Next Article in Journal
Modulating Casein-Stabilized Emulsions Through the Incorporation of Different Emulsifiers: Impacts on Microstructure and Oral Tribology
Previous Article in Journal
Volatile Odor Compounds by HS-SPME-GC-MS and Nutritional Composition of Hybrid Sturgeon (Acipenser baerii ♀ × Acipenser schrenckii ♂) Back Muscle: Freshwater vs. Seawater Cultivation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 15
Issue 5
10.3390/foods15050845
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Pamamycin Disrupts the Cell Envelope and Mitochondrial Potential to Inhibit Aspergillus flavus and Aflatoxin Production in a Peanut Kernel Model

by
Wangqiang Li
,
Tong Liu
,
Xiuyu Liu
,
Zehua Dong
,
Dan Liu
,
Chengfang Ding
,
Laifeng Lu
,
Wentao Ding
,
Zhenjing Li
,
Huanhuan Liu
,
Qingbin Guo
* and
Changlu Wang
*
State Key Laboratory of Food Nutrition and Safety, School of Food Science and Engineering, Tianjin University of Science & Technology, Tianjin 300457, China
*
Authors to whom correspondence should be addressed.
Foods 2026, 15(5), 845; https://doi.org/10.3390/foods15050845
Submission received: 27 January 2026 / Revised: 18 February 2026 / Accepted: 20 February 2026 / Published: 3 March 2026
(This article belongs to the Section Food Toxicology)
Browse Figures
Versions Notes

Abstract

Aspergillus flavus contaminates food commodities and produces carcinogenic aflatoxins. Pamamycin, a macrodiolide antibiotic from Streptomyces alboflavus TD-1, shows potent antifungal activity, yet its action against A. flavus and efficacy in complex food matrices largely remains unknown. Here, pamamycin was purified and evaluated using in vitro assays together with a peanut kernel model. Pamamycin reduced colony formation of A. flavus on PDA in a concentration-dependent manner, with near-complete inhibition at 4.0 mg/L on surface-treated PDA plates. Microscopy revealed progressive deformation and collapse of conidia and hyphae. Pamamycin increased membrane permeability, as indicated by elevated extracellular nucleic acid leakage, and impaired cell envelope integrity, as reflected by alkaline phosphatase release. In addition, pamamycin reduced Rh123-associated fluorescence, indicating an apparent dissipation of mitochondrial membrane potential under the tested conditions. Notably, at pamamycin concentrations of ≥0.5 mg/L, AFB1 accumulation was markedly reduced and fell below the limit of detection (LOD). This suppression was accompanied by distinct transcriptional changes in the aflatoxin regulatory network. RT–qPCR showed concentration-dependent repression of the pathway-specific regulators aflR and aflS, whereas the global regulator veA displayed a biphasic response with transient upregulation at lower concentrations. Notably, at 0.5 mg/L, multiple structural genes (aflC, aflD, aflK, aflP, and aflQ) were reduced to near-background transcript levels, coinciding with the loss of detectable AFB1. In inoculated peanut kernels incubated under high-humidity conditions, pamamycin significantly reduced fungal colonization and decreased AFB1 accumulation by >99%. Transcriptomic analysis of cultures treated with 0.5 mg/L pamamycin further revealed extensive transcriptional reprogramming, with enrichment of pathways related to branched-chain amino acid biosynthesis, central carbon metabolism, and ABC transporters. Collectively, pamamycin inhibits A. flavus through combined disruption of cell envelope integrity, apparent mitochondrial potential collapse, and broad suppression of the aflatoxin biosynthetic pathway, supporting its potential utility for mitigating aflatoxin contamination in peanut kernels, pending further safety evaluation.

1. Introduction

A. flavus is a ubiquitous filamentous fungus that frequently contaminates food and feed commodities under warm and humid conditions [1,2]. Its production of aflatoxins, particularly aflatoxin B1 (AFB1), represents a major food-safety concern because these secondary metabolites are highly toxic and carcinogenic [3,4,5]. Aflatoxin contamination in peanuts, maize, and other grains causes substantial post-harvest losses and poses serious risks to human and animal health [4,5,6,7]. Current control strategies, including chemical fungicides and stringent storage management, can be limited by variable efficacy, residue concerns, and the emergence of resistance, underscoring the need for safe and effective antifungal agents applicable to commodity systems [1,8]. In post-harvest peanut systems, these limitations are often amplified because irregular kernel surfaces and microcracks can hinder uniform treatment coverage/penetration, and high-humidity storage conditions can rapidly promote re-colonization while residue constraints limit dose escalation.
Streptomyces spp. are prolific sources of bioactive natural products and have long been exploited in agricultural and medical settings [9,10]. Streptomyces alboflavus strains are known producers of pamamycin, a macrodiolide antibiotic that occurs as a homologous mixture and exhibits antifungal activity. Pamamycins constitute a unique class of macrodiolide polyketides, commonly found as homologous mixtures, such as pamamycin-607, -621, and -635 [11]. Originally discovered from Streptomyces alboniger, pamamycins have been reported to exhibit antagonistic activity against Gram-positive bacteria and fungi and to function as autoregulatory molecules influencing aerial mycelium formation and sporulation in Streptomyces [12,13]. These properties highlight pamamycins as bioactive natural products with potential utility for agricultural and food-safety applications [14].
Although pamamycin has been reported to exhibit strong antifungal activity, how it inhibits A. flavus and suppresses aflatoxin formation remains insufficiently defined [12,15,16]. In the context of food safety applications, it is crucial to elucidate whether pamamycin primarily disrupts the cell envelope, interferes with mitochondrial and energy metabolism, or induces a broader metabolic reprogramming that compromises fungal viability [17,18]. Furthermore, the suppression of toxins may result from various regulatory mechanisms, such as pathway-specific repression or global stress remodeling [11,19,20]. Consequently, it is crucial to interpret aflatoxin outcomes within the framework of pathway-level transcriptional responses. Addressing these gaps will support evidence-based development of pamamycin as a natural antifungal for commodity protection [11].
Here, we systematically investigated the antifungal action of pamamycin against A. flavus using a multi-level strategy that integrates in vitro phenotypic assays, mechanistic measurements, and a food-relevant peanut kernel model. We evaluated colony formation on PDA and characterized pamamycin-associated changes in conidial and hyphal morphology. We further assessed cell-envelope integrity by measuring membrane permeability (OD260 leakage) and extracellular AKP activity as an indicator of envelope damage, while also monitoring mitochondrial membrane potential (ΔΨm) to evaluate mitochondrial status [21,22,23,24,25,26]. Given the direct relevance of aflatoxin suppression to food safety, we quantified AFB1 and profiled transcriptional responses in the aflatoxin regulatory network, focusing on key global regulators and representative genes within the aflatoxin cluster to determine whether pamamycin exposure is associated with a coordinated downshift of the aflatoxin program rather than isolated changes at individual biosynthetic steps [18]. Importantly, we validated pamamycin efficacy in inoculated peanut kernels by assessing fungal colonization and aflatoxin accumulation under storage-mimicking conditions [27,28]. Finally, transcriptomic analysis was performed to capture global responses and identify pathways perturbed by pamamycin exposure [29,30]. Together, this work provides a framework for understanding how pamamycin inhibits A. flavus and supports its development as a natural antifungal candidate for mitigating aflatoxin risks in food commodities.

2. Materials and Methods

2.1. Microbial Strains and Pamamycin Preparation

S. alboflavus TD-1 (GenBank accession No. JX915780) was used for pamamycin production. TD-1 was cultivated in Gause’s No. 1 medium at 28 °C for 5–7 days [31]. After fermentation, the culture was separated into supernatant and mycelial biomass. Pamamycin in the supernatant was extracted with ethyl acetate. In parallel, the harvested mycelia were extracted with methanol using ultrasonic-assisted extraction. The organic extracts from the supernatant and mycelia were combined and concentrated under reduced pressure. The residue was re-dissolved in methanol and subjected to HPLC purification. The identity of the purified pamamycin preparation was verified by LC–MS, showing the characteristic homologs (pamamycin 607, 621, and 635) [11,32,33]. For bioassays, the final purified product was prepared as a DMSO stock solution and diluted with potato dextrose broth (PDB) or the corresponding assay buffer; solvent controls contained the same final DMSO concentration as treated groups.
A. flavus (toxigenic strain CICC 2219) was cultured on potato dextrose agar (PDA) at 28–30 °C to induce sporulation [34,35]. Conidia were collected by washing the colony surface with sterile saline containing Tween 80 (0.05–0.1%, v/v), filtered to remove hyphal fragments, and adjusted to 1 × 106 conidia/mL using a hemocytometer for subsequent assays [34,36].

2.2. Plate-Based Colony Formation Assay on PDA

Pamamycin activity against A. flavus was evaluated on PDA plates using a surface-application method [37,38]. Pamamycin working solutions (0, 0.25, 0.5, 1.0, 2.0, and 4.0 mg/L) were prepared, and 100 μL was spread evenly onto each PDA plate (resulting in absolute doses of 0, 0.025, 0.05, 0.10, 0.20, and 0.40 μg per plate). Plates were left in a biosafety cabinet until the surface was completely absorbed and no visible liquid remained before inoculation. After drying, plates were inoculated by spreading 100 μL of a conidial suspension (1 × 106 conidia/mL) and incubated at 30 °C for 48 h [39,40]. The solvent (DMSO) level was matched across all treatments, and solvent-control plates received the same volume of DMSO-containing solution. Plates were photographed and colonies were counted where applicable [41]. Each treatment included at least three independent biological replicates.

2.3. Morphological Observation of Spores and Hyphae

To assess morphological responses to pamamycin, A. flavus was grown on PDA plates overlaid with sterile cellophane [42]. PDA surfaces were pre-treated with pamamycin at 0, 0.5, 1.0, 2.0, and 4.0 mg/L prior to inoculation. After 48 h at 30 °C, samples were collected from the actively growing colony margin and immediately fixed in 2.5% (v/v) glutaraldehyde prepared in 0.1 M phosphate buffer (pH 7.2) for at least 2 h. Following three washes with the same buffer, specimens were post-fixed in 1% (w/v) osmium tetroxide, dehydrated through a graded ethanol series, and dried by critical-point drying. Dried samples were sputter-coated with gold and examined using a field emission scanning electron microscope (FE-SEM; Apreo, FEI, Hillsboro, OR, USA) [43]. Representative micrographs were captured under identical acquisition settings for each treatment, and spore and hyphal surface morphology were compared across concentrations. Images were recorded for documentation and comparison among treatments.

2.4. Cell Membrane Permeability Assay

Cell membrane integrity was evaluated by monitoring the release of intracellular materials into the extracellular medium, measured as the absorbance of culture supernatants at 260 nm [44,45]. A. flavus was cultivated in PDB at 30 °C with shaking at 150 rpm for 24 h. Mycelial cultures were then exposed to pamamycin at final concentrations of 0, 0.25, 0.5, 1.0, and 2.0 mg/L. After 8 h of incubation, samples were centrifuged at 5000× g for 5 min, and the supernatants were collected. Absorbance at 260 nm (OD260) was recorded using an Infinite M200 PRO microplate reader (Tecan, Männedorf, Switzerland) with sterile PDB as the blank. All treatments were performed in triplicate. Solvent controls containing the same final concentration of DMSO as the pamamycin-treated groups were included. Data were analyzed using one-way ANOVA followed by Tukey’s multiple comparisons test (p < 0.05).

