specific aptamer against enrofloxacin and fabrication of graphene oxide based label-free fluorescent assay. Anal. Biochem. 2018, 549, 124–129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reinemann, C.; Freiin von Fritsch, U.; Rudolph, S.; Strehlitz, B. Generation and characterization of quinolone-specific DNA aptamers suitable for water monitoring. Biosens. Bioelectron. 2016, 77, 1039–1047. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, Y.; Gao, Z.; Li, H. Real milk sample assisted selection of specific aptamer towards sarafloxacin and its application in establishment of an effective aptasensor. Sens. Actuators B Chem. 2021, 343, 130113. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Liu, C.; Yin, G.; Zhang, Q.; Luo, J.; Wu, N. Aptamer-molecularly imprinted sensor base on electrogenerated chemiluminescence energy transfer for detection of lincomycin. Biosens. Bioelectron. 2017, 91, 687–691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chinnappan, R.; Eissa, S.; Alotaibi, A.; Siddiqua, A.; Alsager, O.A.; Zourob, M. In vitro selection of DNA aptamers and their integration in a competitive voltammetric biosensor for azlocillin determination in waste water. Anal. Chim. Acta 2020, 1101, 149–156. [Google Scholar] [CrossRef] [Scilit]
- Wallis, M.G.; von Ahsen, U.; Schroeder, R.; Famulok, M. A novel RNA motif for neomycin recognition. Chem. Biol. 1995, 2, 543–552. [Google Scholar] [CrossRef] [Scilit]
- Roushani, M.; Rahmati, Z.; Hoseini, S.J.; Hashemi Fath, R. Impedimetric ultrasensitive detection of chloramphenicol based on aptamer MIP using a glassy carbon electrode modified by 3-ampy-RGO and silver nanoparticle. Colloids Surfaces B 2019, 183, 110451. [Google Scholar] [CrossRef] [Scilit]
- Sharma, A.; Istamboulie, G.; Hayat, A.; Catanante, G.; Bhand, S.; Marty, J.L. Disposable and portable aptamer functionalized impedimetric sensor for detection of kanamycin residue in milk sample. Sens. Actuators B Chem. 2017, 245, 507–515. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Yan, K.; Xu, Z.; Wu, J.; Zhang, J. Cathodic “signal-on” photoelectrochemical aptasensor for chloramphenicol detection using hierarchical porous flower-like Bi-BiOI@C composite. Biosens. Bioelectron. 2019, 131, 79–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daprà, J.; Lauridsen, L.H.; Nielsen, A.T.; Rozlosnik, N. Comparative study on aptamers as recognition elements for antibiotics in a label-free all-polymer biosensor -ampicillin or kanamycin. Biosens. Bioelectron. 2013, 43, 315–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pilehvar, S.; Reinemann, C.; Bottari, F.; Vanderleyden, E.; Van Vlierberghe, S.; Blust, R.; Strehlitz, B.; De Wael, K. A joint action of aptamers and gold nanoparticles chemically trapped on a glassy carbon support for the electrochemical sensing of ofloxacin. Sens. Actuators B Chem. 2017, 240, 1024–1035. [Google Scholar] [CrossRef] [Scilit]
- Nie, J.; Yuan, L.; Jin, K.; Han, X.; Tian, Y.; Zhou, N. Electrochemical detection of tobramycin based on enzymes-assisted dual signal amplification by using a novel truncated aptamer with high affinity. Biosens. Bioelectron. 2018, 122, 254–262. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Wang, Y.; Liu, S.; Yu, J.; Guo, Y.; Xu, Y.; Huang, J. Signal-on electrochemical detection of antibiotics at zeptomole level based on target-aptamer binding triggered multiple recycling amplification. Biosens. Bioelectron. 2016, 80, 471–476. [Google Scholar] [CrossRef] [Scilit]
