Development of a Real-Time PCR Assay for the Detection of Donkey (Equus asinus) Meat in Meat Mixtures Treated under Different Processing Conditions
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Samples and Binary Meat Mixtures
2.2. DNA Extraction
2.3. Primer and Probe Design
2.4. Conventional PCR Reaction
2.5. Real-Time PCR Reaction
2.6. Specificity and Sensitivity of Real-Time PCR
3. Results and Discussions
3.1. Specificity
3.2. Sensitivity of the Donkey-Specific Real-Time PCR Assay
3.3. Application of the Real-Time PCR Assay to Meat Mixtures Treated under Different Processing Conditions
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Chen, A.; Wei, C.; Chen, G.; Zhao, Y.; Yang, S. Duplex PCR approach for the detection and quantification of donkey, horse and mule in raw and heat-processed meat products. Int. J. Food Sci. Technol. 2015, 50, 834–839. [Google Scholar] [CrossRef]
- Mousavi, S.M.; Khaniki, G.J.; Eskandari, S.; Rabiei, M.; Samiee, S.M.; Mehdizadeh, M. Applicability of species-specific polymerase chain reaction for fraud identification in raw ground meat commercially sold in Iran. J. Food Compos. Anal. 2015, 40, 47–51. [Google Scholar] [CrossRef]
- Kim, K.H.; Lee, H.Y.; Kim, Y.S.; Kim, M.R.; Jung, Y.K.; Lee, J.H.; Chang, H.S.; Park, Y.C.; Kim, S.Y.; Choi, J.D.; et al. Development of species-specific PCR to determine the animal raw Material. J. Food Hyg. Saf. 2014, 29, 347–355. [Google Scholar] [CrossRef]
- Sul, S.Y.; Kim, M.J.; Kim, H.Y. Development of a direct loop-mediated isothermal amplification (LAMP) assay for rapid and simple on-site detection of chicken in processed meat products. Food Control 2019, 98, 194–199. [Google Scholar] [CrossRef]
- Herrero, B.; Vieites, J.M.; Espiñeira, M. Development of an in-house fast real-time PCR method for detection of fish allergen in foods and comparison with a commercial kit. Food Chem. 2014, 151, 415–420. [Google Scholar] [CrossRef] [PubMed]
- Pascoal, A.; Barros-Velazques, J.; Ortea, I.; Cepeda, A.; Gallardo, J.M.; Calo-Mata, P. Molecular identification of the black tiger shrimp (Penaeus monodon), the white leg shrimp (Litopenaeus vannamei) and the Indian white shrimp (Fenneropenaeus indicus) by PCR targeted to the 16S rRNA mtDNA. Food Chem. 2011, 125, 1457–1461. [Google Scholar] [CrossRef]
- Kim, M.J.; Kim, H.Y. Development of a fast duplex real-time PCR assay for simultaneous detection of chicken and pigeon in raw and heat-treated meats. Food Control 2018, 85, 1–5. [Google Scholar] [CrossRef]
- Eaqub Ali, M.; Hashim, U.; Sabar Dhahi, T.; Mustafa, S.; Che, Y.B.; Abdul Latif, M.M. Analysis of pork adulteration in commercial burgers targeting porcine-specific mitochondrial cytochrome B gene by TaqMan probe real-time polymerase chain reaction. Food Anal. Methods 2012, 5, 784–794. [Google Scholar]
- Kesmen, Z.; Yetiman, A.E.; Sain, F.; Yetim, H. Detection of chicken and turkey meat in meat mixtures by using real-time PCR assay. J. Food Sci. 2012, 77, 167–173. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, M.A.; García, T.; González, I.; Hernández, P.E.; Martín, R. TaqMan real-time PCR for detection and quantitation of pork in meat mixtures. Meat Sci. 2005, 70, 113–120. [Google Scholar] [CrossRef] [PubMed]
- Tanabe, S.; Hase, M.; Yano, T.; Sato, M.; Fujimura, T.; Akiyama, H. A real-time quantitative PCR detection method for pork, chicken, beef, mutton, and horseflesh in foods. Biosci. Biotechnol. Biochem. 2007, 71, 3131–3135. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.; Zhang, C. Detection of adulterated murine components in meat products by TaqMan real-time PCR. Food Chem. 2016, 192, 485–490. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Kumar, R.R.; Sharma, B.D.; Gokulakrishnan, P.; Mendiratta, S.K.; Sharma, D. Identification of species origin of meat and meat products on the DNA basis: A review. Crit. Rev. Food Sci. Nutr. 2015, 55, 1340–1351. [Google Scholar] [CrossRef] [PubMed]
- Girish, P.S.; Anjaneyulu, A.S.R.; Viswas, K.N.; Anand, M.; Rajkumar, N.; Shivakumar, B.M.; Bhaskar, S. Sequence analysis of mitochondrial 12S rRNA gene can identify meat species. Meat Sci. 2004, 66, 551–556. [Google Scholar] [CrossRef]
- Kim, S.Y.; Kim, M.J.; Jung, S.K.; Kim, H.Y. Development of a fast real-time PCR assay based on TaqMan probe for identification of edible rice grasshopper (Oxya chinensis) in processed food products. Food Res. Int. 2019, 116, 441–449. [Google Scholar] [CrossRef] [PubMed]
- Fajardo, V.; Gonzalez, I.; Rojas, M.; Garcia, T.; Martin, R. A review of current PCR-based methodologies for the authentication of meats from game animal species. Trends Food Sci. Technol. 2010, 21, 408–421. [Google Scholar] [CrossRef]
- Ali, M.E.; Amin, M.A.; Razzak, M.A.; Hamid, S.B.A.; Rahman, M.M.; Rashid, N.R.A.; Asing. Short Amplicon-Length PCR Assay Targeting Mitochondrial Cytochrome b Gene for the Detection of Feline Meats in Burger Formulation. Food Anal. Methods 2016, 9, 571–581. [Google Scholar] [CrossRef]
- Fajardo, V.; Gonzalez, I.; Martin, I.; Rojas, M.; Hernandez, P.E.; Garca, T.; Martin, R. Real-time PCR for quantitative detection of chamois (Rupicapra rupicapra) and Pyrenean ibex (Capra pyrenaica) in mea tmixtures. J. AOAC Int. 2008, 97, 103–111. [Google Scholar] [CrossRef] [Green Version]
- Kesmen, Z.; Güllüce, A.; Yilmaz, M.T.; Yetiman, A.E.; Yetim, H. TaqMan-based duplex real-time polymerase chain reaction approach for the detection and quantification of donkey and pork adulterations in raw and heat-processed meats. Int. J. Food Prop. 2014, 17, 629–638. [Google Scholar] [CrossRef]
Primer Name | Sequences (5′→3′) | Target Genes | Amplicon Size (bp) | Reference |
---|---|---|---|---|
Don3 F | CGCTCCATTCCCAACAAACTAGGTGGT | Cytochrome b | 99 | This study |
Don3 R | GCTTCGTTGTTTTGACATGTGTAGGGTA | |||
Don3 P | FAM-GCCCTTATCCTTTCCATCTTAATCC-TAMRA | |||
18SpEU-DIR | GGTAGTGACGAAAAATAACAATACAGGAC | 18S rRNA | 141 | [18] |
18SpEU-INV | ATACGCTATTGGAGCTGGAATTACC | |||
18S probe | FAM-AAGTGGACTCATTCCAATTACAGGGCCT-TAMRA |
Common Name | Scientific Name | Conventional PCR | Real-Time PCR | ||
---|---|---|---|---|---|
Donkey-Specific PCR | Eukaryotic PCR | Donkey-Specific PCR | Eukaryotic PCR | ||
Donkey | Equus asinus | + | + | + | + |
Horse | Equus caballus | − | + | − | + |
Beef | Bos taurus | − | + | − | + |
Lamb | Ovis aries | − | + | − | + |
Goat | Capra hircus | − | + | − | + |
Deer | Cervus elaphus | − | + | − | + |
Pork | Sus scrofa domestica | − | + | − | + |
Rabbit | Oryctolagus cuniculus | − | + | − | + |
Raccoon dog | Nyctereutes procyonoides | − | + | − | + |
Dog | Canis lupus familiaris | − | + | − | + |
Cat | Felis catus | − | + | − | + |
Siberian chipmunk | Tamias sibiricus | − | + | − | + |
Turkey | Meleagris gallopavo | − | + | − | + |
Ostrich | Struthio camelus | − | + | − | + |
Chicken | Gallus gallus | − | + | − | + |
Pheasant | Phasianus colchicus | − | + | − | + |
Duck | Anas platyrhynchos | − | + | − | + |
Goose | Anser anser | − | + | − | + |
Pigeon | Columba livia domestica | − | + | − | + |
Japanese quail | Coturnix japonica | − | + | − | + |
Target Species | Ratio of Donkey Meat in the Binary Meat Mixture (%) | Ct Values | ||||||
---|---|---|---|---|---|---|---|---|
Raw | Boiled | Roasted | Dried | Grinded | Fried | Autoclaved | ||
Donkey | 100 | 18.45 ± 0.70 a | 20.24 ± 0.97 | 18.74 ± 0.06 | 18.59 ± 0.31 | 19.17 ± 0.60 | 21.17 ± 0.55 | 20.86 ± 0.26 |
10 | 21.55 ± 0.52 | 23.34 ± 0.64 | 21.79 ± 0.08 | 21.27 ± 0.25 | 22.30 ± 0.57 | 24.01 ± 0.33 | 23.86 ± 0.21 | |
1 | 24.58 ± 0.47 | 26.4 ± 0.63 | 24.97 ± 0.0.8 | 24.35 ± 0.43 | 25.71 ± 0.10 | 27.31 ± 0.42 | 26.68 ± 0.30 | |
0.1 | 27.37 ± 1.03 | 29.15 ± 1.06 | 28.19 ± 0.07 | 27.47 ± 0.43 | 28.84 ± 0.10 | 30.61 ± 0.38 | 29.53 ± 0.19 | |
0.01 | 30.48 ± 1.03 | 32.11 ± 1.20 | 31.32 ± 0.05 | 30.63 ± 0.56 | 31.83 ± 0.43 | 33.71 ± 0.27 | 32.67 ± 0.08 | |
0.001 | 33.59 ± 1.08 | 34.89 ± 0.96 | 34.35 ± 0.07 | 33.57 ± 0.51 | 34.13 ± 0.51 | 36.72 ± 0.33 | 35.69 ± 0.17 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, M.-J.; Suh, S.-M.; Kim, S.-Y.; Qin, P.; Kim, H.-R.; Kim, H.-Y. Development of a Real-Time PCR Assay for the Detection of Donkey (Equus asinus) Meat in Meat Mixtures Treated under Different Processing Conditions. Foods 2020, 9, 130. https://doi.org/10.3390/foods9020130
Kim M-J, Suh S-M, Kim S-Y, Qin P, Kim H-R, Kim H-Y. Development of a Real-Time PCR Assay for the Detection of Donkey (Equus asinus) Meat in Meat Mixtures Treated under Different Processing Conditions. Foods. 2020; 9(2):130. https://doi.org/10.3390/foods9020130
Chicago/Turabian StyleKim, Mi-Ju, Seung-Man Suh, Sung-Yeon Kim, Pei Qin, Hong-Rae Kim, and Hae-Yeong Kim. 2020. "Development of a Real-Time PCR Assay for the Detection of Donkey (Equus asinus) Meat in Meat Mixtures Treated under Different Processing Conditions" Foods 9, no. 2: 130. https://doi.org/10.3390/foods9020130
APA StyleKim, M.-J., Suh, S.-M., Kim, S.-Y., Qin, P., Kim, H.-R., & Kim, H.-Y. (2020). Development of a Real-Time PCR Assay for the Detection of Donkey (Equus asinus) Meat in Meat Mixtures Treated under Different Processing Conditions. Foods, 9(2), 130. https://doi.org/10.3390/foods9020130