2.5. Cell Envelope Integrity (Akp Release) Assay

Cell envelope integrity was evaluated by measuring extracellular alkaline phosphatase (AKP) activity in culture supernatants [46,47]. A. flavus was grown in liquid PDB at 30 °C for 24 h. Mycelia were harvested, washed twice with phosphate-buffered saline (PBS; pH 7.0), and resuspended in PBS. Pamamycin was added to final concentrations of 0, 0.25, 0.5, 1.0, and 2.0 mg/L, followed by incubation at 30 °C for 8 h. Samples were centrifuged to remove mycelia, and the supernatants were collected for AKP determination.
Extracellular AKP activity was determined using an AKP assay kit (BC2305; Solarbio, Beijing, China) according to the manufacturer’s instructions. Absorbance at 405 nm was measured using an Infinite M200 PRO microplate reader (Tecan, Männedorf, Switzerland). AKP activity was then calculated and expressed as U/mL according to the manufacturer’s instructions. All treatments were performed in triplicate. Solvent controls containing the same final DMSO concentration as pamamycin-treated groups were included. Data were analyzed using one-way ANOVA followed by Tukey’s multiple comparisons test (p < 0.05).

2.6. Mitochondrial Membrane Potential Assay

ΔΨm in A. flavus hyphae was assessed using Rhodamine 123 (Rh123, 10 µM; Cat. IR1800, Solarbio, Beijing, China) [48,49,50]. Conidia were incubated in PDB at 30 °C with shaking at 150 rpm for 24 h. Hyphal cultures were then exposed to pamamycin at final concentrations of 0, 0.25, 0.5, 1.0, and 2.0 mg/L for 4 h under the same shaking conditions. After treatment, hyphae were harvested and washed with PBS, followed by staining with Rh123 for 30 min in the dark. Samples were washed with PBS to remove excess dye.
For imaging, stained hyphae were placed on standard glass slides and covered with a coverslip. Fluorescence images were acquired using an Olympus BX60 fluorescence microscope (Olympus, Tokyo, Japan) under the green channel with excitation/emission of approximately 484/534 nm. All images were captured using identical acquisition settings across treatments. Fluorescence intensity was quantified using ImageJ 1.53t (NIH, Bethesda, MD, USA).
For each sample, five non-overlapping fields of view were randomly selected, hyphal regions were selected as regions of interest (ROIs), background fluorescence was subtracted, and the mean Rh123 fluorescence intensity was normalized to hyphal area. Three independent experiments were performed. Solvent controls containing the same final DMSO concentration as pamamycin-treated groups were included. Data were analyzed using one-way ANOVA followed by Tukey’s multiple comparisons test, with p < 0.05 considered statistically significant.

2.7. Aflatoxin Quantification

To evaluate the effect of pamamycin on aflatoxin production, A. flavus was cultured in PDB supplemented with pamamycin at final concentrations of 0, 0.25, 0.5, 1.0, and 2.0 mg/L. Cultures were incubated statically at 30 °C for 5 days under the same medium and temperature conditions as described above. After incubation, cultures were filtered to separate mycelia from the culture filtrate. AFB1 in the filtrate was extracted with chloroform. The organic phase was collected, evaporated to dryness, and the dried residue was treated with 200 µL trifluoroacetic acid (TFA) at 40 °C for 15 min, followed by evaporation to remove TFA. The residue was reconstituted in the HPLC mobile phase prior to analysis [51,52].
AFB1 was quantified using an Agilent 1260 HPLC system (Agilent Tech., Santa Clara, CA, USA) equipped with a fluorescence detector (FLD). Separation was performed on a reversed-phase C18 column (GIST C18-AQ; Shimadzu, Kyoto, Japan). The mobile phase consisted of acetonitrile/water (75:25, v/v) operated isocratically at 1.0 mL/min. The column temperature was maintained at 30 °C and the injection volume was 20 µL. The excitation and emission wavelengths were set to 365 nm and 435 nm. A UVE photochemical derivatization unit was installed post-column between the analytical column and the fluorescence detector for on-line photochemical derivatization during HPLC–FLD analysis. Matrix-matched calibration was performed to minimize matrix effects. Specifically, calibration standards were prepared in the corresponding extraction matrix and processed in parallel with samples. Matrix-matched calibration was performed using an AFB1 standard (Cat. No. B24051; Yuanye Bio-Technology, Shanghai, China) at 0, 5.0, 10.0, 20.0, 30.0, 40.0, and 50.0 µg/L. The LOD and the LOQ were determined based on signal-to-noise ratios of 3 and 10, respectively, under the same HPLC–FLD conditions. Under the established HPLC-FLD conditions, the LOD was 5 µg/L and the LOQ was 15 µg/L. Peak identity was verified by matching retention time to the authentic standard. Solvent controls contained the same final concentration of DMSO as pamamycin-treated groups.

2.8. Gene Expression Analysis

For transcriptional analysis, mycelia were collected from PDB cultures (30 °C, 150 rpm) after 12 h of pamamycin exposure at the indicated concentrations. Total RNA was extracted from the fungal mycelia using the Total RNA Extraction Kit (Cat. No. R1200; Solarbio, Beijing, China) according to the manufacturer’s instructions. Subsequently, relative gene expression was determined by one-step RT-qPCR using the One Step SYBR Green RT-qPCR Kit (Solarbio, Beijing, China) in an Aria Mix Real-Time PCR system (Agilent Tech., 68830A model; Agilent Technologies, Santa Clara, CA, USA), with 100 ng of total RNA used as the input template per reaction. The specific primers used for amplification are listed in Table 1. All RT–qPCR primers listed in Table 1 were newly designed in this study based on the A. flavus reference sequences; primer specificity was experimentally verified by melt-curve analysis showing a single peak and agarose gel electrophoresis showing a single band of the expected size. Gene-specific primers and probes were used to quantify laeA, veA, aflR, aflS, aflC, aflD, aflK, aflP, and aflQ. The β-tubulin gene was used as the internal reference, and relative transcript levels were calculated using the 2−ΔΔCt method. RT–qPCR was performed with an initial denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 58 °C for 30 s, and 72 °C for 30 s. Melt-curve analysis was conducted at 95 °C for 15 s and 58 °C for 30 s, followed by fluorescence acquisition from 58 to 95 °C, and a final hold at 95 °C for 15 s. Each sample was analyzed with three technical replicates, and no-template controls were included [53]. Statistical analysis was performed as described in Section 2.11.

2.9. Transcriptomic Analysis (RNA-Seq)

To characterize the genome-wide response to pamamycin, RNA-seq was performed for untreated cultures and cultures treated at 0.5 mg/L for 12 h. Three independent biological replicates were prepared per condition. Total RNA was extracted using TRIzol reagent and purified according to the manufacturer’s instructions [54]. RNA integrity was assessed by agarose gel electrophoresis and an RNA bioanalyzer, and samples with RNA integrity number (RIN) > 7.0 were used for library construction [55]. mRNA was enriched by poly(A) selection, fragmented, and reverse-transcribed to generate cDNA libraries using a standard stranded mRNA library preparation workflow. Libraries were sequenced on an Illumina NovaSeq 6000 (Illumina, San Diego, CA, USA) platform to generate paired-end reads (150 bp). Three independent biological replicates were prepared for each condition (CK and pamamycin-treated).
Raw reads were subjected to quality control to remove adapter sequences and low-quality bases/reads. Clean reads were aligned to the A. flavus reference genome (NRRL 3357) downloaded from NCBI using a splice-aware aligner (HISAT2; Version 2.0.4) [56]. Gene-level read counts were generated based on the corresponding NCBI genome annotation file using featureCounts (Version 2.0.1) [57]. Differential expression analysis between pamamycin-treated and control samples was performed in R using DESeq2 based on gene-level counts (Version 1.36.0) [29]. Genes meeting the thresholds of |fold change| ≥ 2 and adjusted p-value < 0.05 were defined as differentially expressed. Functional enrichment analysis of differentially expressed genes was performed using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) annotations, and multiple testing correction was applied using the false discovery rate method [58,59].

2.10. Peanut Kernel Model for Controlling A. flavus Growth and Aflatoxin Accumulation

Peanut kernels of uniform size without visible defects were surface-sterilized with 1% (v/v) sodium hypochlorite for 2 min, rinsed three times with sterile water, and air-dried [60,61]. Kernel moisture was adjusted to 15% (w/w) and equilibrated at 4 °C overnight in sealed sterile bags [62]. Conidial suspensions of A. flavus (1 × 106 conidia/mL) were prepared as described above. To keep the surface-treatment conditions consistent with the in vitro assays, pamamycin working solutions were prepared at 0.25, 0.5, 1.0, and 2.0 mg/L. Each solution was applied at 0.5 mL per 10 g kernels, added dropwise and mixed thoroughly to distribute the solution across kernel surfaces. Thus, the kernel surface was treated with pamamycin at the same solution concentrations (0.25–2.0 mg/L) used in the in vitro experiments. It should be noted that the stated concentrations (0.25–2.0 mg/L) refer to the concentration of the applied surface-treatment solution, representing a surface application rather than homogeneous incorporation. For reference, these application conditions correspond to 12.5, 25.0, 50.0, and 100.0 µg/kg on a kernel-mass basis. The solvent control received 0.5 mL of the corresponding DMSO-containing solution. Treated kernels were incubated at 28–30 °C for 7 days in sealed humid chambers (≥95% RH) [63,64].
Fungal colonization was determined by CFU enumeration after vortexing kernels in sterile saline containing 0.1% Tween 80, followed by serial dilution and plating on PDA as described above; results were expressed as CFU/g [65]. For aflatoxin analysis, kernels were ground and AFB1 was extracted with acetonitrile/water (75:25, v/v) and chloroform partitioning. For peanut kernels, AFB1 extracts were analyzed using the same HPLC–FLD method described in Section 2.7, and quantification was performed using matrix-matched calibration prepared in the corresponding peanut-kernel extraction matrix. AFB1 was quantified by HPLC under the same chromatographic conditions and external calibration described above [66]. Each treatment included three biological replicates. Data were analyzed by one-way ANOVA with Tukey’s multiple comparisons test (p < 0.05).

2.11. Statistical Analysis

All experiments were performed with at least three independent replicates unless otherwise stated. Data are presented as mean ± SD. Statistical analyses were conducted using SPSS Statistics 22.0 (IBM, Armonk, NY, USA). Differences among groups were assessed by one-way ANOVA followed by Tukey’s multiple comparisons test for all-pairs comparisons or Dunnett’s test when comparing each treatment to the solvent control (CK) only. A value of p < 0.05 was considered statistically significant. Figures were generated using Origin 9.0 (OriginLab, Northampton, MA, USA).

3. Results

3.1. Pamamycin Reduces Colony Formation of A. flavus on PDA in a Concentration-Dependent Manner

Pamamycin markedly reduced A. flavus colony formation on PDA plates in a concentration-dependent manner (Figure 1). In the solvent control (0 mg/L), dense colonies were observed after 48 h. Colony numbers decreased progressively at 0.25 and 0.5 mg/L. At 1 mg/L, only scattered colonies remained, and colony formation was further suppressed at 2.0 mg/L. At 4.0 mg/L, colony formation was nearly abolished. Overall, colony formation decreased progressively as pamamycin concentration increased.

3.2. Morphological Damage to Spores and Hyphae Induced by Pamamycin

Microscopic analysis showed clear morphological damage in A. flavus conidia and hyphae after pamamycin exposure (Figure 2). In the control group, conidia were plump with a relatively smooth surface, and hyphae displayed intact filamentous morphology. At 0.5 mg/L, conidia exhibited surface wrinkling and mild deformation, accompanied by irregular hyphal surfaces. More pronounced damage was observed at 1.0 mg/L, where conidia were markedly shrunken and deformed, and hyphae appeared collapsed and twisted. At 2.0 mg/L, extensive structural disruption was evident, with collapsed conidia and fragmented, severely shriveled hyphae. At 4.0 mg/L, conidia were extensively collapsed and irregular in shape, and hyphal growth was not observed under the tested conditions. Overall, the severity of morphological alterations increased with pamamycin concentration, consistent with progressive impairment of fungal cell integrity.

