Carotenoid Biosynthesis in Oriental Melon (Cucumis melo L. var. makuwa)
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Isolation of cDNAs Encoding Carotenoid Biosynthetic Genes
2.3. Quantitative Real-Time PCR Analysis
2.4. Sequence Analysis
2.5. Carotenoid Extraction and HPLC Analysis
2.6. Statistical Analysis
3. Results
3.1. Sequence Analyses of Carotenoid Biosynthetic Genes from C. melo
3.2. Expression Levels of Carotenoid Biosynthetic Genes in Ohbokggul and Gotgam Chamoes
3.3. Analysis of Carotenoid Content in Ohbokggul and Gotgam Chamoes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Maynard, D.N.; Hochmuth, G.J. Knott’s Handbook for Vegetable Growers, 5th ed.; John Wiley & Sons: Hoboken, NJ, USA, 1980; pp. 1–621. [Google Scholar]
- Vouldoukis, I.; Lacan, D.; Kamate, C.; Coste, P.; Calenda, A.; Mazier, D.; Conti, M.; Dugas, B. Antioxidant and anti-inflammatory properties of a Cucumis melo LC. extract rich in superoxide dismutase activity. J. Ethnopharmacol. 2004, 94, 67–75. [Google Scholar] [CrossRef] [PubMed]
- Ismail, H.I.; Chan, K.W.; Mariod, A.A.; Ismail, M. Phenolic content and antioxidant activity of cantaloupe (Cucumis melo) methanolic extracts. Food Chem. 2010, 119, 643–647. [Google Scholar] [CrossRef]
- Choi, Y.-J.; Chun, H.; Choi, Y.; Yum, S.; Lee, S.; Kim, H.; Shin, Y.-S.; Chung, D.-S. Nutritional components content of oriental melon fruits cultivated under different greenhouse covering films. J. Bio-Environ. Control 2007, 16, 67–75. [Google Scholar]
- Shin, Y.-S.; Lee, J.-E.; Yeon, I.-K.; Do, H.-W.; Cheung, J.-D.; Kang, C.-K.; Choi, S.-Y.; Youn, S.-J.; Cho, J.-G.; Kwoen, D.-J. Antioxidant Effects and Tyrosinase Inhibition Activity of Oriental Melon (Cucumis melo L. var makuwa Makino) Extracts. J. Life Sci. 2008, 18, 963–967. [Google Scholar] [CrossRef]
- Kim, J.-H.; Suh, J.-K.; Kang, Y.-H. Anticancer effects of the extracts of oriental melon (Cucumis melo L. var makuwa Makino) seeds. Korean J. Plant Res. 2012, 25, 647–651. [Google Scholar] [CrossRef]
- Britton, G. Overview of carotenoid biosynthesis. Carotenoids 1998, 3, 13–147. [Google Scholar]
- Frank, H.A.; Cogdell, R.J. Carotenoids in photosynthesis. Photochem. Photobiol. 1996, 63, 257–264. [Google Scholar] [CrossRef] [PubMed]
- Calzarano, F.; Osti, F.; Baranek, M.; Di Marco, S. Rainfall and temperature influence expression of foliar symptoms of grapevine leaf stripe disease (esca complex) in vineyards. Phytopathologia Mediterranea 2018, 57, 488–505. [Google Scholar]
- Kyriacou, M.C.; Rouphael, Y. Towards a new definition of quality for fresh fruits and vegetables. Sci. Horticult. 2018, 234, 463–469. [Google Scholar] [CrossRef]
- Havaux, M. Carotenoids as membrane stabilizers in chloroplasts. Trends Plant Sci. 1998, 3, 147–151. [Google Scholar] [CrossRef]
- Ledford, H.K.; Niyogi, K.K. Singlet oxygen and photo-oxidative stress management in plants and algae. Plant Cell Environ. 2005, 28, 1037–1045. [Google Scholar] [CrossRef]
- Auldridge, M.E.; McCarty, D.R.; Klee, H.J. Plant carotenoid cleavage oxygenases and their apocarotenoid products. Curr. Opin. Plant Biol. 2006, 9, 315–321. [Google Scholar] [CrossRef] [PubMed]
- Ziegler, R.G. Vegetables, fruits, and carotenoids and the risk of cancer. Am. J. Clin. Nutr. 1991, 53, 251S–259S. [Google Scholar] [CrossRef] [PubMed]