- González-Fernández, E.; de-los-Santos-Álvarez, N.; Lobo-Castañón, M.J.; Miranda-Ordieres, A.J.; Tuñón-Blanco, P. Aptamer-Based Inhibition Assay for the Electrochemical Detection of Tobramycin Using Magnetic Microparticles. Electroanalysis 2011, 23, 43–49. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.; Wang, Y.; Liu, S.; Yu, J.; Wang, H.; Huang, J. A novel sandwich-type electrochemical aptasensor for sensitive detection of kanamycin based on GR–PANI and PAMAM–Au nanocomposites. New J. Chem. 2014, 38, 4931–4937. [Google Scholar] [CrossRef] [Scilit]
- Lu, H.; Huang, Y.; Cui, H.; Li, L.; Ding, Y. A molecularly imprinted electrochemical aptasensor based on zinc oxide and co-deposited gold nanoparticles/reduced graphene oxide composite for detection of amoxicillin. Microchim. Acta 2022, 189, 421. [Google Scholar] [CrossRef] [Scilit]
- Jalalian, S.H.; Karimabadi, N.; Ramezani, M.; Abnous, K.; Taghdisi, S.M. Electrochemical and optical aptamer-based sensors for detection of tetracyclines. Trends Food Sci. Technol. 2018, 73, 45–57. [Google Scholar] [CrossRef] [Scilit]
- Tenaglia, E.; Ferretti, A.; Decosterd, L.A.; Werner, D.; Mercier, T.; Widmer, N.; Buclin, T.; Guiducci, C. Comparison against current standards of a DNA aptamer for the label-free quantification of tobramycin in human sera employed for therapeutic drug monitoring. J. Pharm. Biomed. Anal. 2018, 159, 341–347. [Google Scholar] [CrossRef] [Scilit]
- Lan, L.; Yao, Y.; Ping, J.; Ying, Y. Recent advances in nanomaterial-based biosensors for antibiotics detection. Biosens. Bioelectron. 2017, 9, 504–514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Joshi, A.; Kim, K.H. Recent advances in nanomaterial-based electrochemical detection of antibiotics: Challenges and future perspectives. Biosens. Bioelectron. 2020, 153, 112046. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, M.; Hu, M.; Liu, J.; Guo, C.; Peng, D.; Jia, Q.; He, L.; Zhang, Z.; Du, M. Covalent organic framework-based electrochemical aptasensors for the ultrasensitive detection of antibiotics. Biosens. Bioelectron. 2019, 132, 8–16. [Google Scholar] [CrossRef] [Scilit]
- Yan, Z.; Gan, N.; Li, T.; Cao, Y.; Chen, Y. A sensitive electrochemical aptasensor for multiplex antibiotics detection based on high-capacity magnetic hollow porous nanotracers coupling exonuclease-assisted cascade target recycling. Biosens. Bioelectron. 2016, 78, 51–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X. Synthesis of MOFs-Based Photoelectrochemical Sensing Materials and Their Application in Antibiotic Detection. Master’s Thesis, Jinan University, Jinan, China, 2020. [Google Scholar]
- Xu, Y.; Jiang, D.; Zhang, M.; Zhang, Z.; Qian, J.; Hao, N.; Ding, C.; Wang, K. High-performance photoelectrochemical aptasensor for enrofloxacin based on Bi-doped ultrathin polymeric carbon nitride nanocomposites with SPR effect and carbon vacancies. Sens. Actuators B Chem. 2020, 316, 128142. [Google Scholar] [CrossRef] [Scilit]