3.3. Pamamycin Compromises Cell Membrane Integrity of A. flavus

To assess membrane permeability changes, the release of intracellular materials was monitored by measuring the absorbance at OD260 of culture supernatants. OD260 increased with pamamycin concentration (Figure 3). Compared with the control (CK, 1.244 ± 0.010), OD260 showed no significant change at 0.25 mg/L (1.250 ± 0.013, p > 0.05). In contrast, OD260 increased significantly at 0.5 mg/L (1.333 ± 0.016) and further increased at 1.0 mg/L (1.452 ± 0.050) and 2.0 mg/L (1.568 ± 0.038) (one-way ANOVA with Tukey’s test, p < 0.05). Thus, OD260 was significantly higher at ≥0.5 mg/L than in the control under the tested conditions.

3.4. Pamamycin Compromises Cell Envelope Integrity as Indicated by AKP Release

In parallel with membrane-associated changes, cell envelope integrity was evaluated by measuring AKP activity. As shown in Figure 4, basal AKP activity in the control group was low (5.60 ± 0.56 U/mL). AKP activity showed a concentration-dependent increase after pamamycin treatment. The value at 0.25 mg/L (6.47 ± 0.42 U/mL) was comparable to the control, whereas AKP activity increased markedly at 0.5 mg/L (10.73 ± 0.64 U/mL) and further increased at 1.0 mg/L (18.70 ± 1.61 U/mL) and 2.0 mg/L (25.20 ± 1.06 U/mL). Differences among groups were significant (one-way ANOVA with Tukey’s test, p < 0.05). Overall, extracellular AKP activity increased significantly at ≥0.5 mg/L compared with the control.

3.5. Pamamycin Reduces Mitochondrial Membrane Potential in A. flavus

We next evaluated ΔΨm using Rh123 staining. Control hyphae showed strong Rh123 fluorescence, whereas pamamycin reduced fluorescence intensity (Figure 5A). Quantification showed that fluorescence was comparable between the control and 0.25 mg/L groups. In contrast, fluorescence decreased significantly at 0.5, 1.0, and 2.0 mg/L compared with the control (one-way ANOVA with Tukey’s test, p < 0.05) (Figure 5B). Thus, Rh123 fluorescence intensity was significantly lower at ≥0.5 mg/L than in the control under the tested conditions.

3.6. Pamamycin Suppresses AFB1 Accumulation and Modulates Aflatoxin-Related Gene Expression

AFB1 accumulation was quantified to evaluate the effect of pamamycin on toxin production in A. flavus (Figure 6A). The solvent control produced 42.67 ± 2.08 mg/L AFB1. Pamamycin reduced AFB1 to 31.47 ± 2.55 mg/L at 0.25 mg/L. At 0.5 mg/L and above, AFB1 was not detected under the current analytical conditions, indicating that toxin levels fell below the method detection limit at these concentrations.
To investigate the transcriptional alterations associated with the suppression of aflatoxin biosynthesis, RT–qPCR analyses were conducted on the global regulators laeA and veA, as well as on key genes within the aflatoxin biosynthetic cluster (Figure 6B). At the 12 h sampling time point, the global regulator veA exhibited a distinct biphasic expression profile. It showed a modest yet statistically significant upregulation at the lowest concentration (approximately 1.25-fold at 0.25 mg/L; Dunnett, p < 0.01). At concentrations ≥1.0 mg/L, veA expression was significantly lower than the control (Dunnett, p < 0.01). In contrast, the expression of laeA remained similar to the control levels at concentrations ranging from 0.25 to 0.5 mg/L but was significantly downregulated at concentrations between 1.0 and 2.0 mg/L (Dunnett, p < 0.01). The pathway-specific regulators aflR and aflS demonstrated a clear concentration-dependent repression. Specifically, aflR expression decreased to approximately 0.36-fold at 0.5 mg/L and approached near-background levels at 2.0 mg/L, while aflS expression declined to approximately 0.69-fold at 0.5 mg/L and to approximately 0.08-fold at 2.0 mg/L. Notably, several downstream structural genes (aflC, aflD, aflK, aflP, and aflQ) exhibited a pronounced threshold-like pattern. Their expression was partially reduced at 0.25 mg/L but dropped to near-background (near-undetectable) levels at concentrations ≥ 0.5 mg/L (Dunnett, p < 0.001) under the current assay sensitivity.

3.7. Global Transcriptomic Response of A. flavus to Pamamycin

To characterize the genome-wide response to pamamycin, RNA-seq was performed for untreated cultures and cultures treated at 0.5 mg/L for 12 h. Using the thresholds of |fold change| ≥ 2 and FDR < 0.05, 4015 genes were differentially expressed, including 1037 upregulated and 2978 downregulated genes (Figure 7A). Overall, the transcriptome showed a clear bias toward downregulation, indicating broad transcriptional repression under pamamycin stress.
GO enrichment analysis indicated that DEGs were significantly enriched in amino acid metabolism, redox-related functions, transcriptional regulation, and membrane-associated components (Figure 7B). In the Biological Process category, branched-chain amino acid biosynthetic process was among the most significantly enriched terms (FDR = 0.00237; rich factor = 0.895), and branched-chain amino acid metabolic process was also enriched (FDR = 0.0402). In the Molecular Function category, enriched terms included DNA-binding transcription factor activity (FDR = 0.00281) and RNA polymerase II–specific DNA-binding transcription factor activity (FDR = 0.00320), as well as transmembrane transporter activity (FDR = 0.00330) and oxidoreductase activity (FDR = 0.00365). In the Cellular Component category, membrane-related terms were prominent, including integral component of membrane (FDR = 0.00425) and intrinsic component of membrane (FDR = 0.00426).
KEGG enrichment analysis further highlighted central metabolic pathways affected by pamamycin (Figure 7C). Significantly enriched pathways included valine, leucine and isoleucine biosynthesis (FDR = 0.00108), glycolysis/gluconeogenesis (FDR = 0.00108), glyoxylate and dicarboxylate metabolism (FDR = 0.00239), and nitrogen metabolism (FDR = 0.00599). Several additional amino acid metabolic pathways were enriched, including tryptophan metabolism (FDR = 0.0111), cysteine and methionine metabolism (FDR = 0.0142), and tyrosine metabolism (FDR = 0.0202). Notably, ABC transporters was also enriched (FDR = 0.0218). Collectively, GO/KEGG enrichment analyses showed significant enrichment of pathways related to amino acid metabolism, central carbon metabolism, redox-associated functions, and membrane/transport-related categories.

3.8. Pamamycin Reduces A. flavus Colonization and AFB1 Accumulation in a Peanut Kernel Model

Pamamycin was evaluated in a peanut kernel model under high-humidity incubation. To align with the in vitro concentration range, kernels were surface-treated with pamamycin working solutions at 0.25, 0.5, 1.0, and 2.0 mg/L (0.5 mL per 10 g kernels). After 7 days, visible colonization was reduced in pamamycin-treated groups compared with the solvent control, and suppression increased with concentration (Table 2).
Plate counting confirmed that pamamycin significantly reduced A. flavus colonization. Spore load decreased from 24.55 ± 0.27 ×105 CFU/g in the control to 13.00 ± 1.08, 7.18 ± 0.38, 4.57 ± 0.05, and 1.52 ± 0.09 ×105 CFU/g at 0.25, 0.5, 1.0, and 2.0 mg/L, respectively (one-way ANOVA with Tukey’s test, p < 0.05; Table 2). AFB1 accumulation showed a similar concentration-dependent reduction. The control group contained 40.55 ± 2.27 μg/kg, whereas AFB1 decreased to 18.00 ± 3.08, 6.48 ± 1.22, 1.57 ± 0.10, and 0.02 ± 0.01 μg/kg at 0.25, 0.5, 1.0, and 2.0 mg/L, respectively (one-way ANOVA with Tukey’s test, p < 0.05; Table 2). Relative to the solvent control (40.55 μg/kg), AFB1 in peanut kernels was reduced by 55.6% (0.25 mg/L), 84.0% (0.5 mg/L), 96.1% (1.0 mg/L), and 99.95% (2.0 mg/L). Overall, both CFU counts and AFB1 levels decreased as pamamycin concentration increased under the tested conditions. For reference, the above surface-treatment concentrations correspond to 12.5–100 µg/kg on a kernel-mass basis (0.5 mL per 10 g kernels).

