Differential Expression of AhR in Peripheral Mononuclear Cells in Response to Exposure to Polycyclic Aromatic Hydrocarbons in Mexican Women
Abstract
1. Introduction
2. Materials and Methods
2.1. Population
2.2. Urine Collection
2.3. Determination of Urinary 1-OHP
2.4. Peripheral Blood Mononuclear Cells (PBMCs) Isolation
2.5. RNA Isolation and RT-qPCR
| Genes | Forward sequence (5′-3′) | Reverse sequence (5′-3′) | Weight of the amplicon | Tm °C | Number of Cycles |
| 18s | CGGCTACCACATCCAAGGAA | GCTGGAATTACCGCGGCT | 189 pb | 60 | 40 |
| TNFα | CCCACGGCTCCACCCTCTCT | TCTGGGGGCCGATCACTCCA | 215 pb | 67.5 | 40 |
| AhR | TCATTTGCTGGAGGTCACCC | GCCAAGGACTGTTGCTGTTG | 254 pb | 60 | 40 |
| CyP1B1 | TAGTGGTGCTGAATGGCGAG | CTCCGAGTAGTGGCCGAAAG | 137 pb | 66.5 | 40 |
2.6. miRNA Expression
2.7. Statistical Analysis
3. Results
3.1. 1-OHP Determination in Urine Samples
3.2. Determination and Correlation of AhR, CYP1B1 and TNF-α Expression by RT-qPCR
3.3. Evaluation of miR-125b and miR-155 Relative Expression in a Population Exposed to PAHs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- ADSTR. Toxicological Profile for Polycyclic Aromatic Hydrocarbons. U.S. Department of Health and Human Services Public Health Service. Agency for Toxic Substances and Disease Registry. 1995. Available online: https://www.atsdr.cdc.gov/toxprofiles/tp69.pdf (accessed on 11 November 2022).
- U.S. EPA. IRIS Toxicological Review of Benzo[A]Pyrene (Final Report); U.S. Environmental Protection Agency: Washington, DC, USA, 2017. [Google Scholar]
- Dasari, S.; Ganjayi, M.S.; Yellanurkonda, P.; Basha, S.; Meriga, B. Role of glutathione S-transferases in detoxification of a polycyclic aromatic hydrocarbon, methylcholanthrene. Chem. Biol. Interact. 2018, 294, 81–90. [Google Scholar] [CrossRef] [Scilit]
- Thuy, H.T.T.; Loan, T.T.C.; Phuong, T.H. The potential accumulation of polycyclic aromatic hydrocarbons in phytoplankton and bivalves in Can Gio coastal wetland, Vietnam. Environ. Sci. Pollut. Res. Int. 2018, 25, 17240–17249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neavin, D.R.; Liu, D.; Ray, B.; Weinshilboum, R.M. The Role of the Aryl Hydrocarbon Receptor (AHR) in Immune and Inflammatory Diseases. Int. J. Mol. Sci. 2018, 19, 3851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kobayashi, S.; Okamoto, H.; Iwamoto, T.; Toyama, Y.; Tomatsu, T.; Yamanaka, H.; Momohara, S. A role for the aryl hydrocarbon receptor and the dioxin TCDD in rheumatoid arthritis. Rheumatology 2008, 47, 1317–1322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perumal Vijayaraman, K.; Muruganantham, S.; Subramanian, M.; Shunmugiah, K.P.; Kasi, P.D. Silymarin attenuates benzo(a)pyrene induced toxicity by mitigating ROS production, DNA damage and calcium mediated apoptosis in peripheral blood mononuclear cells (PBMC). Ecotoxicol. Environ. Saf. 2012, 86, 79–85. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamaki, A.; Hayashi, H.; Nakajima, H.; Takii, T.; Katagiri, D.; Miyazawa, K.; Hirose, K.; Onozaki, K. Polycyclic aromatic hydrocarbon increases mRNA level for interleukin 1 beta in human fibroblast-like synoviocyte line via aryl hydrocarbon receptor. Biol. Pharm. Bull. 2004, 27, 407–410. [Google Scholar] [CrossRef] [Scilit]
- Waddington, C.H. The epigenotype. 1942. Int. J. Epidemiol. 2012, 41, 10–13. [Google Scholar] [CrossRef] [Scilit]
- Guo, H.; Ingolia, N.T.; Weissman, J.S.; Bartel, D.P. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 2010, 466, 835–840. [Google Scholar] [CrossRef] [Scilit]
- Lizarraga, D.; Gaj, S.; Brauers, K.J.; Timmermans, L.; Kleinjans, J.C.; van Delft, J.H. Benzo[a]pyrene-induced changes in microRNA-mRNA networks. Chem. Res. Toxicol. 2012, 25, 838–849. [Google Scholar] [CrossRef] [Scilit]
- Jacob, J.; Seidel, A. Biomonitoring of polycyclic aromatic hydrocarbons in human urine. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2002, 778, 31–47. [Google Scholar] [CrossRef] [Scilit]
- Jongeneelen, F.J. Benchmark guideline for urinary 1-hydroxypyrene as biomarker of occupational exposure to polycyclic aromatic hydrocarbons. Ann. Occup. Hyg. 2001, 45, 3–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuusimaki, L.; Peltonen, Y.; Mutanen, P.; Peltonen, K.; Savela, K. Urinary hydroxy-metabolites of naphthalene, phenanthrene and pyrene as markers of exposure to diesel exhaust. Int. Arch. Occup. Environ. Health 2004, 77, 23–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Narayanan, S.; Appleton, H.D. Creatinine: A review. Clin. Chem. 1980, 26, 1119–1126. [Google Scholar] [CrossRef] [Scilit]
- Perez-Maldonado, I.N.; Martinez-Salinas, R.I.; Pruneda Alvarez, L.G.; Perez-Vazquez, F.J. Urinary 1-hydroxypyrene concentration from Mexican children living in the southeastern region in Mexico. Int. J. Environ. Health Res. 2014, 24, 113–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perez-Maldonado, I.N.; Ochoa-Martinez, A.C.; Orta-Garcia, S.T.; Ruiz-Vera, T.; Varela-Silva, J.A. Concentrations of Environmental Chemicals in Urine and Blood Samples of Children from San Luis Potosi, Mexico. Bull. Environ. Contam Toxicol. 2017, 99, 258–263. [Google Scholar] [CrossRef] [Scilit]
- Polanska, K.; Hanke, W.; Dettbarn, G.; Sobala, W.; Gromadzinska, J.; Magnus, P.; Seidel, A. The determination of polycyclic aromatic hydrocarbons in the urine of non-smoking Polish pregnant women. Sci. Total Environ. 2014, 487, 102–109. [Google Scholar] [CrossRef] [Scilit]
- Pruneda-Alvarez, L.G.; Perez-Vazquez, F.J.; Ruiz-Vera, T.; Ochoa-Martinez, A.C.; Orta-Garcia, S.T.; Jimenez-Avalos, J.A.; Perez-Maldonado, I.N. Urinary 1-hydroxypyrene concentration as an exposure biomarker to polycyclic aromatic hydrocarbons (PAHs) in Mexican women from different hot spot scenarios and health risk assessment. Environ. Sci. Pollut. Res. Int. 2016, 23, 6816–6825. [Google Scholar] [CrossRef] [Scilit]
- Ruiz-Vera, T.; Pruneda-Alvarez, L.G.; Ochoa-Martinez, A.C.; Ramirez-GarciaLuna, J.L.; Pierdant-Perez, M.; Gordillo-Moscoso, A.A.; Perez-Vazquez, F.J.; Perez-Maldonado, I.N. Assessment of vascular function in Mexican women exposed to polycyclic aromatic hydrocarbons from wood smoke. Environ. Toxicol. Pharmacol. 2015, 40, 423–429. [Google Scholar] [CrossRef] [Scilit]
- Wilhelm, M.; Hardt, J.; Schulz, C.; Angerer, J.; Human Biomonitoring Commission of the German Federal Environment, A. New reference value and the background exposure for the PAH metabolites 1-hydroxypyrene and 1- and 2-naphthol in urine of the general population in Germany: Basis for validation of human biomonitoring data in environmental medicine. Int. J. Hyg. Environ. Health 2008, 211, 447–453. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.H.; Jahan, S.A.; Kabir, E.; Brown, R.J. A review of airborne polycyclic aromatic hydrocarbons (PAHs) and their human health effects. Environ. Int. 2013, 60, 71–80. [Google Scholar] [CrossRef] [Scilit]
- Pruneda-Alvarez, L.G.; Perez-Vazquez, F.J.; Salgado-Bustamante, M.; Martinez-Salinas, R.I.; Pelallo-Martinez, N.A.; Perez-Maldonado, I.N. Exposure to indoor air pollutants (polycyclic aromatic hydrocarbons, toluene, benzene) in Mexican indigenous women. Indoor Air 2012, 22, 140–147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alegria-Torres, J.A.; Diaz-Barriga, F.; Gandolfi, A.J.; Perez-Maldonado, I.N. Mechanisms of p,p′-DDE-induced apoptosis in human peripheral blood mononuclear cells. Toxicol. In Vitro 2009, 23, 1000–1006. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cardenas-Gonzalez, M.; Gaspar-Ramirez, O.; Perez-Vazquez, F.J.; Alegria-Torres, J.A.; Gonzalez-Amaro, R.; Perez-Maldonado, I.N. p,p′-DDE, a DDT metabolite, induces proinflammatory molecules in human peripheral blood mononuclear cells "in vitro". Exp. Toxicol. Pathol. 2013, 65, 661–665. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Umannova, L.; Zatloukalova, J.; Machala, M.; Krcmar, P.; Majkova, Z.; Hennig, B.; Kozubik, A.; Vondracek, J. Tumor necrosis factor-alpha modulates effects of aryl hydrocarbon receptor ligands on cell proliferation and expression of cytochrome P450 enzymes in rat liver "stem-like" cells. Toxicol. Sci. 2007, 99, 79–89. [Google Scholar] [CrossRef] [Scilit]
- Baird, W.M.; Hooven, L.A.; Mahadevan, B. Carcinogenic polycyclic aromatic hydrocarbon-DNA adducts and mechanism of action. Environ. Mol. Mutagen. 2005, 45, 106–114. [Google Scholar] [CrossRef] [Scilit]
- Brucker, N.; Moro, A.M.; Charao, M.F.; Durgante, J.; Freitas, F.; Baierle, M.; Nascimento, S.; Gauer, B.; Bulcao, R.P.; Bubols, G.B.; et al. Biomarkers of occupational exposure to air pollution, inflammation and oxidative damage in taxi drivers. Sci. Total Environ. 2013, 463–464, 884–893. [Google Scholar] [CrossRef] [Scilit]
- Vondracek, J.; Umannova, L.; Machala, M. Interactions of the aryl hydrocarbon receptor with inflammatory mediators: Beyond CYP1A regulation. Curr. Drug Metab. 2011, 12, 89–103. [Google Scholar] [CrossRef] [Scilit]
- Vogel, C.F.; Khan, E.M.; Leung, P.S.; Gershwin, M.E.; Chang, W.L.; Wu, D.; Haarmann-Stemmann, T.; Hoffmann, A.; Denison, M.S. Cross-talk between aryl hydrocarbon receptor and the inflammatory response: A role for nuclear factor-kappaB. J. Biol. Chem. 2014, 289, 1866–1875. [Google Scholar] [CrossRef] [Scilit]
- Prigent, L.; Robineau, M.; Jouneau, S.; Morzadec, C.; Louarn, L.; Vernhet, L.; Fardel, O.; Sparfel, L. The aryl hydrocarbon receptor is functionally upregulated early in the course of human T-cell activation. Eur. J. Immunol. 2014, 44, 1330–1340. [Google Scholar] [CrossRef] [Scilit]
- Schembri, F.; Sridhar, S.; Perdomo, C.; Gustafson, A.M.; Zhang, X.; Ergun, A.; Lu, J.; Liu, G.; Zhang, X.; Bowers, J.; et al. MicroRNAs as modulators of smoking-induced gene expression changes in human airway epithelium. Proc. Natl. Acad. Sci. USA 2009, 106, 2319–2324. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.; Wang, L.S.; Zhou, Y.H. Elevated microRNA-125b promotes inflammation in rheumatoid arthritis by activation of NF-kappaB pathway. Biomed. Pharmacother. 2017, 93, 1151–1157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faraoni, I.; Antonetti, F.R.; Cardone, J.; Bonmassar, E. miR-155 gene: A typical multifunctional microRNA. Biochim. Biophys. Acta 2009, 1792, 497–505. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Wu, B.Q.; Wang, Y.H.; Shi, Y.F.; Luo, J.M.; Ba, J.H.; Liu, H.; Zhang, T.T. Regulatory effects of miR-155 and miR-146a on repolarization and inflammatory cytokine secretion in human alveolar macrophages in vitro. Immunopharmacol. Immunotoxicol. 2016, 38, 502–509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Umannova, L.; Machala, M.; Topinka, J.; Novakova, Z.; Milcova, A.; Kozubik, A.; Vondracek, J. Tumor necrosis factor-alpha potentiates genotoxic effects of benzo[a]pyrene in rat liver epithelial cells through upregulation of cytochrome P450 1B1 expression. Mutat. Res. 2008, 640, 162–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Umannova, L.; Machala, M.; Topinka, J.; Schmuczerova, J.; Krcmar, P.; Neca, J.; Sujanova, K.; Kozubik, A.; Vondracek, J. Benzo[a]pyrene and tumor necrosis factor-alpha coordinately increase genotoxic damage and the production of proinflammatory mediators in alveolar epithelial type II cells. Toxicol. Lett. 2011, 206, 121–129. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Units | Mean | SD | PC25 | PC50 | PC75 | PC95 | Min | Max |
|---|---|---|---|---|---|---|---|---|
| μg/g creatinine | 1.46 | 2.11 | 0.84 | 1.47 | 2.76 | 7.10 | ˂LOD | 10.87 |
| µg/L of urine | 1.09 | 1.68 | 0.61 | 0.96 | 2.10 | 6.08 | ˂LOD | 9.19 |
| p Value | Mean of Group A | Mean of Group B | |
|---|---|---|---|
| Age | 0.109067 | 38.8261 | 46.3529 |
| 1-OHP | 0.001267 | 0.848821 | 4.53468 |
| Glucose | 0.121731 | 92.8827 | 120.720 |
| Total cholesterol | 0.197449 | 165.233 | 181.997 |
| HDL cholesterol | 0.651043 | 46.2526 | 48.3669 |
| LDL cholesterol | 0.409356 | 94.2199 | 102.562 |
| VLDL cholesterol | 0.182865 | 25.3966 | 31.0680 |
| Triglycerides | 0.211349 | 126.983 | 153.343 |
| Height | 0.432416 | 1.46174 | 1.47686 |
| Waist diameter | 0.324131 | 85.4565 | 88.4571 |
| Hip diameter | 0.281592 | 97.9565 | 101.814 |
| Weight | 0.324085 | 55.5478 | 58.6314 |
| BMI | 0.508237 | 25.9577 | 26.7646 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Varela-Silva, J.A.; Martínez-Leija, M.E.; Orta-García, S.T.; Pérez-Maldonado, I.N.; López, J.A.; Hernández-López, H.; González-Amaro, R.; Calderón-Aranda, E.S.; Portales-Pérez, D.P.; Salgado-Bustamante, M. Differential Expression of AhR in Peripheral Mononuclear Cells in Response to Exposure to Polycyclic Aromatic Hydrocarbons in Mexican Women. Toxics 2023, 11, 28. https://doi.org/10.3390/toxics11010028
Varela-Silva JA, Martínez-Leija ME, Orta-García ST, Pérez-Maldonado IN, López JA, Hernández-López H, González-Amaro R, Calderón-Aranda ES, Portales-Pérez DP, Salgado-Bustamante M. Differential Expression of AhR in Peripheral Mononuclear Cells in Response to Exposure to Polycyclic Aromatic Hydrocarbons in Mexican Women. Toxics. 2023; 11(1):28. https://doi.org/10.3390/toxics11010028
Chicago/Turabian StyleVarela-Silva, José Antonio, Miguel Ernesto Martínez-Leija, Sandra Teresa Orta-García, Ivan Nelinho Pérez-Maldonado, Jesús Adrián López, Hiram Hernández-López, Roberto González-Amaro, Emma S. Calderón-Aranda, Diana Patricia Portales-Pérez, and Mariana Salgado-Bustamante. 2023. "Differential Expression of AhR in Peripheral Mononuclear Cells in Response to Exposure to Polycyclic Aromatic Hydrocarbons in Mexican Women" Toxics 11, no. 1: 28. https://doi.org/10.3390/toxics11010028
APA StyleVarela-Silva, J. A., Martínez-Leija, M. E., Orta-García, S. T., Pérez-Maldonado, I. N., López, J. A., Hernández-López, H., González-Amaro, R., Calderón-Aranda, E. S., Portales-Pérez, D. P., & Salgado-Bustamante, M. (2023). Differential Expression of AhR in Peripheral Mononuclear Cells in Response to Exposure to Polycyclic Aromatic Hydrocarbons in Mexican Women. Toxics, 11(1), 28. https://doi.org/10.3390/toxics11010028