- Song, J.; Huang, M.; Jiang, N.; Zheng, S.; Mu, T.; Meng, L.; Liu, Y.; Liu, J.; Chen, G. Ultrasensitive detection of amoxicillin by TiO2-g-C3N4@AuNPs impedimetric aptasensor: Fabrication, optimization, and mechanism. J. Hazard. Mater. 2020, 391, 122024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bai, W.; Zhu, C.; Liu, J.; Yan, M.; Yang, S.; Chen, A. AuNP-based colorimetric aptasensor for rapid detection of six organophosphorus pesticides. Environ. Toxicol. Chem. 2015, 34, 2244–2249. [Google Scholar] [CrossRef] [Scilit]
- Bala, R.; Sharma, R.K.; Wangoo, N. Development of gold nanoparticles-based aptasensor for the colorimetric detection of organophosphorus pesticide phorate. Anal. Bioanal. Chem. 2015, 408, 333–338. [Google Scholar] [CrossRef] [Scilit]
- Fahimi-Kashani, N.; Hormozi-Nezhad, M.R. Gold-Nanoparticle-Based Colorimetric Sensor Array for Discrimination of Organophosphate Pesticides. Anal. Chem. 2016, 88, 8099–8106. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Wang, L.; Shen, G.; Zhang, D.; Xie, J.; Mamut, A.; Huang, W.; Zhou, S. Colorimetric determination of ofloxacin using unmodified aptamers and the aggregation of gold nanoparticles. Microchim. Acta 2018, 185, 355. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Gao, S.; Sun, S.; Yang, Y.; Zhang, Y.; Liu, J.; Dong, Y.; Su, H.; Tan, T. A molecular recognition assisted colorimetric aptasensor for tetracycline. RSC Adv. 2016, 6, 45645–45651. [Google Scholar] [CrossRef] [Scilit]
- Luo, Y.; Xu, J.; Li, Y.; Gao, H.; Guo, J.; Shen, F.; Sun, C. A novel colorimetric aptasensor using cysteamine-stabilized gold nanoparticles as probe for rapid and specific detection of tetracycline in raw milk. Food Control 2015, 54, 7–15. [Google Scholar] [CrossRef] [Scilit]
- Lavaee, P.; Danesh, N.M.; Ramezani, M.; Abnous, K.; Taghdisi, S.M. Colorimetric aptamer based assay for the determination of fluoroquinolones by triggering the reduction-catalyzing activity of gold nanoparticles. Microchim. Acta 2017, 184, 2039–2045. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Tian, Y.; Huang, P.; Wu, F.-Y. Using target-specific aptamers to enhance the peroxidase-like activity of gold nanoclusters for colorimetric detection of tetracycline antibiotics. Talanta 2020, 208, 120342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, R.; Tao, Q.; Bian, X.J.; Zhu, F.L.; Yan, J. Aptasensor based on hybrid chain reaction for colorimetric detection of kanamycin. Chin. J. Anal. Chem. 2020, 48, 608–614. [Google Scholar]
- Tian, R.; Ji, J.; Zhou, Y.; Du, Y.; Bian, X.; Zhu, F.; Liu, G.; Deng, S.; Wan, Y.; Yan, J. Terminal-conjugated non-aggregated constraints of gold nanoparticles on lateral flow strips for mobile phone readouts of enrofloxacin. Biosens. Bioelectron. 2020, 160, 112218. [Google Scholar] [CrossRef] [Scilit]
- Du, Y.; Zhou, Y.; Wen, Y.; Bian, X.; Xie, Y.; Zhang, W.; Liu, G.; Yan, J. Multiplexed aptasensing of food contaminants by using terminal deoxynucleotidyl transferase-produced primer-triggered rolling circle amplification: Application to the colorimetric determination of enrofloxacin, lead (II), Escherichia coli O157:H7 and tropomyosin. Microchim. Acta 2019, 186, 840. [Google Scholar]