4. Discussion

In this study, we characterized the inhibitory activity of pamamycin against A. flavus using phenotypic assays, microscopy, biochemical indicators of cell integrity, aflatoxin-related measurements, and transcriptomics. Across these layers, pamamycin exposure was associated with coordinated changes in cell-envelope integrity, mitochondrial membrane potential, aflatoxin output, and global gene expression, supporting a multifaceted inhibitory profile. Based on the colony formation assay, concentrations up to 2.0 mg/L were selected for mechanistic studies as they represented sub-lethal to significantly inhibitory doses. Notably, pamamycin showed strong inhibitory activity against A. flavus within the tested concentration range (0.5–4.0 mg/L) in our plate and broth-based assays. However, because standardized antifungal susceptibility testing (e.g., CLSI/EUCAST) was not performed, we do not assign formal MIC/MFC values here, and any cross-study comparisons should be interpreted cautiously. Future work will formally determine MIC and MFC values using CLSI/EUCAST protocols and conduct head-to-head comparisons against benchmark antifungals/fungicides under identical assay conditions and endpoints. In this context, the active concentration window observed here (0.5–4.0 mg/L) falls within the same order of magnitude as concentrations reported for several benchmark antifungals/fungicides against A. flavus, but direct potency ranking requires standardized, side-by-side testing. For instance, amphotericin B has been reported to show relatively high MICs against A. flavus, commonly in the 1–4 mg/L range [67,68,69]. Likewise, azole-class fungicides used in agriculture can show inhibitory concentrations in the mg/L scale, with substantial isolate-to-isolate variability [70]. By contrast, many crude plant extracts and some essential-oil–based preparations require markedly higher concentrations (often hundreds of mg/L to g/L) to achieve comparable inhibition in vitro [71,72,73]. Taken together, these observations support pamamycin as a high-activity candidate in our assays, while emphasizing that formal MIC/MFC determination and standardized benchmarking are necessary for definitive comparisons.
A central response to pamamycin was disruption of the fungal cell envelope under the tested conditions [74]. SEM imaging showed progressive deformation and collapse of conidia and hyphae with increasing pamamycin concentration [75,76]. Consistently, extracellular OD260 increased and AKP activity rose in the supernatant [77,78,79]. While AKP is an intracellular enzyme, its release into the extracellular space is widely regarded as an indicator of compromised cell envelope integrity and increased permeability [77,78,79,80]. Together, these phenotypes are consistent with reduced barrier function of the envelope, which would be expected to impair hyphal growth and colony establishment [74,76].
Exposure to pamamycin caused a reduction in Rhodamine 123 fluorescence that correlated with the concentration, indicative of a collapse in ΔΨm [81,82]. While this depolarization points to compromised mitochondrial bioenergetics, distinguishing primary mitochondrial perturbation from the secondary consequences of envelope damage remains challenging based on fluorescence assays alone [82]. However, given that pamamycins belong to the macrodiolide class, which includes compounds known to perturb membrane-associated transport and electrochemical gradients, an ionophore-like mechanism that directly dissipates transmembrane potential remains a plausible explanation [83]. This hypothesis is supported by early mechanistic studies in Staphylococcus aureus, where pamamycin was shown to bind tightly to bacterial membranes, inhibit the transport of nucleosides and phosphate, and induce the significant release of UV-absorbing intracellular material [13,84]. Although A. flavus is a eukaryotic organism, our observations of mitochondrial depolarization and the leakage of nucleic acids (OD260) parallel these bacterial findings, supporting the broader possibility that pamamycin can perturb membrane-associated functions in multiple systems, rather than establishing an identical molecular target in fungi [13,84]. Nevertheless, important differences should be recognized between bacterial membranes and the fungal cell envelope. Unlike bacteria, A. flavus possesses a multilayered cell wall (e.g., β-glucans and chitin) surrounding an ergosterol-rich plasma membrane, and it also contains mitochondria and eukaryotic trafficking and efflux systems that can influence membrane potential probes and stress responses. Thus, the S. aureus literature is cited here only to support the general concept that pamamycin can interact with membranes and perturb gradient-dependent processes, rather than to imply an identical molecular target in fungi. In our study, the inference for A. flavus is grounded primarily in the concordant phenotypes observed in fungal assays, including SEM-detected deformation, OD260 leakage, extracellular AKP increase, ΔΨm-associated Rh123 signal reduction, and the coordinated suppression of aflatoxin-related transcription. It is also important to note that Rh123 is a known substrate for fungal efflux pumps; thus, future investigations utilizing complementary probes (e.g., JC-1 or MitoTracker) and including established ionophore positive controls are necessary to rigorously rule out dye efflux artifacts [26,85]. Regardless of the exact sequence of events, pamamycin induces concomitant cell-envelope damage and a pronounced reduction in ΔΨm-associated Rh123 fluorescence, consistent with severe bioenergetic stress. This simultaneous disruption is consistent with severe cellular stress and impaired bioenergetic homeostasis in A. flavus. From a perspective of food safety, such a pleiotropic mode of action could be advantageous. Multi-process disruption is sometimes associated with a reduced likelihood of rapid resistance emergence compared with single-site inhibitors; however, this remains speculative for pamamycin in A. flavus without dedicated resistance-selection experiments. Future studies will evaluate resistance potential by serial passaging under sublethal pamamycin pressure and monitoring shifts in susceptibility and underlying genetic changes [86,87,88].
From a food-safety perspective, pamamycin exposure was associated with a marked reduction in AFB1 accumulation in liquid culture, with toxin levels falling below the detection limit in cultures treated with ≥0.5 mg/L pamamycin. This outcome coincided with distinct transcriptional reprogramming within the aflatoxin regulatory network [15,89]. RT–qPCR analysis revealed a biphasic response of the global regulator veA, which exhibited a transient upregulation at 0.25 mg/L. This initial increase likely reflects a compensatory stress or developmental response prior to its decline at higher concentrations [16,90]. Notably, a distinct transcriptional threshold was identified at 0.5 mg/L, where the pathway-specific regulator aflR was significantly repressed [91]. Concurrently, the expression of multiple downstream structural genes (aflC, aflD, aflK, aflP, and aflQ) was reduced to near-background levels [15,18,92]. These coordinated transcriptional alterations are consistent with the effective silencing of the aflatoxin biosynthetic program at concentrations of 0.5 mg/L and above, paralleling the absence of detectable AFB1 under the tested analytical conditions [15,18,92].
Transcriptomic profiling at 0.5 mg/L captured the genome-wide response of A. flavus at the concentration corresponding to this phenotypic/transcriptional threshold [93]. A large set of DEGs showed a bias toward downregulation, indicating broad transcriptional repression under pamamycin exposure [93]. Enrichment analyses highlighted pathways related to amino acid biosynthesis, central carbon metabolism, redox-associated functions, and transporter activity [93]. The upregulation of ABC transporter genes may reflect a stress-induced multidrug resistance (MDR) response, suggesting that A. flavus mounts a generalized detoxification and efflux program under pamamycin stress [94,95,96]. Functionally, the overexpression of these efflux pumps could potentially enhance the extrusion of intracellular substrates, including Rhodamine 123, which may contribute partially to the observed reduction in fluorescence intensity discussed above [85,97,98]. Furthermore, the enrichment of pathways related to branched-chain amino acids may reflect stress-associated metabolic reprogramming and altered carbon, nitrogen, and redox demands [99,100]. While a contribution from mitochondrial perturbation is possible, it cannot be inferred directly from enrichment patterns alone. Accordingly, enrichment results were interpreted as hypothesis-generating rather than definitive evidence of organelle-specific primary targets [101].
Importantly, pamamycin also showed activity in a commodity-relevant peanut kernel model [63,75]. Under high-humidity incubation, pamamycin reduced fungal colonization and limited AFB1 accumulation relative to the solvent control [75]. This matrix-based result strengthens translational relevance, because commodity systems incorporate factors absent from broth assays, such as heterogeneous nutrients, surface structure, and diffusion constraints [102,103]. Furthermore, pamamycin retained measurable efficacy in a lipid-rich matrix, supporting translational potential, although stability and residue kinetics remain to be determined [103,104].
From an application perspective, the strong efficacy of pamamycin on peanut kernels at low concentrations supports its potential as a candidate for post-harvest surface treatment. However, translation from laboratory findings to practical storage conditions requires further evaluation of its stability on lipid-rich matrices and persistence under variable environmental conditions. Furthermore, comprehensive safety assessments, including toxicity screening and residue analysis, remain a critical prerequisite to determining its suitability as a safe food intervention.
Several limitations should be noted. First, the current dataset supports envelope disruption and an apparent reduction in ΔΨm as key responses, but the direct molecular interaction site(s) of pamamycin in A. flavus remain to be identified [105,106,107]. Second, although matrix-matched calibration was applied, “not detected” results indicate that AFB1 levels were below the method’s detection (LOD: 5 μg/L) under the current extraction and HPLC conditions [108]. Third, transcriptomics was conducted under a single exposure condition; additional time points and concentrations would help distinguish early primary responses from downstream stress effects [105,109].
Overall, the combined evidence indicates that pamamycin suppresses A. flavus growth and reduces AFB1 to below the detection limit through coordinated impacts on cell-envelope integrity, mitochondrial electrochemical status, and a threshold-like transcriptional shutdown of the aflatoxin biosynthetic gene cluster. These findings support pamamycin as a promising natural antifungal candidate for mitigating aflatoxin risks in food commodities.

5. Conclusions

This study provides an integrated characterization of the antifungal efficacy and associated inhibitory responses of pamamycin against A. flavus. Phenotypic and microscopic analyses demonstrated that pamamycin reduces colony formation and induces a dose-dependent morphological collapse of conidia and hyphae. Mechanistically, pamamycin exposure was associated with impaired cell-envelope integrity, as evidenced by the increased leakage of intracellular components marked by elevated extracellular OD260 and the release of alkaline phosphatase. Concurrently, pamamycin induced a significant dissipation of mitochondrial membrane potential. Although the precise hierarchy of these events remains to be fully resolved, the synergistic disruption of both the cell envelope barrier and mitochondrial bioenergetics constitutes a robust, multi-target inhibitory strategy. This dual mechanism effectively compromises fungal viability and prevents adaptive recovery, and may increase the difficulty of resistance emergence compared with single-target inhibition, although dedicated resistance-selection experiments are required to confirm this. These physiological changes were accompanied by extensive transcriptional reprogramming. This included broad downshifts in aflatoxin-pathway transcripts, characterized by the dose-dependent repression of the pathway-specific regulator aflR and the near-total silencing of downstream structural genes (aflC, aflD, aflK, aflP, and aflQ). This was accompanied by a biphasic modulation of the global regulator veA, together with alterations in pathways related to central carbon metabolism, amino acid metabolism, and transporter activity.
Importantly, the efficacy of pamamycin was validated in a commodity-relevant peanut kernel model. Under conditions mimicking high-humidity storage, pamamycin significantly reduced fungal colonization and decreased AFB1 accumulation significantly. In liquid culture, toxin levels dropped below the LOD at effective doses; in peanut kernels, accumulation was reduced by >99% relative to the control. Collectively, these findings indicate that pamamycin exerts a multifaceted inhibitory profile involving envelope-associated damage alongside metabolic and regulatory perturbations. Our results highlight pamamycin as a promising natural candidate for managing aflatoxin contamination in stored peanuts, pending further evaluation of stability, residue kinetics, and toxicological safety. Specifically, future work should assess (i) physicochemical stability and antifungal performance under storage- and processing-relevant conditions (e.g., temperature/humidity fluctuations, light exposure, and matrix effects in lipid-rich kernels), and (ii) food-use safety, including cytotoxicity and genotoxicity screening, oral exposure/toxicokinetic studies, and residue dissipation to define acceptable exposure limits before practical deployment in food systems.

Author Contributions

Conceptualization, C.W. and Q.G.; methodology, W.L. and T.L.; software, X.L. and Z.D.; validation, D.L., C.D. and L.L.; formal analysis, W.L. and W.D.; investigation, W.L., Z.L. and H.L.; resources, C.W. and Q.G.; data curation, W.L. and T.L.; writing—original draft preparation, W.L.; writing—review and editing, C.W. and Q.G.; visualization, W.L. and X.L.; supervision, C.W. and Q.G.; project administration, C.W.; funding acquisition, C.W. and Q.G. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the National Natural Science Foundation of China (No. 31972177), Tianjin Graduate Research Innovation Project (No. YJSKC2021B27).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding authors.

Conflicts of Interest

There are no conflicts of interest.