- Gaziano, J.M.; Hennekens, C.H. The role of beta-carotene in the prevention of cardiovascular disease. Ann. N. Y. Acad. Sci. 1993, 691, 148–155. [Google Scholar] [CrossRef] [PubMed]
- Mayne, S.T. Beta-carotene, carotenoids, and disease prevention in humans. FASEB J. 1996, 10, 690–701. [Google Scholar] [CrossRef] [PubMed]
- Giovannucci, E. Tomatoes, tomato-based products, lycopene, and cancer: Review of the epidemiologic literature. J. Natl. Cancer Inst. 1999, 91, 317–331. [Google Scholar] [CrossRef] [PubMed]
- Fraser, P.D.; Bramley, P.M. The biosynthesis and nutritional uses of carotenoids. Prog. Lipid Res. 2004, 43, 228–265. [Google Scholar] [CrossRef]
- Mactier, H.; Weaver, L. Vitamin A and preterm infants: What we know, what we don’t know, and what we need to know. Arch. Dis. Child. Fetal Neonatal Ed. 2005, 90, F103–F108. [Google Scholar] [CrossRef]
- Villamor, E.; Fawzi, W.W. Vitamin A supplementation: Implications for morbidity and mortality in children. J. Infect. Dis. 2000, 182, S122–S133. [Google Scholar] [CrossRef]
- Thorne-Lyman, A.; Fawzi, W.W. Vitamin D during pregnancy and maternal, neonatal and infant health outcomes: A systematic review and meta-analysis. Paediatr. Perinat. Epidemiol. 2012, 26, 75–90. [Google Scholar] [CrossRef]
- Cunningham, F., Jr.; Gantt, E. Genes and enzymes of carotenoid biosynthesis in plants. Annu. Rev. Plant Biol. 1998, 49, 557–583. [Google Scholar] [CrossRef] [PubMed]
- Schwartz, S.H.; Tan, B.C.; Gage, D.A.; Zeevaart, J.A.; McCarty, D.R. Specific oxidative cleavage of carotenoids by VP14 of maize. Science 1997, 276, 1872–1874. [Google Scholar] [CrossRef] [PubMed]
- Park, C.H.; Chae, S.C.; Park, S.-Y.; Kim, J.K.; Kim, Y.J.; Chung, S.O.; Arasu, M.V.; Al-Dhabi, N.A.; Park, S.U. Anthocyanin and carotenoid contents in different cultivars of chrysanthemum (Dendranthema grandiflorum Ramat.) flower. Molecules 2015, 20, 11090–11102. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.-H.; Jiang, J.-G.; Yan, Y.; Chen, X.-W. Isolation and characterization of phytoene desaturase cDNA involved in the β-carotene biosynthetic pathway in Dunaliella salina. J. Agric. Food Chem. 2005, 53, 5593–5597. [Google Scholar] [CrossRef] [PubMed]
- Yan, P.; Gao, X.; Shen, W.; Zhou, P. Cloning and expression analysis of phytoene desaturase and ζ-carotene desaturase genes in Carica papaya. Mol. Biol. Rep. 2011, 38, 785–791. [Google Scholar] [CrossRef] [PubMed]
- Rossmann, M.G.; Moras, D.; Olsen, K.W. Chemical and biological evolution of a nucleotide-binding protein. Nature 1974, 250, 194–199. [Google Scholar] [CrossRef]
- Borchetia, S.; Bora, C.; Gohain, B.; Bhagawati, P.; Agarwala, N.; Bhattacharya, N.; Bharalee, R.; Bhorali, P.; Bandyopadhyay, T.; Gupta, S. Cloning and heterologous expression of a gene encoding lycopene-epsilon-cyclase, a precursor of lutein in tea (Camellia sinensis var assamica). Afr. J. Biotechnol. 2011, 10, 5934–5939. [Google Scholar]
- Bouvier, F.; Keller, Y.; d’Harlingue, A.; Camara, B. Xanthophyll biosynthesis: Molecular and functional characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L.). Biochim. Biophys. Acta 1998, 1391, 320–328. [Google Scholar] [CrossRef]
- Hieber, A.D.; Bugos, R.C.; Yamamoto, H.Y. Plant lipocalins: Violaxanthin de-epoxidase and zeaxanthin epoxidase. Biochim. Biophys. Acta 2000, 1482, 84–91. [Google Scholar] [CrossRef]
- Durocher, D.; Jackson, S.P. The FHA domain. FEBS Lett. 2002, 513, 58–66. [Google Scholar] [CrossRef]