- Wang, R.; Zhang, Q.; Zhang, Y.; Shi, H.; Nguyen, K.T.; Zhou, X. Unconventional Split Aptamers Cleaved at Functionally Essential Sites Preserve Biorecognition Capability. Anal. Chem. 2019, 91, 15811–15817. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Li, Y.; Wang, W.; Lu, Z.; Han, H.; Liu, J. Kanamycin adsorption on gold nanoparticles dominates its label-free colorimetric sensing with its aptamer. Langmuir 2020, 36, 11490–11498. [Google Scholar] [CrossRef] [Scilit]
- Babaei, M.; Jalalian, S.H.; Bakhtiari, H.; Ramezani, M.; Abnous, K.; Taghdisi, S.M. Aptamer-based fluorescent switch for sensitive detection of oxytetracycline. Aust. J. Chem. 2017, 70, 718–723. [Google Scholar] [CrossRef] [Scilit]
- Zhao, J.X.; Wu, X.; Chen, J. A reversible fFluorescent logic gate for sensing mercury and iodide ions based on a molecular beacon. Analyst 2013, 138, 5281–5287. [Google Scholar]
- Bellassai, N.; D’Agata, R.; Spoto, G. Novel nucleic acid origami structures and conventional molecular beacon-based platforms: A comparison in biosensing applications. Anal. Bioanal. Chem. 2021, 413, 6063–6077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Tang, X.; Chen, X.; Qu, B.; Lu, L. Label-free and enzyme-free fluorescent isocarbophos aptasensor based on MWCNTs and G-quadruplex. Talanta 2018, 188, 232–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Zhang, H.; Aldalbahi, A.; Zuo, X.; Fan, C.; Mi, X. Fluorescent biosensors enabled by graphene and graphene oxide. Biosens. Bioelectron. 2017, 89, 96–106. [Google Scholar] [CrossRef] [Scilit]
- Zhao, H.; Gao, S.; Liu, M.; Chang, Y.; Fan, X.; Quan, X. Fluorescent assay for oxytetracycline based on a long-chain aptamer assembled onto reduced graphene oxide. Microchim. Acta 2013, 180, 829–835. [Google Scholar] [CrossRef] [Scilit]
- Dong, S.J.; Hu, P.; Jin, L.H.; Zhu, C.Z. A simple and sensitive fluorescent sensing platform for Hg2+ ions assay based on G-quenching. Talanta 2011, 85, 713–717. [Google Scholar]
- Ma, H.; Li, W.; Zhou, W.; Liu, J. Site-Selective Labeling of Chromium(III) as a Quencher on DNA for Molecular Beacons. ChemPlusChem 2017, 82, 1224–1230. [Google Scholar] [CrossRef] [Scilit]
- Verdian-Doghaei, A.; Housaindokht, M.R.; Abnous, K. A fluorescent aptasensor for potassium ion detection-based triple-helix molecular switch. Anal. Biochem. 2014, 466, 72–75. [Google Scholar] [CrossRef] [Scilit]
- Chen, T.X.; Ning, F.; Liu, H.S.; Wu, K.F.; Li, W.; Ma, C.B. Label-free fluorescent strategy for sensitive detection of tetracycline based on triple-helix molecular switch and G-quadruplex. Chin. Chem. Lett. 2017, 28, 1380–1384. [Google Scholar] [CrossRef] [Scilit]
- Taghdisi, S.M.; Danesh, N.M.; Nameghi, M.A.; Ramezani, M.; Abnous, K. A label-free fluorescent aptasensor for selective and sensitive detection of streptomycin in milk and blood serum. Food Chem. 2016, 203, 145–149. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.; Li, H.; Qiao, S.; Huang, C.; Liu, Q.; Shen, X.; Geng, Y.; Xu, W.; Sun, C. A simple and rapid sensing strategy based on structure-switching signaling aptamers for the sensitive detection of chloramphenicol. Food Chem. 2020, 302, 125359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jalalian, S.H.; Taghdisi, S.M.; Danesh, N.M.; Bakhtiari, H.; Lavaee, P.; Ramezani, M.; Abnous, K. Sensitive and fast detection of tetracycline using an aptasensor. Anal. Methods 2015, 7, 2523–2528. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.; Bie, J.; Zhang, X.; Yan, C.; Li, H.; Zhang, M.; Su, R.; Zhang, X.; Sun, C. A label-free aptasensor for the detection of tetracycline based on the luminescence of SYBR Green I. Spectrochim. Acta Mol. Biomol. Spectrosc. 2018, 202, 382–388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, L.; Sun, N.; Tu, C.; Zhang, Q.; Diao, A. Design of an aptamer-based fluorescence displacement biosensor for selective and sensitive detection of kanamycin in aqueous samples. RSC Adv. 2017, 7, 38512–38518. [Google Scholar] [CrossRef] [Scilit]
- Hosseini, M.; Mehrabi, F.; Ganjali, M.R.; Norouzi, P. A fluorescent aptasensor for sensitive analysis oxytetracycline based on silver nanoclusters. Luminescence 2016, 31, 1339–1343. [Google Scholar] [CrossRef] [Scilit]
- Yi, H.; Yan, Z.; Wang, L.; Zhou, X.; Yan, R.; Zhang, D.; Shen, G.; Zhou, S. Fluorometric determination for ofloxacin by using an aptamer and SYBR Green I. Microchim. Acta 2019, 186, 668. [Google Scholar] [CrossRef] [Scilit]
- Belal, A.S.F.; Ismail, A.; Elnaggar, M.M.; Belal, T.S. Click chemistry inspired copper sulphide nanoparticle-based fluorescence assay of kanamycin using DNA aptamer. Spectrochim. Acta Mol. Biomol. Spectros. 2018, 205, 48–54. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Su, L.; Zhu, L.; Gao, X.; Wang, Y.; Bai, F.; Tang, Y.; Li, J. Hybrid material for enrofloxacin sensing based on aptamer-functionalized magnetic nanoparticle conjugated with upconversion nanoprobes. Sens. Actuators B Chem. 2016, 233, 394–401. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Ren, J.; Su, L.; Gao, X.; Tang, Y.; Ma, T.; Zhu, L.; Li, J. Novel hybrid probe based on double recognition of aptamer-molecularly imprinted polymer grafted on upconversion nanoparticles for enrofloxacin sensing. Biosens. Bioelectron. 2017, 87, 203–208. [Google Scholar] [CrossRef] [Scilit]



| Targets | Aptamer Sequences | Length (Bases) | Kd * (nM) | Refs. |
|---|---|---|---|---|
| Kanamycin A | GGGACTTGGTTTAGGTAATGAGTCCC | 26 | / | [43] |
| TGGGGGTTGAGGCTAAGCCGA | 21 | 78.8 | [44] | |
| Kanamycin B | TGGGGGTTGAGGCTAAGCCGA | 21 | 84.5 | [45] |
| Tetracycline | CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG | 76 | 70.7 | [46] |
| UUCACUGCUGCUUAAAGCCUAAAACAUACCAGAUCGCCACCCGCGCUUUAAUCUGGAGAGGUGAAGAAUUCGAC | 74 | 1000 | [47] | |
| Oxytetracycline | GGAATTCGCTAGCACGTTGACGCTGGTGCCCGGTTGTGGTGCGAGTGTTGTGTGGATCCGAGCTCCACGTG | 71 | 9.61 | [48] |
| Tetracycline; Oxytetracycline; Doxycycline; Chlortetracycline | CGGTGGTG | 8 | 1.067 | [49] |
| Chlortetracycline | CGGTGGTGTTTTTTTTTTTTTTTT | 24 | / | [50] |
| GGGAUCAUCACAGUGAAAAAAGAUCACACUGAAAAAAGAUCCC | 43 | 2100 | [51] | |
| Tobramycin | TGGGGGTTGAGGCTAAGCCGA | 21 | 103 | [45] |
| GATAATACGACTCACTATAGGAATGGATCCACATCTACGAACCTGTTATGTTTGAGAGAGGGTAGTCAATAGTGTTATGCCCGCTTCCCCCCTTTGGGGGTTCACTGCAGACTTGACGAAGCTT | 124 | 150 | [52] | |
| CGTCGACGGATCCATGGCACGTTACAGGTCGACG | 34 | 56.8 | [28] | |
| Chloramphenicol | ACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGTAG | 40 | 800 | [53] |
| Streptomycin | TAGGGAATTCGTCGACGGATCCGGGGTCTGGTGTTCTGCTTTGTTCTGTCGGGTCGTCTGCAGGTCGACGCATGCGCCG | 79 | 199.1 | [54] |
| CCCGTTTAAAGTAGTTGAGAGTATTCCGTTTCTTTGTGTC | 40 | 6.07 | [55] | |
| GCGCGCCCTAGGTACGATCGCGC | 23 | 132.3 | [56] | |
| Penicillin G | CTGAATTGGATCTCTCTTCTTGAGCGATCTCCACA | 35 | / | [57] |
| GGGAGGACGAAGCGGAACGAGATGTAGATGAGGCTCGATCCGAATGCGTGACGTCTATCGGAATACTCGTTTTTACGCCTCAGAAGACACGCCCGACA | 98 | / | [58] | |
| CACCAGTCAGACAGCACGGTGACTGGAGTGACGTCGGTACCTGAGATCGAGTGACGTCGGTACCTG | 66 | 105.15 | [59] | |
| Ampicillin | CACGGCATGGTGGGCGTCGTG | 21 | 9.4 | [60] |
| GCGGGCGGTTGTATAGCGG | 20 | 13.4 | [61] | |
| TTAGTTGGGGTTCAGTTGG | 19 | 9.8 | [60] | |
| Benzylpenicillin | GGGTCTGAGGAGTGCGCGGTGCCAGTGAGT | 30 | 384.3 | [62] |
| amoxicillin | TTAGTTGGGGTTCAGTTGG | 19 | / | [63] |
| Danofloxacin | UCAGGCUCCUGUGAAGCAACCGAAUGGACUGA | 32 | 1.81 | [38] |
| Lomefloxacin | GACAGGCAGGACACCGTAACGGGTAGCCTCGCGACTCTTGAAGTTAATAGCCGGTGGTCCCTGGTACCTCCCTCCTCTTC | 80 | 17.57 | [39] |
| Ofloxacin | TGGCGCTTAGGTGTAATAACCTGAGGACGGCTTGG | 35 | 130.1 | [40] |
| Enrofloxacin | CCCATCAGGGGGCTAGGCTAACAGGTTCGGCTCTCTGAGCCCGGGTTATTTCAGGGGGA | 59 | 188 | [64] |
| GCTGTGTGACTCCTGCAAGTCCGACATACCTTAGTGCCCTGATATAATGTAACACTATTGAGCAGCTGTATCTTGTCTCC | 80 | 14.19 | [65] | |
| Ciprofloxacin | ATACCAGCTTATTCAATTCGATGGTAAGTGAGGTTCGTCCCTTTAATAAACTCGATTAGGATCTCGTGAGGTGTGCTCTACAATCGTAATCAGTTAG | 97 | / | [66] |
| Mapofloxacin; Pefloxacin; Ciprofloxacin; Ofloxacin; Levofloxacin; Deoxyfloxacin; Enrofloxacin; Moxifloxacin | ATACCAGCTTATTCAATTAGTTGTGTATTGAGGTTTGATCTAGGCATAGTCAACAGAGCACGATCGATCTGGCTTGTTCTACAATCGTAATCAGTTAG | 99 | 0.11 ** | [66] |
| Salfloxacin | CTCCGTGCGATCGCCGGGGACCGAAGAATCGTTCACATCG | 40 | 48.08 | [67] |
| Lincomycin | CGCGTGATGTGGTCGATGCGATACGGTGAGTCGCGCCACGGCTACACACGTCTCAGCGA | 59 | / | [68] |
| Azlocillin | CAGGAAGACAACTCCGACTAGAATTGATAATCAAGAATTCGTCTGGGGGGAATGTGCG | 58 | 55 | [69] |
| Neomycin | GGACUGGGCGAGAAGUUUAGUCC | 23 | 115 | [70] |
| Strategy/Recognition Element | Analyte | Detection Limit | Ref. | |
|---|---|---|---|---|
| (nM) | (ug/L) | |||
| Aptamer/silver sulfide/polydopamine/titanium dioxide nanotube/Ti sheet | ofloxacin | 7.5 × 10−4 | 2.7 × 10−4 | [47] |
| GCE/graphene(GR)/silver nanocluster/aptamer | chloramphenicol | 3 × 10−4 | 9.7 × 10−5 | [71] |
| SP carbon electrode/aminobenzoic acid | kanamycin | 0.23 | 0.11 | [72] |
| GCE/ Bi-BiOI@C/aptamer | chloramphenicol | 0.79 | 0.255 | [73] |
| Microfluidic double-channel sensor/tosylate doped poly(3,4-ethylenedioxythiophene) and the hydroxyl methyl derivative film | penicillin G | 0.1 | 0.035 | [74] |
| GCE/gold nanoparticles/aptamer | ofloxacin | 1 | 0.36 | [75] |
| Gold electrode/methyl blue (MB)-labeled aptamer | enrofloxacin | 0.1 | 0.036 | [27] |
| Enzyme-assisted dual-signal amplification | tobramycin | 5.13 | 2.40 | [76] |
| Target-aptamer binding triggered multiple recycling amplification | kanamycin | 1.3 × 10−6 | 6.3×107 | [77] |
| GCE/PAMAM–Au/GO–PANI/KAb | kanamycin | 9.48 × 103 | 4.60 × 10−4 | [79] |
| Zinc oxide–gold nanoparticles/reduced graphene oxide composite /dopamine/aptamer–amoxicillin film | amoxicillin | 3.3 × 10−6 | 1.2 × 10−6 | [80] |
| Gold electrode/Py-M-COF/aptamer | ampicillin | 1.2 × 10−5 | 4.2 × 10−16 | [85] |
| Magnetic hollow porous nano-tracers coupling nucleases-assisted cascade target recycling methods | chloramphenicol | 0.46 | 0.15 | [86] |
| tetracycline | 0.22 | 0.098 | ||
| Aptamer/Ru(bpy)3]2+@Ce-UiO-66/Mn:Bi2S3 | ofloxacin | 6 × 10−3 | 2.17 × 10−3 | [87] |
| Aptamer/Bi/CV-PCN/ITO | enrofloxacin | 9.18 × 10−6 | 1.6 × 10−6 | [88] |
| Aptamer/TiO2/g-C3N4@AuNPs/GCE | amoxicillin | 0.2 | 0.073 | [89] |
| Strategy/Recognition Element | Analyte | Detection Limit | Ref. | |
|---|---|---|---|---|
| (nM) | (ug/L) | |||
| Hairpin aptamer DNA/Enzyme-cutting signal amplification | kanamycin | 0.00041 | 0.0002 | [28] |
| Aptamer–AuNPs/NaCl | ofloxacin | 3.4 | 1.23 | [93] |
| Aptamer–AuNPs/NaCl | tetracycline | 26.9 | 11.96 | [94] |
| Aptamer/cysteine-stabilized AuNPs | tetracycline | 87.8 | 39.02 | [95] |
| Nitrophenol–NaBH4 /AuNPs | ciprofloxacin | 1.2 | 0.40 | [96] |
| gold nanocluster–ligand–TMB | tetracycline | 46 | 20.44 | [97] |
| Aldehyde-functionalized MB and DNA hybridization chain reaction signal amplification | kanamycin | 0.9 | 0.44 | [98] |
| Paper strips/split aptamer (SPA) | enrofloxacin | 0.28 | 0.10 | [99] |
| Magnetic bead/split aptamer (SPA) | enrofloxacin | 0.00695 | 0.0025 | [100] |
| Microplate plate/HRP–split aptamer (SPA) | tilmicosin | 1000 | 869.2 | [101] |
| Citrate-capped AuNPs/aptamer | kanamycin | 90 | 43.6 | [102] |
| Strategy/Recognition Element | Analyte | Detection Limit | Ref. | |
|---|---|---|---|---|
| (nM) | (ug/L) | |||
| Triple-helix molecular switch/hairpin aptamer/FAM-BHQ1 | oxytetracycline | 1067 | 491.28 | [103] |
| Triple-helix molecular switch and G-quadruplex | tetracycline | 0.97 | 0.43 | [112] |
| Aptamer/aptamer complementary chain (ds-DNA)-SYBR Gold-exonuclease III | streptomycin | 5.45 | 3.17 | [113] |
| Aptamer/aptamer complementary chain (ds-DNA) labeled BHQ1 and FAM | chloramphenicol | 2.16 | 0.70 | [114] |
| Triple-helix molecular switch/FAM-BHQ1 | tetracycline | 2.09 | 0.93 | [115] |
| G-quadruplex aptamer/SYBR I | tetracycline | 225 | 100.0 | [116] |
| G-quadruplex aptamer/ThT | kanamycin | 0.3 | 0.15 | [117] |
| Aptamer extending C-rich DNA sequence/silver nanoclusters | tetracycline | 0.1 | 0.04 | [118] |
| Aptamer–nanogold–SYBR Green I | ofloxacin | 0.34 | 0.12 | [119] |
| Aptamer/ferromagnetic nanoparticles/CuS nanoparticles | kanamycin | 0.026 | 0.01 | [120] |
| Aptamer-modified MB/up-converting fluorescent materials | enrofloxacin | 0.17 | 0.06 | [121] |
| Molecularly imprinting and biotinylated enrofloxacin aptamers | enrofloxacin | 0.12 | 0.04 | [122] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liang, G.; Song, L.; Gao, Y.; Wu, K.; Guo, R.; Chen, R.; Zhen, J.; Pan, L. Aptamer Sensors for the Detection of Antibiotic Residues— A Mini-Review. Toxics 2023, 11, 513. https://doi.org/10.3390/toxics11060513
Liang G, Song L, Gao Y, Wu K, Guo R, Chen R, Zhen J, Pan L. Aptamer Sensors for the Detection of Antibiotic Residues— A Mini-Review. Toxics. 2023; 11(6):513. https://doi.org/10.3390/toxics11060513
Chicago/Turabian StyleLiang, Gang, Le Song, Yufei Gao, Kailong Wu, Rui Guo, Ruichun Chen, Jianhui Zhen, and Ligang Pan. 2023. "Aptamer Sensors for the Detection of Antibiotic Residues— A Mini-Review" Toxics 11, no. 6: 513. https://doi.org/10.3390/toxics11060513
APA StyleLiang, G., Song, L., Gao, Y., Wu, K., Guo, R., Chen, R., Zhen, J., & Pan, L. (2023). Aptamer Sensors for the Detection of Antibiotic Residues— A Mini-Review. Toxics, 11(6), 513. https://doi.org/10.3390/toxics11060513