References

  1. Amaike, S.; Keller, N.P.  Aspergillus flavus. Annu. Rev. Phytopathol. 2011, 49, 107–133. [Google Scholar] [CrossRef]
  2. Klich, M.A. Aspergillus flavus: The major producer of aflatoxin. Mol. Plant Pathol. 2007, 8, 713–722. [Google Scholar] [CrossRef]
  3. Wild, C.P.; Gong, Y.Y. Mycotoxins and human disease: A largely ignored global health issue. Carcinogenesis 2010, 31, 71–82. [Google Scholar] [CrossRef]
  4. Liu, Y.; Wu, F. Global burden of aflatoxin-induced hepatocellular carcinoma: A risk assessment. Environ. Health Perspect. 2010, 118, 818–824. [Google Scholar] [CrossRef] [PubMed]
  5. Kensler, T.W.; Roebuck, B.D.; Wogan, G.N.; Groopman, J.D. Aflatoxin: A 50-year odyssey of mechanistic and translational toxicology. Toxicol. Sci. Off. J. Soc. Toxicol. 2011, 120, S28–S48. [Google Scholar] [CrossRef]
  6. Torres, A.M.; Barros, G.G.; Palacios, S.A.; Chulze, S.N.; Battilani, P. Review on pre- and post-harvest management of peanuts to minimize aflatoxin contamination. Food Res. Int. 2014, 62, 11–19. [Google Scholar] [CrossRef]
  7. Udomkun, P.; Wiredu, A.N.; Nagle, M.; Müller, J.; Vanlauwe, B.; Bandyopadhyay, R. Innovative technologies to manage aflatoxins in foods and feeds and the profitability of application—A review. Food Control 2017, 76, 127–138. [Google Scholar] [CrossRef] [PubMed]
  8. Ojiambo, P.S.; Battilani, P.; Cary, J.W.; Blum, B.H.; Carbone, I. Cultural and Genetic Approaches to Manage Aflatoxin Contamination: Recent Insights Provide Opportunities for Improved Control. Phytopathology 2018, 108, 1024–1037. [Google Scholar] [CrossRef]
  9. Alam, K.; Mazumder, A.; Sikdar, S.; Zhao, Y.M.; Hao, J.; Song, C.; Wang, Y.; Sarkar, R.; Islam, S.; Zhang, Y.; et al. Streptomyces: The biofactory of secondary metabolites. Front. Microbiol. 2022, 13, 968053. [Google Scholar] [CrossRef]
  10. Pham, J.V.; Yilma, M.A.; Feliz, A.; Majid, M.T.; Maffetone, N.; Walker, J.R.; Kim, E.; Cho, H.J.; Reynolds, J.M.; Song, M.C.; et al. A Review of the Microbial Production of Bioactive Natural Products and Biologics. Front. Microbiol. 2019, 10, 1404. [Google Scholar] [CrossRef]
  11. Gläser, L.; Kuhl, M.; Stegmüller, J.; Rückert, C.; Myronovskyi, M.; Kalinowski, J.; Luzhetskyy, A.; Wittmann, C. Superior production of heavy pamamycin derivatives using a bkdR deletion mutant of Streptomyces albus J1074/R2. Microb. Cell Factories 2021, 20, 111. [Google Scholar] [CrossRef]
  12. McCann, P.A.; Pogell, B.M. Pamamycin: A new antibiotic and stimulator of aerial mycelia formation. J. Antibiot. 1979, 32, 673–678. [Google Scholar] [CrossRef] [PubMed]
  13. Chou, W.G.; Pogell, B.M. Mode of action of pamamycin in Staphylococcus aureus. Antimicrob. Agents Chemother. 1981, 20, 443–454. [Google Scholar] [CrossRef] [PubMed]
  14. Hashimoto, M.; Kondo, T.; Kozone, I.; Kawaide, H.; Abe, H.; Natsume, M. Relationship between response to and production of the aerial mycelium-inducing substances pamamycin-607 and A-factor. Biosci. Biotechnol. Biochem. 2003, 67, 803–808. [Google Scholar] [CrossRef] [PubMed]
  15. Caceres, I.; Khoury, A.A.; Khoury, R.E.; Lorber, S.; Oswald, I.P.; Khoury, A.E.; Atoui, A.; Puel, O.; Bailly, J.D. Aflatoxin Biosynthesis and Genetic Regulation: A Review. Toxins 2020, 12, 150. [Google Scholar] [CrossRef]
  16. Hou, X.; Liu, L.; Xu, D.; Lai, D.; Zhou, L. Involvement of LaeA and Velvet Proteins in Regulating the Production of Mycotoxins and Other Fungal Secondary Metabolites. J. Fungi 2024, 10, 561. [Google Scholar] [CrossRef]
  17. Moon, H.; Lee, M.-K.; Bok, I.; Bok, J.W.; Keller, N.P.; Yu, J.-H. Unraveling the Gene Regulatory Networks of the Global Regulators VeA and LaeA in Aspergillus nidulans. Microbiol. Spectr. 2023, 11, e00166-23. [Google Scholar] [CrossRef]
  18. Wang, P.; Xu, J.; Chang, P.-K.; Liu, Z.; Kong, Q. New Insights of Transcriptional Regulator AflR in Aspergillus flavus Physiology. Microbiol. Spectr. 2022, 10, e00791-21. [Google Scholar] [CrossRef]
  19. Xu, J.; Jiang, M.; Wang, P.; Kong, Q. The Gene vepN Regulated by Global Regulatory Factor veA That Affects Aflatoxin Production, Morphological Development and Pathogenicity in Aspergillus flavus. Toxins 2024, 16, 174. [Google Scholar] [CrossRef]
  20. Filipek, J.; Chalaskiewicz, K.; Kosmider, A.; Nielipinski, M.; Michalak, A.; Bednarkiewicz, M.; Goslawski-Zeligowski, M.; Prucnal, F.; Sekula, B.; Pietrzyk-Brzezinska, A.J. Comprehensive structural overview of the C-terminal ligand-binding domains of the TetR family regulators. J. Struct. Biol. 2024, 216, 108071. [Google Scholar] [CrossRef]
  21. Ling, L.; Luo, H.; Zhao, Y.; Yang, C.; Cheng, W.; Pang, M. Fungal pathogens causing postharvest fruit rot of wolfberry and inhibitory effect of 2,3-butanedione. Front. Microbiol. 2023, 13, 1068144. [Google Scholar] [CrossRef] [PubMed]
  22. Wang, T.; Li, Y.; Bi, Y.; Zhang, M.; Zhang, T.; Zheng, X.; Dong, Y.; Huang, Y. Benzyl isothiocyanate fumigation inhibits growth, membrane integrity and mycotoxin production in Alternaria alternata. RSC Adv. 2020, 10, 1829–1837. [Google Scholar] [CrossRef]
  23. Lu, Q.; Wang, Y.; Liao, X.; Zhou, F.; Zhang, B.; Wu, X. Physiological and transcriptome analysis of Candida albicans in response to X33 antimicrobial oligopeptide treatment. Front. Cell. Infect. Microbiol. 2023, 13, 1123393. [Google Scholar] [CrossRef]
  24. Chen, Y.-Y.; Zhang, Y.-D.; Wang, L.; Li, M.-Q.; Wang, Y.; Liang, J.; Wang, D.-L.; Zhang, H.-W. Investigating the antifungal mechanism of Artemisia argyi essential oil against Botrytis cinerea, Alternaria alternata, and Penicillium digitatum and its application in extending blueberry shelf life. Int. J. Food Microbiol. 2025, 439, 111262. [Google Scholar] [CrossRef] [PubMed]
  25. Zhu, G.; Chen, S.; Zhang, Y.; Lu, L. Mitochondrial Membrane-Associated Protein Mba1 Confers Antifungal Resistance by Affecting the Production of Reactive Oxygen Species in Aspergillus fumigatus. Antimicrob. Agents Chemother. 2023, 67, e00225-23. [Google Scholar] [CrossRef] [PubMed]
  26. Zorova, L.D.; Demchenko, E.A.; Korshunova, G.A.; Tashlitsky, V.N.; Zorov, S.D.; Andrianova, N.V.; Popkov, V.A.; Babenko, V.A.; Pevzner, I.B.; Silachev, D.N.; et al. Is the Mitochondrial Membrane Potential (∆Ψ) Correctly Assessed? Intracellular and Intramitochondrial Modifications of the ∆Ψ Probe, Rhodamine 123. Int. J. Mol. Sci. 2022, 23, 482. [Google Scholar] [CrossRef]
  27. Zhang, W.; Lv, Y.; Lv, A.; Wei, S.; Zhang, S.; Li, C.; Hu, Y. Sub3 inhibits Aspergillus flavus growth by disrupting mitochondrial energy metabolism, and has potential biocontrol during peanut storage. J. Sci. Food Agric. 2021, 101, 486–496. [Google Scholar] [CrossRef]
  28. Shakeel, Q.; Lyu, A.; Zhang, J.; Wu, M.; Li, G.; Hsiang, T.; Yang, L. Biocontrol of Aspergillus flavus on Peanut Kernels Using Streptomyces yanglinensis 3-10. Front. Microbiol. 2018, 9, 1049. [Google Scholar] [CrossRef]
  29. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
  30. Haas, B.J.; Papanicolaou, A.; Yassour, M.; Grabherr, M.; Blood, P.D.; Bowden, J.; Couger, M.B.; Eccles, D.; Li, B.; Lieber, M.; et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protoc. 2013, 8, 1494–1512. [Google Scholar] [CrossRef]
  31. Li, W.; Yang, M.; Dong, Z.; Liu, T.; Liu, X.; Liu, D.; Ding, C.; Lu, L.; Ding, W.; Li, Z.; et al. Glutamine Modulates mVOC Biosynthesis in Streptomyces alboflavus Through a gluR-Dependent Signaling Pathway and Enhances Its Inhibitory Activity Against Aspergillus flavus. Foods 2026, 15, 228. [Google Scholar] [CrossRef]
  32. Seo, K.; Shu, W.; Rückert-Reed, C.; Gerlinger, P.; Erb, T.J.; Kalinowski, J.; Wittmann, C. From waste to health-supporting molecules: Biosynthesis of natural products from lignin-, plastic- and seaweed-based monomers using metabolically engineered Streptomyces lividans. Microb. Cell Factories 2023, 22, 262. [Google Scholar] [CrossRef]
  33. Eckert, N.; Rebets, Y.; Horbal, L.; Zapp, J.; Herrmann, J.; Busche, T.; Müller, R.; Kalinowski, J.; Luzhetskyy, A. Discovery and overproduction of novel highly bioactive pamamycins through transcriptional engineering of the biosynthetic gene cluster. Microb. Cell Factories 2023, 22, 233. [Google Scholar] [CrossRef]
  34. Li, C.; Jia, S.; Rajput, S.A.; Qi, D.; Wang, S. Transcriptional Stages of Conidia Germination and Associated Genes in Aspergillus flavus: An Essential Role for Redox Genes. Toxins 2022, 14, 560. [Google Scholar] [CrossRef]
  35. Ren, S.; Yang, M.; Yue, Y.; Ge, F.; Li, Y.; Guo, X.; Zhang, J.; Zhang, F.; Nie, X.; Wang, S. Lysine Succinylation Contributes to Aflatoxin Production and Pathogenicity in Aspergillus flavus. Mol. Cell. Proteom. 2018, 17, 457–471. [Google Scholar] [CrossRef]
  36. Nickles, G.; Ludwikoski, I.; Bok, J.W.; Keller, N.P. Comprehensive Guide to Extracting and Expressing Fungal Secondary Metabolites with Aspergillus fumigatus as a Case Study. Curr. Protoc. 2021, 1, e321. [Google Scholar] [CrossRef] [PubMed]
  37. Dib, A.A.; Louka, N.; Assaf, J.C.; El Khatib, S.; El Khoury, A.; Debs, E. A Methodological Review of Strategies for Artificial Contamination of Solid Food with Aspergillus flavus and Aflatoxin B1: Insights Into Growth Dynamics, AFB1 Production, and Spiking Techniques for Cereals, Nuts, and Seeds. eFood 2025, 6, e70082. [Google Scholar] [CrossRef]
  38. Kraut-Cohen, J.; Frenkel, O.; Covo, S.; Marcos-Hadad, E.; Carmeli, S.; Belausov, E.; Minz, D.; Cytryn, E. A pipeline for rapidly evaluating activity and inferring mechanisms of action of prospective antifungal compounds. Pest Manag. Sci. Former. Pestic. Sci. 2024, 80, 2804–2816. [Google Scholar] [CrossRef]
  39. Zhou, X.; Chen, D.; Yu, M.; Jiao, Y.; Tao, F. Role of Flavohemoglobins in the Development and Aflatoxin Biosynthesis of Aspergillus flavus. J. Fungi 2024, 10, 437. [Google Scholar] [CrossRef] [PubMed]
  40. Mosquera, J.; Warn, P.A.; Morrissey, J.; Moore, C.B.; Gil-Lamaignere, C.; Denning, D.W. Susceptibility testing of Aspergillus flavus: Inoculum dependence with itraconazole and lack of correlation between susceptibility to amphotericin B in vitro and outcome in vivo. Antimicrob. Agents Chemother. 2001, 45, 1456–1462. [Google Scholar] [CrossRef]
  41. Liu, Y.; Tortora, G.; Ryan, M.E.; Lee, H.M.; Golub, L.M. Potato dextrose agar antifungal susceptibility testing for yeasts and molds: Evaluation of phosphate effect on antifungal activity of CMT-3. Antimicrob. Agents Chemother. 2002, 46, 1455–1461. [Google Scholar] [CrossRef]
  42. Zhao, J.; Csetenyi, L.; Gadd, G.M. Biocorrosion of copper metal by Aspergillus niger. Int. Biodeterior. Biodegrad. 2020, 154, 105081. [Google Scholar] [CrossRef]
  43. Xiong, Z.-Q.; Tu, X.-R.; Wei, S.-J.; Huang, L.; Li, X.-H.; Lu, H.; Tu, G.-Q. The Mechanism of Antifungal Action of a New Polyene Macrolide Antibiotic Antifungalmycin 702 from Streptomyces padanus JAU4234 on the Rice Sheath Blight Pathogen Rhizoctonia solani. PLoS ONE 2013, 8, e73884. [Google Scholar] [CrossRef]
  44. Qu, S.; Yang, K.; Chen, L.; Liu, M.; Geng, Q.; He, X.; Li, Y.; Liu, Y.; Tian, J. Cinnamaldehyde, a Promising Natural Preservative Against Aspergillus flavus. Front. Microbiol. 2019, 10, 2895. [Google Scholar] [CrossRef] [PubMed]
  45. Chen, X.; Yang, G.; Zhang, Y.; Su, Y.; Huang, J.; Li, A.; Chen, K.; Du, M.; Zalán, Z.; Awad, S.; et al. Combined UV and Formic Acid Treatment Suppresses Aspergillus flavus and Aflatoxin B(1) on Dried Red Chili Powder. Foods 2025, 14, 2194. [Google Scholar] [CrossRef]
  46. Che, J.; Chen, X.; Ouyang, Q.; Tao, N. p-Anisaldehyde Exerts Its Antifungal Activity Against Penicillium digitatum and Penicillium italicum by Disrupting the Cell Wall Integrity and Membrane Permeability. J. Microbiol. Biotechnol. 2019, 30, 878–884. [Google Scholar] [CrossRef]
  47. Ouyang, Q.; Shi, S.; Liu, Y.; Yang, Y.; Zhang, Y.; Yuan, X.; Tao, N.; Li, L. Inhibitory Mechanisms of trans-2-Hexenal on the Growth of Geotrichum citri-aurantii. J. Fungi 2023, 9, 930. [Google Scholar] [CrossRef] [PubMed]
  48. Das, S.; Ghosh, S.; Pal, K.; Chakraborty, M.; Khalko, S.; Islam, S.M.; Rai, S.; Choudhury, A.; Sahana, N.; Mandal, S. Cinchona-based liquid formulation exhibits antifungal activity through Tryptophan starvation and disruption of mitochondrial respiration in Rhizoctonia solani. Sci. Rep. 2025, 15, 39034. [Google Scholar] [CrossRef]
  49. Lin, H.; Cai, Y.; Shan, J.; Mao, X.; Zhang, Z.; Huang, J.; Cai, C.; Zhu, R. White and blue LED irradiation effectively inhibit postharvest decay in citrus caused by Cladosporium cladosporioides. LWT 2025, 227, 118016. [Google Scholar] [CrossRef]
  50. Huang, M.; Camara, A.K.; Stowe, D.F.; Qi, F.; Beard, D.A. Mitochondrial inner membrane electrophysiology assessed by rhodamine-123 transport and fluorescence. Ann. Biomed. Eng. 2007, 35, 1276–1285. [Google Scholar] [CrossRef]