- Rodríguez-Villalón, A.; Gas, E.; Rodríguez-Concepción, M. Phytoene synthase activity controls the biosynthesis of carotenoids and the supply of their metabolic precursors in dark-grown Arabidopsis seedlings. Plant J. 2009, 60, 424–435. [Google Scholar] [CrossRef] [PubMed]
- Toledo-Ortiz, G.; Huq, E.; Rodríguez-Concepción, M. Direct regulation of phytoene synthase gene expression and carotenoid biosynthesis by phytochrome-interacting factors. Proc. Natl. Acad. Sci. USA 2010, 107, 11626–11631. [Google Scholar] [CrossRef] [PubMed]
- Fraser, P.; Kiano, J.; Truesdale, M.; Schuch, W.; Bramley, P. Phytoene synthase-2 enzyme activity in tomato does not contribute to carotenoid synthesis in ripening fruit. Plant Mol. Biol. 1999, 40, 687–698. [Google Scholar] [CrossRef] [PubMed]


| Gene Name | Primer Sequence (5′ to 3′) | |
|---|---|---|
| Forward Primer | Reverse Primer | |
| CmPSY | TGTGCAGAGTATGCCAAGAC | GTCCGCCTACACCATACATAAA |
| CmPDS | GGCTGGAGAAGTGGAGTTATTG | CCTCAGCTTAAAGCCAGAATACA |
| CmZDS | ACACTCCAGACGCAGATTTC | GCAATGATCCCTGTCCTTCA |
| CmLCYB | GTTTCTTCCCGAGCTGTTACT | GAGTTCCCTTTGCCATGATTTC |
| CmLCYE | TGGTCCAGATCTGCCATTTAC | CCGGCCATACATGCTCTATAC |
| CmCHXB | GCTGTCATGGCGGTTTATTAC | GGCACCAACAGAGAGAGAAA |
| CmCHXE | AATCGTTGCACTTGCCATATTC | GCTCCAGTAGTCATCCCAATG |
| CmZEP | GTAGAAGAATACGGGTTGCTGTA | CCGAGTCCAACTCCCAAATAA |
| CmCCD1 | CATGATGAGACTCCTCCGATTAC | GATTTGGTCCCACCCTAACA |
| CmNCED | CAATCCTCTCTTCCAACCAACT | CTAGCGGAACCGTGATTGATAG |
| CmACT2 | CTACGAACTTCCTGATGGACAAG | CCAATGAGAGATGGCTGGAATAG |
| Carotenoids | Ohbokggul Chamoe | Gotgam Chamoe | ||||
|---|---|---|---|---|---|---|
| Peel | Pulp | Stalk | Peel | Pulp | Stalk | |
| α-carotene | N.D. | N.D. | N.D. | 2.54 ± 0.33 | 0.38 ± 0.01 | N.D. |
| Lutein | 0.45 ± 0.05 | 0.02 ± 0.00 | 0.07 ± 0.01 | 278.05 ± 23.51 | 14.16 ± 0.37 | 0.52 ± 0.11 |
| β-carotene | 0.27 ± 0.04 | N.D. | 0.33 ± 0.04 | 112.02 ± 10.69 | 6.45 ± 1.06 | 17.64 ± 3.94 |
| 9-cis β-carotene | 0.02 ± 0.00 | N.D. | 0.02 ± 0.00 | 10.27 ± 0.69 | 0.50 ± 0.05 | 0.66 ± 0.15 |
| 13-cis β-carotene | 0.07 ± 0.02 | N.D. | 0.04 ± 0.01 | 11.82 ± 1.56 | 0.96 ± 0.32 | 2.29 ± 0.53 |
| β-cryptoxanthin | 0.03 ± 0.01 | N.D. | 0.01 ± 0.00 | 13.44 ± 1.12 | 1.88 ± 0.19 | 2.23 ± 0.55 |
| Zeaxanthin | 0.05 ± 0.01 | N.D. | 0.05 ± 0.00 | 0.67 ± 0.07 | 0.11 ± 0.02 | 0.02 ± 0.00 |
| Total | 0.89 ± 0.14 | 0.02 ± 0.00 | 0.51 ± 0.07 | 428.81 ± 37.99 | 24.44 ± 2.01 | 23.35 ± 5.28 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tuan, P.A.; Lee, J.; Park, C.H.; Kim, J.K.; Noh, Y.-H.; Kim, Y.B.; Kim, H.; Park, S.U. Carotenoid Biosynthesis in Oriental Melon (Cucumis melo L. var. makuwa). Foods 2019, 8, 77. https://doi.org/10.3390/foods8020077
Tuan PA, Lee J, Park CH, Kim JK, Noh Y-H, Kim YB, Kim H, Park SU. Carotenoid Biosynthesis in Oriental Melon (Cucumis melo L. var. makuwa). Foods. 2019; 8(2):77. https://doi.org/10.3390/foods8020077
Chicago/Turabian StyleTuan, Pham Anh, Jeongyeo Lee, Chang Ha Park, Jae Kwang Kim, Young-Hee Noh, Yeon Bok Kim, HyeRan Kim, and Sang Un Park. 2019. "Carotenoid Biosynthesis in Oriental Melon (Cucumis melo L. var. makuwa)" Foods 8, no. 2: 77. https://doi.org/10.3390/foods8020077
APA StyleTuan, P. A., Lee, J., Park, C. H., Kim, J. K., Noh, Y.-H., Kim, Y. B., Kim, H., & Park, S. U. (2019). Carotenoid Biosynthesis in Oriental Melon (Cucumis melo L. var. makuwa). Foods, 8(2), 77. https://doi.org/10.3390/foods8020077