  51. Alshannaq, A.F.; Yu, J.-H. A Liquid Chromatographic Method for Rapid and Sensitive Analysis of Aflatoxins in Laboratory Fungal Cultures. Toxins 2020, 12, 93. [Google Scholar] [CrossRef]
  52. Khan, R.; Ghazali, F.M.; Mahyudin, N.A.; Samsudin, N.I.P. Chromatographic Analysis of Aflatoxigenic Aspergillus flavus Isolated from Malaysian Sweet Corn. Separations 2021, 8, 98. [Google Scholar] [CrossRef]
  53. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  54. Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef]
  55. Schroeder, A.; Mueller, O.; Stocker, S.; Salowsky, R.; Leiber, M.; Gassmann, M.; Lightfoot, S.; Menzel, W.; Granzow, M.; Ragg, T. The RIN: An RNA integrity number for assigning integrity values to RNA measurements. BMC Mol. Biol. 2006, 7, 3. [Google Scholar] [CrossRef]
  56. Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
  57. Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef]
  58. Consortium, T.G.O. The Gene Ontology knowledgebase in 2026. Nucleic Acids Res. 2026, 54, D1779–D1792. [Google Scholar] [CrossRef] [PubMed]
  59. Kanehisa, M.; Furumichi, M.; Sato, Y.; Ishiguro-Watanabe, M.; Tanabe, M. KEGG: Integrating viruses and cellular organisms. Nucleic Acids Res. 2021, 49, D545–D551. [Google Scholar] [CrossRef] [PubMed]
  60. Yan, L.; Song, W.; Chen, Y.; Kang, Y.; Lei, Y.; Huai, D.; Wang, Z.; Wang, X.; Liao, B. Effect of non-aflatoxigenic strains of Aspergillus flavus on aflatoxin contamination of pre-harvest peanuts in fields in China. Oil Crop Sci. 2021, 6, 81–86. [Google Scholar] [CrossRef]
  61. Horn, B.W. Colonization of wounded peanut seeds by soil fungi: Selectivity for species from Aspergillus section Flavi. Mycologia 2005, 97, 202–217. [Google Scholar] [CrossRef]
  62. Wang, Y.; Zhou, Y.; Qin, Y.; Wang, L. Effect of environmental factors on the aflatoxin production by Aspergillus flavus during storage in upland rice seed using response surface methodology. LWT 2022, 169, 113977. [Google Scholar] [CrossRef]
  63. Darko, C.; Kumar Mallikarjunan, P.; Kaya-Celiker, H.; Frimpong, E.A.; Dizisi, K. Effects of packaging and pre-storage treatments on aflatoxin production in peanut storage under controlled conditions. J. Food Sci. Technol. 2018, 55, 1366–1375. [Google Scholar] [CrossRef]
  64. Zhang, H.; Jia, B.; Lu, Y.; Yoon, S.C.; Ni, X.; Zhuang, H.; Guo, X.; Le, W.; Wang, W. Detection of Aflatoxin B(1) in Single Peanut Kernels by Combining Hyperspectral and Microscopic Imaging Technologies. Sensors 2022, 22, 4864. [Google Scholar] [CrossRef]
  65. Commey, L.; Tengey, T.K.; Cobos, C.J.; Dampanaboina, L.; Dhillon, K.K.; Pandey, M.K.; Sudini, H.K.; Falalou, H.; Varshney, R.K.; Burow, M.D.; et al. Peanut Seed Coat Acts as a Physical and Biochemical Barrier against Aspergillus flavus Infection. J. Fungi 2021, 7, 1000. [Google Scholar] [CrossRef] [PubMed]
  66. Zhang, K.; Banerjee, K. A Review: Sample Preparation and Chromatographic Technologies for Detection of Aflatoxins in Foods. Toxins 2020, 12, 539. [Google Scholar] [CrossRef] [PubMed]
  67. Taghizadeh-Armaki, M.; Hedayati, M.T.; Ansari, S.; Omran, S.M.; Saber, S.; Rafati, H.; Zoll, J.; Lee, H.A.V.D.; Melchers, W.J.G.; Verweij, P.E.; et al. Genetic Diversity and In Vitro Antifungal Susceptibility of 200 Clinical and Environmental Aspergillus flavus Isolates. Antimicrob. Agents Chemother. 2017, 61, e00004-17. [Google Scholar] [CrossRef] [PubMed]
  68. Espinel-Ingroff, A.; Cuenca-Estrella, M.; Fothergill, A.; Fuller, J.; Ghannoum, M.; Johnson, E.; Pelaez, T.; Pfaller, M.A.; Turnidge, J. Wild-type MIC distributions and epidemiological cutoff values for amphotericin B and Aspergillus spp. for the CLSI broth microdilution method (M38-A2 document). Antimicrob. Agents Chemother. 2011, 55, 5150–5154. [Google Scholar] [CrossRef]
  69. Hadrich, I.; Makni, F.; Neji, S.; Cheikhrouhou, F.; Bellaaj, H.; Elloumi, M.; Ayadi, A.; Ranque, S. Amphotericin B in vitro resistance is associated with fatal Aspergillus flavus infection. Med. Mycol. 2012, 50, 829–834. [Google Scholar] [CrossRef]
  70. Kaminiaris, M.D.; Varveri, M.; Dimakopoulou, M.G.; Tsitsigiannis, D.I. Effective chemical management of Aspergillus flavus and aflatoxin contamination in pistachio nuts and orchards. Pest Manag. Sci. 2025, 81, 5062–5070. [Google Scholar] [CrossRef]
  71. Tian, F.; Woo, S.Y.; Lee, S.Y.; Park, S.B.; Zheng, Y.; Chun, H.S. Antifungal Activity of Essential Oil and Plant-Derived Natural Compounds against Aspergillus flavus. Antibiotics 2022, 11, 1727. [Google Scholar] [CrossRef]
  72. Wang, Y.; Yang, L.; Fei, X.; Yao, X.; Gao, D.; Guo, S. Antifungal Effect of Camellia Seed Cake Extract on Aspergillus flavus. J. Food Prot. 2019, 82, 463–469. [Google Scholar] [CrossRef]
  73. Dikhoba, P.M.; Mongalo, N.I.; Elgorashi, E.E.; Makhafola, T.J. Antifungal and anti-mycotoxigenic activity of selected South African medicinal plants species. Heliyon 2019, 5, e02668. [Google Scholar] [CrossRef] [PubMed]
  74. Santra, H.K.; Dutta, R.; Banerjee, D. Antifungal activity of bio-active cell-free culture extracts and volatile organic compounds (VOCs) synthesised by endophytic fungal isolates of Garden Nasturtium. Sci. Rep. 2024, 14, 11228. [Google Scholar] [CrossRef]
  75. Achar, P.N.; Quyen, P.; Adukwu, E.C.; Sharma, A.; Msimanga, H.Z.; Nagaraja, H.; Sreenivasa, M.Y. Investigation of the Antifungal and Anti-Aflatoxigenic Potential of Plant-Based Essential Oils against Aspergillus flavus in Peanuts. J. Fungi 2020, 6, 383. [Google Scholar] [CrossRef] [PubMed]
  76. Shishodia, S.K.; Tiwari, S.; Hoda, S.; Vijayaraghavan, P.; Shankar, J. SEM and qRT-PCR revealed quercetin inhibits morphogenesis of Aspergillus flavus conidia via modulating calcineurin-Crz1 signalling pathway. Mycology 2020, 11, 118–125. [Google Scholar] [CrossRef]
  77. Huang, F.; Kong, J.; Ju, J.; Zhang, Y.; Guo, Y.; Cheng, Y.; Qian, H.; Xie, Y.; Yao, W. Membrane damage mechanism contributes to inhibition of trans-cinnamaldehyde on Penicillium italicum using Surface-Enhanced Raman Spectroscopy (SERS). Sci. Rep. 2019, 9, 490. [Google Scholar] [CrossRef] [PubMed]
  78. OuYang, Q.; Duan, X.; Li, L.; Tao, N. Cinnamaldehyde Exerts Its Antifungal Activity by Disrupting the Cell Wall Integrity of Geotrichum citri-aurantii. Front. Microbiol. 2019, 10, 55. [Google Scholar] [CrossRef] [PubMed]
  79. Wu, W.; Li, Y.; Zhu, X.; Wang, L.; Wang, J.; Qin, Y.; Zhang, M.; Yu, C.; Gou, C.; Yan, X. Antimicrobial activity enabled by chitosan-ε-polylysine-natamycin and its effect on microbial diversity of tomato scrambled egg paste. Food Chem. X 2023, 19, 100872. [Google Scholar] [CrossRef]
  80. Mani-López, E.; Cortés-Zavaleta, O.; López-Malo, A. A review of the methods used to determine the target site or the mechanism of action of essential oils and their components against fungi. SN Appl. Sci. 2021, 3, 44. [Google Scholar] [CrossRef]
  81. Benarroch, J.M.; Asally, M. The Microbiologist’s Guide to Membrane Potential Dynamics. Trends Microbiol. 2020, 28, 304–314. [Google Scholar] [CrossRef]
  82. Nasim, F.; Schmid, D.; Szakács, G.; Sohail, A.; Sitte, H.H.; Chiba, P.; Stockner, T. Active transport of rhodamine 123 by the human multidrug transporter P-glycoprotein involves two independent outer gates. Pharmacol. Res. Perspect. 2020, 8, e00572. [Google Scholar] [CrossRef]
  83. Fraser, B.H.; Mulder, R.J.; Perlmutter, P. The total synthesis of pamamycin-607. Part 2: Synthesis of the C6–C18 domain. Tetrahedron 2006, 62, 2857–2867. [Google Scholar] [CrossRef]
  84. Chou, W.G.; Pogell, B.M. Pamamycin inhibits nucleoside and inorganic phosphate transport in Staphylococcus aureus. Biochem. Biophys. Res. Commun. 1981, 100, 344–350. [Google Scholar] [CrossRef] [PubMed]
  85. Ernst, R.; Kueppers, P.; Klein, C.M.; Schwarzmueller, T.; Kuchler, K.; Schmitt, L. A mutation of the H-loop selectively affects rhodamine transport by the yeast multidrug ABC transporter Pdr5. Proc. Natl. Acad. Sci. USA 2008, 105, 5069–5074. [Google Scholar] [CrossRef] [PubMed]
  86. Corkley, I.; Fraaije, B.; Hawkins, N. Fungicide resistance management: Maximizing the effective life of plant protection products. Plant Pathol. 2022, 71, 150–169. [Google Scholar] [CrossRef]
  87. McLaughlin, M.S.; Roy, M.; Abbasi, P.A.; Carisse, O.; Yurgel, S.N.; Ali, S. Why Do We Need Alternative Methods for Fungal Disease Management in Plants? Plants 2023, 12, 3822. [Google Scholar] [CrossRef]
  88. Alkemade, J.A.; Hawkins, N.J.; Baraldi, E.; Buddie, A.G.; Cockerton, H.M.; Corkley, I.; Fraaije, B.A.; Gaya, E.; Gifford, D.R.; Hartig, F.; et al. Learning from fungicide resistance: Evolutionary insights to guide RNAi-based control of fungal crop pathogens. Fungal Biol. Rev. 2025, 53, 100443. [Google Scholar] [CrossRef]
  89. Khan, R.; Ghazali, F.M.; Mahyudin, N.A.; Samsudin, N.I.P. Aflatoxin Biosynthesis, Genetic Regulation, Toxicity, and Control Strategies: A Review. J. Fungi 2021, 7, 606. [Google Scholar] [CrossRef]
  90. Cary, J.W.; Han, Z.; Yin, Y.; Lohmar, J.M.; Shantappa, S.; Harris-Coward, P.Y.; Mack, B.; Ehrlich, K.C.; Wei, Q.; Arroyo-Manzanares, N.; et al. Transcriptome Analysis of Aspergillus flavus Reveals veA-Dependent Regulation of Secondary Metabolite Gene Clusters, Including the Novel Aflavarin Cluster. Eukaryot. Cell 2015, 14, 983–997. [Google Scholar] [CrossRef]
  91. Wang, P.; Ma, L.; Jin, J.; Zheng, M.; Pan, L.; Zhao, Y.; Sun, X.; Liu, Y.; Xing, F. The anti-aflatoxigenic mechanism of cinnamaldehyde in Aspergillus flavus. Sci. Rep. 2019, 9, 10499. [Google Scholar] [CrossRef] [PubMed]
  92. Yu, J.; Chang, P.-K.; Ehrlich, K.C.; Cary, J.W.; Bhatnagar, D.; Cleveland, T.E.; Payne, G.A.; Linz, J.E.; Woloshuk, C.P.; Bennett, J.W. Clustered Pathway Genes in Aflatoxin Biosynthesis. Appl. Environ. Microbiol. 2004, 70, 1253–1262. [Google Scholar] [CrossRef]
  93. Tian, F.; Lee, S.Y.; Woo, S.Y.; Choi, H.Y.; Heo, S.; Nah, G.; Chun, H.S. Transcriptomic responses of Aspergillus flavus to temperature and oxidative stresses during aflatoxin production. Sci. Rep. 2021, 11, 2803. [Google Scholar] [CrossRef]
  94. Tobin, M.B.; Peery, R.B.; Skatrud, P.L. Genes encoding multiple drug resistance-like proteins in Aspergillus fumigatus and Aspergillus flavus. Gene 1997, 200, 11–23. [Google Scholar] [CrossRef]
  95. Moye-Rowley, W.S. Multiple mechanisms contribute to the development of clinically significant azole resistance in Aspergillus fumigatus. Front. Microbiol. 2015, 6, 70. [Google Scholar] [CrossRef]
  96. Harris, A.; Wagner, M.; Du, D.; Raschka, S.; Nentwig, L.-M.; Gohlke, H.; Smits, S.H.J.; Luisi, B.F.; Schmitt, L. Structure and efflux mechanism of the yeast pleiotropic drug resistance transporter Pdr5. Nat. Commun. 2021, 12, 5254. [Google Scholar] [CrossRef]
  97. Hiraga, K.; Yamamoto, S.; Fukuda, H.; Hamanaka, N.; Oda, K. Enniatin has a new function as an inhibitor of Pdr5p, one of the ABC transporters in Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun. 2005, 328, 1119–1125. [Google Scholar] [CrossRef]
  98. Egner, R.; Rosenthal, F.E.; Kralli, A.; Sanglard, D.; Kuchler, K. Genetic separation of FK506 susceptibility and drug transport in the yeast Pdr5 ATP-binding cassette multidrug resistance transporter. Mol. Biol. Cell 1998, 9, 523–543. [Google Scholar] [CrossRef]
  99. Luo, F.; Zhou, H.; Zhou, X.; Xie, X.; Li, Y.; Hu, F.; Huang, B. The Intermediates in Branched-Chain Amino Acid Biosynthesis Are Indispensable for Conidial Germination of the Insect-Pathogenic Fungus Metarhizium robertsii. Appl. Environ. Microbiol. 2020, 86, e01682-01620. [Google Scholar] [CrossRef] [PubMed]
  100. Steyer, J.T.; Downes, D.J.; Hunter, C.C.; Migeon, P.A.; Todd, R.B. Duplication and Functional Divergence of Branched-Chain Amino Acid Biosynthesis Genes in Aspergillus nidulans. mBio 2021, 12, e00768-21. [Google Scholar] [CrossRef] [PubMed]
  101. Consortium, T.G.O. The Gene Ontology resource: Enriching a GOld mine. Nucleic Acids Res. 2020, 49, D325–D334. [Google Scholar] [CrossRef]
  102. Yang, Y.; Chen, J.; Chen, L. A comprehensive insight into peanut storage: Patterns of quality changes, pathways of quality deterioration, and storage strategies. Food Chem. X 2025, 30, 102973. [Google Scholar] [CrossRef]
  103. Molina-Hernandez, J.B.; Grande-Tovar, C.D.; Neri, L.; Delgado-Ospina, J.; Rinaldi, M.; Cordero-Bueso, G.A.; Chaves-López, C. Enhancing postharvest food safety: The essential role of non-thermal technologies in combating fungal contamination and mycotoxins. Front. Microbiol. 2025, 16, 1543716. [Google Scholar] [CrossRef]
  104. Kępka-Borkowska, K.; Chałaśkiewicz, K.; Ogłuszka, M.; Borkowski, M.; Lepczyński, A.; Pareek, C.S.; Starzyński, R.R.; Lichwiarska, E.; Sultana, S.; Kalra, G.; et al. Current Approaches to Aflatoxin B1 Control in Food and Feed Safety: Detection, Inhibition, and Mitigation. Int. J. Mol. Sci. 2025, 26, 6534. [Google Scholar] [CrossRef]
  105. Waag, R.; von Ziegler, L.; Sonder, E.; Sturman, O.; Leonardi, J.; Frei, S.; Longster, R.; Gapp, K.; Germain, P.L.; Bohacek, J. Distinct mechanisms of transcriptomic habituation to repeated stress in the mouse hippocampus. Nat. Commun. 2025, 16, 11569. [Google Scholar] [CrossRef]
  106. Feng, F.; Zhang, W.; Chai, Y.; Guo, D.; Chen, X. Label-free target protein characterization for small molecule drugs: Recent advances in methods and applications. J. Pharm. Biomed. Anal. 2023, 223, 115107. [Google Scholar] [CrossRef] [PubMed]
  107. Mateus, A.; Kurzawa, N.; Perrin, J.; Bergamini, G.; Savitski, M.M. Drug Target Identification in Tissues by Thermal Proteome Profiling. Annu. Rev. Pharmacol. Toxicol. 2022, 62, 465–482. [Google Scholar] [CrossRef]
  108. Andronaco, P.; Di Sanzo, R.; Ioppolo, F.; Ligato, F.; Alberto, S.; Galluccio, M.A.; Carabetta, S.; Russo, M. An Innovative Analytical Approach for Multi-Mycotoxin Detection in Craft Beer Using Freeze-Dried Samples, IAC Column and HPLC/ESI-MS/MS. Foods 2025, 14, 956. [Google Scholar] [CrossRef] [PubMed]
  109. Leite, M.; Freitas, A.; Barbosa, J.; Ramos, F. Comprehensive assessment of different extraction methodologies for optimization and validation of an analytical multi-method for determination of emerging and regulated mycotoxins in maize by UHPLC-MS/MS. Food Chem. Adv. 2023, 2, 100145. [Google Scholar] [CrossRef]
Foods 15 00845 g001
Figure 1. Representative plates of A. flavus after 48 h incubation at 30 °C. PDA surfaces were pre-treated by spreading 100 μL of pamamycin working solutions, followed by inoculation with a standardized conidial suspension: (A) 0 mg/L (equivalent to 0 μg per plate); (B) 0.25 mg/L (0.025 μg per plate); (C) 0.5 mg/L (0.05 μg per plate); (D) 1.0 mg/L (0.10 μg per plate); (E) 2.0 mg/L (0.20 μg per plate); and (F) 4.0 mg/L (0.40 μg per plate).
Figure 1. Representative plates of A. flavus after 48 h incubation at 30 °C. PDA surfaces were pre-treated by spreading 100 μL of pamamycin working solutions, followed by inoculation with a standardized conidial suspension: (A) 0 mg/L (equivalent to 0 μg per plate); (B) 0.25 mg/L (0.025 μg per plate); (C) 0.5 mg/L (0.05 μg per plate); (D) 1.0 mg/L (0.10 μg per plate); (E) 2.0 mg/L (0.20 μg per plate); and (F) 4.0 mg/L (0.40 μg per plate).
Foods 15 00845 g001
Foods 15 00845 g002
Figure 2. Scanning electron micrographs showing morphological changes of A. flavus conidia and hyphae after 48 h exposure to pamamycin (CK, 0.5, 1.0, 2.0, and 4.0 mg/L). Conidia are shown at two magnifications (scale bars: 10 µm and 5 µm), and hyphae are shown with a 10 µm scale bar. Scale bars are shown at the bottom-right corner of each panel. Representative images illustrate progressive conidial surface wrinkling, shrinkage, and collapse, together with increasing hyphal distortion and shrinkage as pamamycin concentration increased. Hyphal growth was not observed at 4.0 mg/L under the tested conditions.
Figure 2. Scanning electron micrographs showing morphological changes of A. flavus conidia and hyphae after 48 h exposure to pamamycin (CK, 0.5, 1.0, 2.0, and 4.0 mg/L). Conidia are shown at two magnifications (scale bars: 10 µm and 5 µm), and hyphae are shown with a 10 µm scale bar. Scale bars are shown at the bottom-right corner of each panel. Representative images illustrate progressive conidial surface wrinkling, shrinkage, and collapse, together with increasing hyphal distortion and shrinkage as pamamycin concentration increased. Hyphal growth was not observed at 4.0 mg/L under the tested conditions.
Foods 15 00845 g002
Foods 15 00845 g003
Figure 3. OD260 of culture supernatants after pamamycin treatment. Data are presented as mean ± SD (n = 3). Asterisks indicate significant differences compared with the control (CK) (** p < 0.01, *** p < 0.001; one-way ANOVA followed by Tukey’s multiple comparisons test).
Figure 3. OD260 of culture supernatants after pamamycin treatment. Data are presented as mean ± SD (n = 3). Asterisks indicate significant differences compared with the control (CK) (** p < 0.01, *** p < 0.001; one-way ANOVA followed by Tukey’s multiple comparisons test).
Foods 15 00845 g003
Foods 15 00845 g004
Figure 4. AKP activity of A. flavus after pamamycin treatment. Data are shown as mean ± SD (n = 3). Asterisks indicate significant differences compared with CK (*** p < 0.001, **** p < 0.0001; one-way ANOVA followed by Tukey’s multiple comparisons test).
Figure 4. AKP activity of A. flavus after pamamycin treatment. Data are shown as mean ± SD (n = 3). Asterisks indicate significant differences compared with CK (*** p < 0.001, **** p < 0.0001; one-way ANOVA followed by Tukey’s multiple comparisons test).
Foods 15 00845 g004
Foods 15 00845 g005
Figure 5. Effects of pamamycin on ΔΨm in A. flavus assessed by Rh123 staining. (A) Representative bright-field and Rh123 fluorescence images of A. flavus germlings after treatment with pamamycin (CK, 0.25, 0.5, 1.0, and 2.0 mg/L). Rh123 fluorescence was imaged using an Olympus BX60 fluorescence microscope under the green channel (Ex/Em ≈ 484/534 nm) with identical acquisition settings across groups. Scale bar = 100 µm. (B) Quantification of Rh123 fluorescence intensity. For each biological replicate, five fields of view were analyzed in ImageJ with background subtraction and intensity normalization to hyphal area. Data are presented as mean ± SD (n = 3 biological replicates). Asterisks indicate significant differences compared with CK (** p < 0.01, *** p < 0.001, **** p < 0.0001; one-way ANOVA followed by Tukey’s multiple comparisons test).
Figure 5. Effects of pamamycin on ΔΨm in A. flavus assessed by Rh123 staining. (A) Representative bright-field and Rh123 fluorescence images of A. flavus germlings after treatment with pamamycin (CK, 0.25, 0.5, 1.0, and 2.0 mg/L). Rh123 fluorescence was imaged using an Olympus BX60 fluorescence microscope under the green channel (Ex/Em ≈ 484/534 nm) with identical acquisition settings across groups. Scale bar = 100 µm. (B) Quantification of Rh123 fluorescence intensity. For each biological replicate, five fields of view were analyzed in ImageJ with background subtraction and intensity normalization to hyphal area. Data are presented as mean ± SD (n = 3 biological replicates). Asterisks indicate significant differences compared with CK (** p < 0.01, *** p < 0.001, **** p < 0.0001; one-way ANOVA followed by Tukey’s multiple comparisons test).
Foods 15 00845 g005
Foods 15 00845 g006
Figure 6. Pamamycin suppresses AFB1 accumulation and modulates the expression of aflatoxin-related genes in A. flavus. (A) AFB1 levels in culture filtrates after pamamycin treatment. Bars represent mean ± SD (n = 3), and dots indicate individual biological replicates. AFB1 was quantified by HPLC–FLD. ND indicates that AFB1 was below the method detection limit (LOD, 5 μg/L) under the current analytical conditions. Pamamycin concentrations are expressed as mg/L. (B) RT–qPCR analysis of global regulators (laeA, veA) and aflatoxin-cluster genes (aflR, aflS, aflC, aflD, aflK, aflP, and aflQ) following pamamycin exposure. Mycelia were harvested for RNA extraction after 12 h of treatment. Transcript levels were normalized to the reference gene (β-tubulin) and expressed relative to the control (CK = 1). Bars represent mean ± SD (n = 3). Asterisks indicate significant differences versus CK determined by one-way ANOVA followed by Dunnett’s multiple comparisons test (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 6. Pamamycin suppresses AFB1 accumulation and modulates the expression of aflatoxin-related genes in A. flavus. (A) AFB1 levels in culture filtrates after pamamycin treatment. Bars represent mean ± SD (n = 3), and dots indicate individual biological replicates. AFB1 was quantified by HPLC–FLD. ND indicates that AFB1 was below the method detection limit (LOD, 5 μg/L) under the current analytical conditions. Pamamycin concentrations are expressed as mg/L. (B) RT–qPCR analysis of global regulators (laeA, veA) and aflatoxin-cluster genes (aflR, aflS, aflC, aflD, aflK, aflP, and aflQ) following pamamycin exposure. Mycelia were harvested for RNA extraction after 12 h of treatment. Transcript levels were normalized to the reference gene (β-tubulin) and expressed relative to the control (CK = 1). Bars represent mean ± SD (n = 3). Asterisks indicate significant differences versus CK determined by one-way ANOVA followed by Dunnett’s multiple comparisons test (* p < 0.05, ** p < 0.01, *** p < 0.001).
Foods 15 00845 g006
Foods 15 00845 g007
Figure 7. Transcriptomic response of A. flavus to pamamycin and functional enrichment of DEGs. (A) Volcano plot of DEGs in A. flavus after pamamycin treatment. Cultures were treated with pamamycin at 0.5 mg/L for 12 h and compared with the solvent control (CK). Each dot represents one gene. DEGs were defined as |fold change| ≥ 2 with FDR < 0.05. Upregulated genes are shown in red (n = 1037) and downregulated genes in blue (n = 2978); non-significant genes are shown in grey. The x-axis indicates log2(fold change) and the y-axis indicates −log10(FDR). (B) GO enrichment dot plot of DEGs. The x-axis indicates the rich factor (DEGs in term/total genes annotated in the term). Dot size represents the number of DEGs in each GO term, and color indicates −log10(FDR). (C) KEGG pathway enrichment dot plot of DEGs. Dot size represents the number of DEGs mapped to each pathway, and color indicates −log10(FDR). Enrichment analyses were performed using the DEGs defined in (A).
Figure 7. Transcriptomic response of A. flavus to pamamycin and functional enrichment of DEGs. (A) Volcano plot of DEGs in A. flavus after pamamycin treatment. Cultures were treated with pamamycin at 0.5 mg/L for 12 h and compared with the solvent control (CK). Each dot represents one gene. DEGs were defined as |fold change| ≥ 2 with FDR < 0.05. Upregulated genes are shown in red (n = 1037) and downregulated genes in blue (n = 2978); non-significant genes are shown in grey. The x-axis indicates log2(fold change) and the y-axis indicates −log10(FDR). (B) GO enrichment dot plot of DEGs. The x-axis indicates the rich factor (DEGs in term/total genes annotated in the term). Dot size represents the number of DEGs in each GO term, and color indicates −log10(FDR). (C) KEGG pathway enrichment dot plot of DEGs. Dot size represents the number of DEGs mapped to each pathway, and color indicates −log10(FDR). Enrichment analyses were performed using the DEGs defined in (A).
Foods 15 00845 g007
Table 1. List of primers for RT-qPCR used in this study.
Table 1. List of primers for RT-qPCR used in this study.
GenePrimer
Name		Sequence (5′–3′)Product
Size (bp)		Reference
β-tubulinBen2fATGGCTGCTTCTGACTTCCG159This study
Bt2bCGCATCTGGTCCTCAACCTC
laeAlaeA-FTTATTCACGGTGGCAAGGG139This study
laeA-RCAACAACGAAAGCGTCTGG
veAveA-FTACCTCACAGCTGGCTGAGTTCCCAC215This study
veA-RGGTGTCTCTTCCCTGGAATGTTCCTC
aflRaflR-FTAGCTGTACGAGTTGTGCCAGCTCA208This study
aflR-RCATTCTCGATGCAGGTAATCAATAATG
aflSaflS-FACTGGCAAAACTTGGGAATG162This study
aflS-RGAGGAAACGGAGTGATGGAA′
aflCaflC-FTGGTGGATCTGGTCGAGTTC185This study
aflC-RCGGATGGATACAGCCAGACA
aflDaflD-FATGAACGGATCACTTAGCCAGCACGGTC120This study
aflD-RCTACCAGGGGAGTTGAGATCCATCCGT
aflKaflK-FCACAGCCATCAGCCTCTACA145This study
aflK-RAGGTTTGGGGTTCTTGGTTC
aflPaflP-FGGTTACCCCTGACCAATACG190This study
aflP-RGCTGCAAGAAGTCGGAAAAG
aflQaflQ-FATGGTGTTCAAGCCAGAGCG172This study
aflQ-RTGGGCGAGATGAAGAAGCAG
Table 2. Spore load and AFB1 production of A. flavus in peanut kernels under different pamamycin doses (mean ± SD).
Table 2. Spore load and AFB1 production of A. flavus in peanut kernels under different pamamycin doses (mean ± SD).
Pamamycin Dose (mg/L)CK0.250.51.02.0
Spore load
(×105 CFU/g)		24.55 ± 0.27 a13.00 ± 1.08 b7.18 ± 0.38 c4.57 ± 0.05 d1.52 ± 0.09 e
AFB1
(μg/kg)		40.55 ± 2.27 a18.00 ± 3.08 b6.48 ± 1.22 c1.57 ± 0.10 d0.02 ± 0.01 e
Note: Data are presented as mean ± SD (n = 3) from independent biological replicates incubated for 7 days under high-humidity conditions. Kernels were treated by applying 0.5 mL of pamamycin working solution per 10 g kernels. For reference, 0.25, 0.5, 1.0, and 2.0 mg/L correspond to 12.5, 25.0, 50.0, and 100.0 µg/kg on a kernel-mass basis. Different lowercase letters (a–e) within the same row indicate statistically significant differences (p < 0.05) based on one-way ANOVA followed by Tukey’s multiple comparisons test. CK: solvent control.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, W.; Liu, T.; Liu, X.; Dong, Z.; Liu, D.; Ding, C.; Lu, L.; Ding, W.; Li, Z.; Liu, H.; et al. Pamamycin Disrupts the Cell Envelope and Mitochondrial Potential to Inhibit Aspergillus flavus and Aflatoxin Production in a Peanut Kernel Model. Foods 2026, 15, 845. https://doi.org/10.3390/foods15050845

AMA Style

Li W, Liu T, Liu X, Dong Z, Liu D, Ding C, Lu L, Ding W, Li Z, Liu H, et al. Pamamycin Disrupts the Cell Envelope and Mitochondrial Potential to Inhibit Aspergillus flavus and Aflatoxin Production in a Peanut Kernel Model. Foods. 2026; 15(5):845. https://doi.org/10.3390/foods15050845

Chicago/Turabian Style

Li, Wangqiang, Tong Liu, Xiuyu Liu, Zehua Dong, Dan Liu, Chengfang Ding, Laifeng Lu, Wentao Ding, Zhenjing Li, Huanhuan Liu, and et al. 2026. "Pamamycin Disrupts the Cell Envelope and Mitochondrial Potential to Inhibit Aspergillus flavus and Aflatoxin Production in a Peanut Kernel Model" Foods 15, no. 5: 845. https://doi.org/10.3390/foods15050845

APA Style

Li, W., Liu, T., Liu, X., Dong, Z., Liu, D., Ding, C., Lu, L., Ding, W., Li, Z., Liu, H., Guo, Q., & Wang, C. (2026). Pamamycin Disrupts the Cell Envelope and Mitochondrial Potential to Inhibit Aspergillus flavus and Aflatoxin Production in a Peanut Kernel Model. Foods, 15(5), 845. https://doi.org/10.3390/foods15050845

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop