Next Article in Journal
Donkey Milk Quality and Safety: Challenges of Using the ISO 11816-1 ALP Method for Pasteurization Verification
Previous Article in Journal
Impact of Farm Management Practices on Salmonella Occurrence at the Farm Level—A Blend of Traditional Methods and Artificial Intelligence
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 15
Issue 4
10.3390/foods15040670
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Curcumin, the Bioactive Compound of Turmeric, Boosts Cellular Antioxidant Defense via the miR-22-3p/MCAT Axis

by
Haiqi Wang
1,2,†,
Yanqi Lin
1,2,†,
Yuanyuan Li
1,2,
Shiying Huang
1,2 and
Guiling Li
1,2,*
1
College of Ocean Food and Biological Engineering, Jimei University, Xiamen 361021, China
2
Fujian Marine Functional Food Engineering Technology Research Center, Xiamen 361021, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Foods 2026, 15(4), 670; https://doi.org/10.3390/foods15040670
Submission received: 16 January 2026 / Revised: 6 February 2026 / Accepted: 9 February 2026 / Published: 12 February 2026
(This article belongs to the Special Issue Innovative Applications of Molecular Techniques and Genetic Engineering in Foods)
Browse Figures
Versions Notes

Abstract

Curcumin, the major bioactive polyphenol derived from the edible rhizome turmeric (Curcuma longa L.), is recognized for its health-promoting properties. Despite well-documented antioxidant effects, its molecular mechanisms, particularly those involving post-transcriptional regulation, remain incompletely understood. This in vitro study identifies a novel microRNA-mediated pathway contributing to the antioxidant activity of curcumin in human hepatic LO2 cells. Curcumin treatment downregulated the stress-responsive microRNA miR-22-3p. Bioinformatics analysis and a dual-luciferase reporter assay identified malonyl-CoA-acyl carrier protein transacylase (MCAT), a mitochondrial enzyme, as a direct target of miR-22-3p. Modulation of this axis reduced intracellular reactive oxygen species (ROS), enhanced total reducing capacity, increased activities of key antioxidant enzymes (SOD, CAT, GPx), and improved mitochondrial bioenergetics without altering membrane potential. Crucially, siRNA-mediated knockdown of MCAT attenuated the ROS-scavenging effect of curcumin. These findings reveal a mechanistic pathway wherein curcumin downregulates miR-22-3p, resulting in upregulation of MCAT and enhanced mitochondrial antioxidant defense. This work broadens the understanding of curcumin’s bioactivity from direct radical scavenging to include the post-transcriptional fine-tuning of mitochondrial metabolism. The study establishes a molecular framework for further exploration of curcumin’s potential in alleviating oxidative stress.

1. Introduction

The consumption of fruits and vegetables is strongly associated with reduced risk of chronic diseases, a benefit largely attributed to their rich array of bioactive phytochemicals [1]. Among the numerous bioactive phytochemicals derived from edible plants, curcumin—the principal curcuminoid obtained from the rhizome of turmeric (Curcuma longa L.)—has been extensively studied for its health-promoting properties [2,3]. It has demonstrated potent antioxidant and anti-inflammatory activities in diverse preclinical models [4]. However, a central paradox remains: curcumin’s remarkably broad efficacy contrasts with its notoriously low systemic bioavailability [5,6]. This discrepancy suggests that its mechanisms of action may extend beyond direct interactions or the activation of canonical pathways like Nrf2, potentially involving more subtle, indirect modulation of cellular regulatory networks [7].
Implicated in a spectrum of diseases, oxidative stress is a fundamental pathological mechanism whereby excessive reactive oxygen species (ROS) drive the progression of metabolic and neurodegenerative disorders [8]. Mitochondria play a dual role in this process, serving as both the primary source of ROS and a major target of oxidative damage, thereby creating a vicious cycle of cellular decline [9]. Consequently, strategies aimed at reinforcing endogenous mitochondrial antioxidant defenses are of significant therapeutic interest [10]. In this context, dietary interventions with phytochemical-rich foods or their bioactive components, such as the curcuminoids derived from turmeric, present a promising avenue.
The regulatory role of microRNAs (miRNAs) operates at the post-transcriptional level, where they fine-tune gene expression and serve as pivotal integrators of cellular stress responses and metabolic pathways [11]. Accumulating evidence indicates that the bioactivities of numerous dietary phytochemicals can be mediated through the modulation of specific miRNAs [12]. For example, curcumin has been shown to regulate miRNAs such as miR-21 and miR-146a in various biological contexts [13]. Nevertheless, it remains unclear whether the antioxidant properties of curcumin involve the regulation of stress-responsive miRNAs, especially within the framework of mitochondrial metabolism. In this study, attention was directed to miR-22-3p, a stress-inducible miRNA associated with cellular senescence and metabolic control [14,15]. A hypothesis was advanced that curcumin could produce its antioxidant effects, at least partially, via downregulation of miR-22-3p. Bioinformatic prediction indicated malonyl-CoA-acyl carrier protein transacylase (MCAT), a mitochondrial enzyme required for fatty acid synthesis, as a potential direct target of miR-22-3p [16,17,18]. Beyond its conventional role in lipid synthesis, the mitochondrial fatty acid synthesis (mtFAS) pathway—where MCAT acts as a key enzyme—has been implicated in sustaining the integrity and function of the mitochondrial respiratory chain [19,20]. Consequently, it was postulated that MCAT, by maintaining mtFAS activity, might contribute to mitochondrial redox homeostasis, and that its repression by miR-22-3p could represent a vulnerable node under conditions of oxidative stress.
Based on the analysis, this study proposes a mechanistic axis linking the bioactivity of dietary curcumin to cellular stress tolerance: curcumin enhances mitochondrial antioxidant defense by suppressing miR-22-3p expression, thereby upregulating MCAT. This pathway was systematically investigated in human hepatic LO2 cells through an integrated approach combining bioinformatic prediction, dual-luciferase reporter assays, gain- and loss-of-function experiments, and comprehensive assessment of redox balance and mitochondrial function. The results substantiate this mechanistic axis and elucidate a novel post-transcriptional mechanism through which curcumin augments cellular antioxidant capacity.

2. Materials and Methods

2.1. Cell Culture and Curcumin Treatment

The LO2 human fetal hepatocyte cell line was procured from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in standard conditions: high-glucose Dulbecco’s modified Eagle’s medium (DMEM; Cat# SH30022.01, HyClone, Logan, UT, USA) containing 10% fetal bovine serum (FBS; Cat# 100-106, Gemini, West Sacramento, CA, USA) and 1% penicillin (100 U/mL)-streptomycin (100 µg/mL) solution (Cat# 15140-122, Gibco, Waltham, MA,), at 37 °C in a 5% CO2 humidified incubator. For treatment, we prepared a curcumin (Sigma-Aldrich, St. Louis, MO, USA, CAS 458-37-7) stock solution in dimethyl sulfoxide (DMSO; Cat# D2650, Sigma-Aldrich) and applied it to cells at specified concentrations for 24 h [21,22]. The final DMSO concentration in all groups, including the vehicle control treated with 0.1% (v/v) DMSO alone, was maintained at or below 0.1% (v/v).

2.2. Construction of Plasmid

To create the psiCHECK2-MCAT reporter constructs, the wild-type (WT) 3′-untranslated region (3′-UTR) of the human MCAT gene and a mutant form (MUT, with seed region mutations abolishing miR-22-3p binding) were PCR-amplified. The amplicons were digested with XhoI (Cat# 1094A) and NotI (Cat# 1166A) (Takara Bio, Beijing, China) and subcloned into the corresponding sites of the psiCHECK-2 vector (Cat# C8021, Promega, Madison, WI, USA) via T4 DNA Ligase (Cat# 2011A, Takara Bio). Separately, to generate the MCAT overexpression plasmid, the full-length MCAT CDS was amplified and cloned into the XhoI/NotI sites of the pCMV-3X Flag vector (Cat# E7901, Promega), yielding pCMV-MCAT. Construct fidelity was confirmed by double-restriction digestion and commercial Sanger sequencing (Tsingen, Beijing, China). The sequences of all cloning primers are listed as follows:
MCAT-3′-UTR WT Forward: 5′-CCGCTCGAGTCAGACGCACCAGG-3′,
MCAT-3′-UTR WT Reverse: 5′-ATTTGCGGCCGCTCAGGAGGACAGAGGG-3′,
MCAT-3′-UTR MUT Forward: 5′-CATTGGGAGCCATCCTGAAGAGCTGTAACA-3′,
MCAT-3′-UTR MUT Reverse: 5′-GCCTGCCAGGGCCTACTTCGAAAGTTTGGG-3′,
pCMV-MCAT Forward:5′-GCCACATGAGCGTCCGGGTCGCA-3′,
pCMV-MCAT Reverse: 5′-TTAGAGGAATTCTTCTGGAGAAACCG-3′

2.3. Cell Transfection

For transfection experiments, LO2 cells were plated in 12-well plates at a density of 1 × 106 cells per well and cultured overnight. Transfections were conducted at 75–80% confluency using Lipofectamine 2000 reagent (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s protocol. The following final amounts were used: 50 nM for miRNA mimics or inhibitors (designed and synthesized by RiboBio, Guangzhou, China) or their controls; 1.6 μg per well for plasmids (pCMV-MCAT or empty vector); and a combination of 0.2 μg reporter plasmid and 5 pmol miRNA for dual-luciferase assays. At 6 h post-transfection, the medium was changed. Cells were collected for analysis 48 h after transfection.

2.4. Dual-Luciferase Reporter Assay

The dual-luciferase reporter assay was conducted as follows. LO2 cells were plated in 96-well plates at 1 × 104 cells per well and grown for 24 h to 70–80% confluency. Prior to transfection, a DNA-miRNA mixture containing 0.2 μg of reporter plasmid (WT or MUT psiCHECK2-MCAT-3′UTR) and 40 nM of miR-22-3p mimic (or NC mimic; RiboBio) was prepared per well. This mixture was combined with Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) at a 1:2 ratio in Opti-MEM, incubated for 20 min at room temperature to form complexes, and then applied to the cells. Subsequently, 48 h post-transfection, cells were lysed and luciferase activity was measured sequentially (Firefly, then Renilla after quenching) using the Dual-Luciferase Reporter Assay System (Cat# E1910, Promega, Madison, WI, USA) [23,24]. All transfections were performed in triplicate wells and repeated in three independent experiments. For data analysis, Renilla/Firefly luminescence ratios were calculated, and the value from the NC mimic + WT reporter group was defined as 1.0 for normalization.

2.5. RNA Extraction and Quantitative Real-Time PCR (qRT-PCR)

Total RNA was isolated from treated cells using TRIzol Reagent (Cat# 15596026, Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA concentration and purity were assessed by measuring the absorbance at 260 nm and 280 nm using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). For mRNA analysis, 1 μg of total RNA was reverse-transcribed into cDNA using the ReverTra Ace qPCR RT Master Mix (Cat# FSQ-201, Toyobo, Osaka, Japan). For miRNA analysis, cDNA was synthesized from an equivalent amount of RNA using the M-MLV Reverse Transcriptase system (Cat# M1701, Promega, Madison, WI, USA) with gene-specific stem-loop primers (RiboBio, Guangzhou, China). Quantitative real-time PCR was performed on an ABI 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using the SYBR Premix Ex Taq II (Tli RNaseH Plus) kit (Cat# RR820A, Takara Bio, Beijing, China). The thermal cycling conditions were: initial denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 31 s. All reactions were performed in triplicate. Gene expression was normalized to β-actin (for mRNA) or U6 snRNA (for miRNA). Relative expression levels were calculated using the comparative 2−ΔΔCt method [25,26]. The primer sequences for mRNA detection are listed in Table 1; miRNA primers were designed and synthesized by RiboBio.

2.6. Measurement of Intracellular and Mitochondrial ROS Levels

Intracellular reactive oxygen species (ROS) were assessed in parallel using two fluorescent probes, with the understanding that DCFH-DA reports on a broad spectrum of intracellular peroxides as a general indicator of oxidative burden. For assessment of total cellular ROS, cells were harvested after treatment, washed, and incubated with 10 μM 2′,7′-dichlorofluorescein diacetate (DCFH-DA; Cat# S0033, Beyotime, Shanghai, China) in Opti-MEM at 37 °C for 30 min in the dark. Similarly, for detection of mitochondrial superoxide, cells were incubated with 5 μM MitoSOX™ Red reagent (Cat# M36008, Thermo Fisher Scientific) in PBS under the same conditions. Following incubation, cells from both assays were thoroughly washed to remove excess probe and resuspended. DCFH-DA-derived green fluorescence (indicative of total ROS) and MitoSOX™ Red-derived red fluorescence (indicative of mitochondrial superoxide) were then quantified immediately by flow cytometry.

2.7. Assessment of Total Reducing Capacity

The total reducing capacity (i.e., in vitro antioxidant capacity) of cell lysates was evaluated using two complementary chemical assays: the ABTS radical cation decolorization assay and the ferric reducing anti-oxidant power (FRAP) assay, using commercial kits (ABTS: Cat# S0119; FRAP: Cat# S0116, Beyotime Biotechnology, Shanghai, China). LO2 cells were seeded in 12-well plates and transfected according to the procedure described in Section 2.3. After 48 h of incubation, cells were harvested and lysed, and the supernatants were collected for analysis. For the ABTS assay, antioxidant capacity was determined by measuring the scavenging of the pre-formed ABTS+ radical, indicated by a decrease in absorbance at 734 nm. For the FRAP assay, reducing power was quantified based on the reduction of the ferric-tripyridyltriazine (Fe3+-TPTZ) complex to the ferrous form (Fe2+) at acidic pH, which produces a colored product with maximum absorption at 593 nm. Both assays were performed strictly according to the manufacturer’s protocols. Absorbance was measured using a Multiskan SkyHigh microplate spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Fresh standard curves were prepared for each assay using Trolox (for ABTS) and FeSO4·7H2O (for FRAP) as reference standards, and all samples were analyzed in triplicate. Results were normalized to the total protein concentration and expressed as Trolox-equivalent (for ABTS) and FeSO4-equivalent (for FRAP) antioxidant capacities per milligram of protein, respectively. The detailed procedures followed established methodology [27].

2.8. Analysis of Antioxidant Enzyme Activities

The activities of key antioxidant enzymes were evaluated in cell lysates using commercial assay kits. Following the indicated treatments, LO2 cells were harvested and lysed in ice-cold buffers provided with the respective kits, and the supernatants were collected after centrifugation for analysis. Superoxide dismutase (SOD) activity was determined using a WST-1-based Total SOD Assay Kit (Cat# A001-3, Nanjing Jiancheng Bioengineering Institute, Nanjing, China). This assay measures the ability of SOD to inhibit the reduction of the water-soluble tetrazolium salt WST-1 by superoxide anions generated by a xanthine/xanthine oxidase system, with the inhibition rate monitored at 450 nm. Catalase (CAT) activity was assessed using a Catalase Assay Kit (Cat# S0051, Beyotime Biotechnology, Shanghai, China), which quantifies H2O2 decomposition by CAT via a peroxidase-coupled colorimetric reaction; residual H2O2 was measured at 520 nm. Glutathione peroxidase (GPx) activity was measured with a Glutathione Peroxidase Assay Kit (Cat# A005, Nanjing Jiancheng Bioengineering Institute). The assay is based on GPx-catalyzed reduction of cumene hydroperoxide, which oxidizes reduced glutathione (GSH) to oxidized glutathione (GSSG). The resulting GSH consumption is coupled to the reduction of 5,5′-dithio-bis-(2-nitrobenzoic acid) (DTNB), yielding a yellow product with maximum absorbance at 412 nm. All absorbance measurements were performed on a Multiskan SkyHigh microplate spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Enzyme activities were calculated based on standard curves (for CAT) or molar extinction coefficients (for SOD and GPx) as specified in the respective kit instructions, and all assays were performed in triplicate. All assays were performed strictly according to the manufacturers’ protocols. Enzyme activities were normalized to the total protein concentration of the lysates as determined by the BCA method.

2.9. Determination of Cellular Energy Charge via ADP/ATP Ratio

The cellular ADP/ATP ratio, a key indicator of energy charge, was quantified using a bioluminescent ADP/ATP Ratio Assay Kit (Cat # MAK135, Sigma-Aldrich, St. Louis, MO, USA). LO2 cells were seeded in white-walled, clear-bottom 96-well plates at a density of 1 × 104 cells per well and subjected to the specified treatments. The assay was performed in-plate according to the manufacturer’s protocol. Luminescence was measured sequentially using a Synergy H1 multimode microplate reader (BioTek Instruments, Winooski, VT, USA) to obtain three readings: the basal ATP signal (RLUA), background after ATP degradation (RLUB), and total signal after enzymatic conversion of ADP to ATP (RLUC). ATP concentrations were quantified based on a standard curve generated with known ATP standards included in the kit, and all samples were assayed in triplicate. The ADP/ATP ratio for each sample was then calculated as (RLUC–RLUB)/RLUA.

2.10. Assessment of Mitochondrial Membrane Potential (ΔΨm)

Mitochondrial membrane potential (ΔΨm) was assessed using the fluorescent cationic dye JC-1 (Cat# C2006, Beyotime Biotechnology, Shanghai, China), which exhibits potential-dependent accumulation in mitochondria. Following the indicated treatments, LO2 cells were harvested, resuspended, and incubated with 5 μg/mL JC-1 working solution at 37 °C for 20 min in the dark. Cells were then washed twice with pre-warmed JC-1 staining buffer. Fluorescence was immediately measured using a Synergy H1 multimode microplate reader (BioTek Instruments, Winooski, VT, USA). JC-1 forms red fluorescent J-aggregates (excitation/emission: 525/590 nm) in mitochondria with high ΔΨm, but remains as green fluorescent monomers (excitation/emission: 490/530 nm) in the cytoplasm upon depolarization. ΔΨm was quantified as the ratio of red (aggregate) to green (monomer) fluorescence intensity. A decrease in this ratio indicates mitochondrial depolarization.

2.11. siRNA-Mediated Gene Knockdown and Rescue Experiment

For MCAT knockdown, LO2 cells were seeded in 12-well plates. At 60–70% conflu-ency, cells were transfected with 50 nM of either negative control siRNA (siCtrl) or MCAT-specific siRNA (siMCAT; SMARTpool: ON-TARGETplus Human MCAT siRNA, Dharmacon, Lafayette, CO, USA) using Lipofectamine RNAiMAX (Invitrogen), following the manufacturer’s instructions. After 6 h, the medium was replaced with fresh complete medium. For the rescue experiment, a concentration of 20 μM curcumin was selected based on our dose–response results, which demonstrated that this concentration effectively downregulated miR-22-3p and upregulated MCAT mRNA expression. 24 h after siRNA transfection, 20 μM curcumin or an equal volume of solvent (DMSO, vehicle control) was added to the designated wells. Following an additional 24 h of incubation, cells were harvested for RNA extraction or ROS measurement. Knockdown efficiency was verified by qRT-PCR (see Section 2.5). Intracellular ROS levels were assessed using the DCFH-DA probe as described in Section 2.6.

2.12. Statistical Analysis

Data are expressed as the mean ± standard deviation (SD) derived from a minimum of three independent replicates. Statistical evaluations were carried out with SPSS Statistics software (v17.0, IBM, Armonk, New York, USA). For multi-group comparisons, the homogeneity of variances was first verified using Levene’s test. If the assumption of homogeneity was met, we employed one-way analysis of variance (ANOVA). In cases of significant heteroscedasticity, Welch’s ANOVA or the non-parametric Kruskal–Wallis test was applied, as appropriate. Where ANOVA indicated significance, Duncan’s post-hoc test for equal variances or the Games-Howell test for unequal variances was applied for inter-group comparisons. A p value of less than 0.05 (*) was deemed statistically significant, and a p value less than 0.01 (**) was considered highly significant.

2.13. Bioinformatic Analysis

Potential miRNA targets were predicted using TargetScanHuman (release 8.0) and miRanda (August 2022 release).

3. Results

3.1. The miR-22-3p/MCAT Axis Regulates Cellular Antioxidant Defense and Mitochondrial Bioenergetics

Modulation of the miR-22-3p/MCAT axis exerted a profound influence on cellular redox homeostasis. Inhibition of miR-22-3p reduced intracellular reactive oxygen species (ROS) levels, as evidenced by a leftward shift in the fluorescence peak in flow cytometry analysis (Figure 1), which was accompanied by an increase in the total reducing capacity measured by both ABTS and FRAP assays (Figure 2a). Conversely, overexpression of miR-22-3p elevated ROS accumulation (Figure 1) and correspondingly decreased the overall antioxidant capacity (Figure 2a). This regulatory effect extended to key antioxidant enzymes; the activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) were increased upon miR-22-3p inhibition and decreased upon its overexpression (Figure 2b).
Bioinformatic analysis predicted the mitochondrial enzyme malonyl-CoA-acyl carrier protein transacylase (MCAT) as a direct target of miR-22-3p. Consistent with this prediction, modulation of miR-22-3p bidirectionally affected mitochondrial energy metabolism. Inhibition of miR-22-3p elevated the cellular ADP/ATP ratio, a change indicative of enhanced oxidative phosphorylation, while its overexpression decreased the ratio (Figure 3a,b). In contrast to these effects on bioenergetics, neither inhibition of miR-22-3p nor overexpression of MCAT significantly altered the mitochondrial membrane potential (ΔΨm) (Figure 3c,d).
Collectively, these findings suggest that miR-22-3p may function as a regulatory node, the inhibition of which is associated with reduced ROS levels, enhanced cellular antioxidant capacity (Figure 1 and Figure 2a), increased activities of key antioxidant enzymes (Figure 2b), and improved mitochondrial bioenergetics (Figure 3a,b), without altering the mitochondrial membrane potential (Figure 3c,d).

3.2. MCAT Is a Direct Transcriptional Target of miR-22-3p

To identify direct downstream targets mediating the antioxidant effects of miR-22-3p, bioinformatic analysis was performed using TargetScan and miRanda as detailed in the Section 2. This analysis revealed a highly conserved binding site for miR-22-3p within the 3′-untranslated region (3′-UTR) of MCAT mRNA (Figure 4), suggesting post-transcriptional repression.
This prediction was validated experimentally using a dual-luciferase reporter assay. The wild-type (WT) segment of the MCAT 3′-UTR containing the predicted binding site, and a corresponding mutant (MUT) version with site-specific mutations, were cloned downstream of the Renilla luciferase gene in a psiCHECK2 vector.
In LO2 cells, co-transfection of the miR-22-3p mimic with the WT reporter significantly reduced Renilla luciferase activity compared to the negative control (NC) mimic. This suppression was completely abolished when the MUT reporter was used (Figure 5a), confirming specific binding of miR-22-3p to the seed sequence in the MCAT 3′-UTR.
The regulatory relationship was further examined under physiological conditions by modulating miR-22-3p levels. Ectopic expression of the miR-22-3p mimic significantly downregulated endogenous MCAT mRNA, whereas inhibition of endogenous miR-22-3p increased its expression (Figure 5b). This reciprocal expression pattern corroborates MCAT as a direct cellular target of miR-22-3p.
Collectively, the luciferase and qPCR data confirm that miR-22-3p directly targets the MCAT 3′-UTR under these experimental conditions. It is noted that the reporter assay, while a standard for validation, employs overexpression and may not fully recapitulate physiological regulatory dynamics.

3.3. Curcumin Acts as an Upstream Regulator of the miR-22-3p/MCAT Axis

Given the established role of the miR-22-3p/MCAT axis in antioxidant defense, we investigated whether the dietary antioxidant curcumin functions through this mechanism. In LO2 cells, treatment with curcumin (5, 10, and 20 μM) for 24 h resulted in a significant, dose-dependent downregulation of miR-22-3p levels (Figure 6a).
Consistent with the predicted regulatory relationship, this suppression of miR-22-3p led to the derepression of its target. MCAT mRNA expression was markedly upregulated by curcumin in a reciprocal, dose-dependent manner (Figure 6b). The inverse correlation between miR-22-3p and MCAT expression indicates that curcumin activates this pathway by suppressing the miRNA.
Within the functional context of the pathway, curcumin treatment led to a significant reduction in intracellular ROS levels, as measured by DCFH-DA fluorescence (Figure 6c), aligning with an enhanced antioxidant state. Collectively, these data suggest that curcumin acts as an upstream regulator of the miR-22-3p/MCAT pathway. The ability of curcumin to suppress miR-22-3p and consequently increase MCAT expression supports the existence of a novel post-transcriptional mechanism that may contribute to its antioxidant activity.

3.4. MCAT Is Essential for Curcumin-Mediated Antioxidant Defense

To establish MCAT as a required effector downstream of the miR-22-3p/MCAT axis, loss-of-function experiments were performed using siRNA-mediated knockdown in LO2 cells. Transfection with MCAT-specific siRNA effectively reduced MCAT mRNA levels by approximately 65% compared with control siRNA (Figure 7a).
The impact of MCAT depletion on the antioxidant effect of curcumin was then examined. Consistent with earlier findings, curcumin treatment alone significantly reduced intracellular ROS levels (Figure 7b). However, this ROS-scavenging effect was largely abolished when MCAT was knocked down. ROS levels in the si-MCAT + Curcumin group were comparable to those in the siRNA control group and significantly higher than in the Curcumin-only group (Figure 7b). Furthermore, MCAT knockdown alone resulted in a modest yet statistically significant elevation of basal ROS, which underscores the role of MCAT in maintaining redox homeostasis.
These results demonstrate that the reduction of ROS by curcumin is dependent on MCAT. This genetic evidence solidifies MCAT as the critical functional target within the miR-22-3p/MCAT axis, through which curcumin enhances cellular antioxidant defense.

4. Discussion

4.1. Elucidating the Turmeric–Curcumin–miR-22-3p–MCAT Antioxidant Axis

This study investigates a potential mechanism through which curcumin, the principal bioactive constituent of turmeric (Curcuma longa L.), may enhance mitochondrial antioxidant defense. Our data demonstrate that curcumin downregulates the stress-responsive microRNA miR-22-3p. Integrated bioinformatic and functional analyses established malonyl-CoA-acyl carrier protein transacylase (MCAT)—a central enzyme in mitochondrial fatty acid synthesis (mtFAS)—as a direct and functional target of miR-22-3p. The functional necessity of this regulatory node was confirmed, as siRNA-mediated knockdown of MCAT abolished the curcumin-induced reduction of intracellular ROS.
Collectively, these data define a curcumin–miR-22-3p–MCAT axis that enhances mitochondrial antioxidant defense and bioenergetics. Key supporting evidence includes a reduction in mitochondrial ROS, an increase in the cellular ADP/ATP ratio (consistent with enhanced oxidative phosphorylation in the context of a stable membrane potential ΔΨm), and an elevation in cellular reducing capacity. The curcumin concentrations employed (5–20 μM) are within the standard, biologically effective range for in vitro mechanistic studies [21,22]. While curcumin thus acts as an upstream regulator of this axis, the precise molecular mechanism driving miR-22-3p downregulation remains an open question. This finding expands the known bioactivity of curcumin beyond direct radical scavenging to include the post-transcriptional modulation of core metabolism. Given that curcumin is the primary bioactive compound in turmeric, this mechanism provides a novel molecular basis that could contribute to the potential health benefits associated with turmeric consumption. The proposed model, which contrasts this novel post-transcriptional axis with the canonical Nrf2-mediated transcriptional pathway, is summarized in Figure 8.
Modulation of this axis led to a coordinated improvement in the cellular antioxidant profile—reduced ROS, increased chemical reducing capacity (ABTS/FRAP), and elevated activities of key antioxidant enzymes (SOD, CAT, GPx)—indicating a multi-faceted enhancement of defense. One plausible explanation for this enhancement is that MCAT-driven mtFAS activity bolsters cellular antioxidant defenses through several non-exclusive mechanisms: (i) supporting the integrity of respiratory supercomplexes to minimize electron leakage and ROS generation; (ii) providing essential lipids for the functional maturation of resident antioxidants such as SOD2; and (iii) the generation of metabolic intermediates that could, hypothetically, act as mitochondrial retrograde signaling molecules.

4.2. Interplay with Canonical Pathways and Broader Implications

The identification of the miR-22-3p/MCAT axis reveals a novel, post-transcriptional layer underlying the established bioactivity of turmeric, traditionally attributed to curcumin’s activation of the Nrf2-Keap1 pathway [28]. This mitochondria-centered mechanism may operate in parallel with or complement this canonical antioxidant response. Physiologically, this axis may hold relevance for metabolic health. Considering the pathogenic role of oxidative stress in conditions such as NAFLD [6,8] and the documented upregulation of miR-22-3p in fatty liver models [29], the observed suppression of this miRNA and concomitant improvement in mitochondrial bioenergetics and antioxidant defense by curcumin in vitro provide a plausible mechanistic basis for its investigated dietary benefits in metabolic contexts. Furthermore, by improving cellular bioenergetics in our model, this curcumin-driven pathway provides a mechanistic rationale that could, if validated in vivo, support the investigation of turmeric—as a dietary source of curcumin—for promoting metabolic resilience, a key factor often compromised during aging [30].

4.3. Limitations and Future Perspectives

Despite the mechanistic insights provided, this study has limitations that delineate clear avenues for future research. The primary constraints stem from its in vitro design. The findings are derived from a single cell line and a defined treatment window (24 h) with curcumin concentrations (5–20 μM) standard for mechanistic studies but exceeding typical systemic levels. Consequently, establishing the physiological and translational relevance of this axis requires in vivo validation in relevant models, alongside time-course analyses to elucidate its dynamics.
At the mechanistic level, several key validations remain. While MCAT’s functional necessity is supported by siRNA-mediated knockdown—a result crucial to our model—we acknowledge that potential off-target or compensatory effects inherent to this technique, though mitigated by using a validated siRNA pool, cannot be entirely excluded. Complementary to this functional evidence, direct confirmation of MCAT upregulation at the protein and enzymatic activity level is essential to fully solidify the post-transcriptional regulation mechanism. Similarly, the direct targeting by miR-22-3p, confirmed via a luciferase reporter assay, would benefit from validation in endogenous editing models to complement the overexpression system.
Beyond these foundational validations, our work opens several mechanistic questions. It will be important to determine whether the observed increase in antioxidant enzyme activities is underpinned by transcriptional or translational changes. Furthermore, elucidating how this mitochondria-centric axis interacts with canonical pathways like Nrf2, and whether mtFAS-derived lipids function as signaling molecules to coordinate the antioxidant response, will provide a more integrated understanding of cellular redox regulation.
Addressing these points will not only deepen the understanding of turmeric’s bioactivity but also critically evaluate its potential in strategies aimed at mitigating oxidative stress-related metabolic diseases.

5. Conclusions

This in vitro study identifies the miR-22-3p/MCAT axis as a novel and significant post-transcriptional pathway contributing to the ability of curcumin to mitigate mitochondrial oxidative stress and bolsters associated antioxidant defenses. These findings extend our understanding of curcumin’s bioactivity beyond direct radical scavenging, highlighting its potential to modulate fundamental metabolic networks.
While the data establish a functional link within the cellular model, it is critical to emphasize that the in vivo physiological relevance and translational potential of this axis remain to be determined. The current work does not address physiological dose–response, bioavailability, or the complex organismal context, which are essential for evaluating any dietary implications. Therefore, claims regarding direct application to functional food development would be premature.
The primary significance of this work lies in identifying a previously unexplored mechanistic node. Future research should prioritize in vivo validation in relevant disease models and investigate the crosstalk between this pathway and established regulators like Nrf2. Such studies will clarify whether this axis represents a viable target for nutritional strategies aimed at mitigating oxidative stress [31,32].

Author Contributions

H.W. and Y.L. (Yanqi Lin) contributed equally to this work. Conceptualization, S.H. and G.L.; methodology, H.W. and Y.L. (Yanqi Lin); software, H.W.; validation, Y.L. (Yanqi Lin) and Y.L. (Yuanyuan Li); formal analysis, Y.L. (Yanqi Lin), Y.L. (Yuanyuan Li); investigation, Y.L. (Yanqi Lin) and Y.L. (Yuanyuan Li); resources, G.L.; data curation, Y.L. (Yanqi Lin) and Y.L. (Yuanyuan Li); writing—original draft preparation, H.W.; writing—review and editing, H.W., Y.L. (Yanqi Lin), S.H. and G.L.; visualization, H.W.; supervision, S.H. and G.L.; project administration, S.H. and G.L.; funding acquisition, S.H. and G.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (grant number 31771972), the Guiding Project of Fujian Provincial Science and Technology Program (Grant No. 2025N03010434), the Natural Science Foundation of Fujian Province (grant numbers 2017J01447 and 2020J01676).

Data Availability Statement

The original datasets generated and analyzed during this study (including raw flow cytometry FCS files, qPCR data, and other primary datasets) are not deposited in a public repository due to their specialized format and size. However, they are available from the corresponding author (G.L.) upon reasonable request for the purpose of verifying the research findings.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Alam, M.S.; Anwar, M.J.; Maity, M.K.; Azam, F.; Jaremko, M.; Emwas, A.H. The Dynamic Role of Curcumin in Mitigating Human Illnesses: Recent Advances in Therapeutic Applications. Pharmaceuticals 2024, 17, 1674. [Google Scholar] [CrossRef]
  2. Hewlings, S.; Kalman, D. Curcumin: A Review of Its Effects on Human Health. Foods 2017, 6, 92. [Google Scholar] [CrossRef] [PubMed]
  3. Tabrizi, R.; Vakili, S.; Akbari, M.; Mirhosseini, N.; Lankarani, K.B.; Rahimi, M.; Mobini, M.; Jafarnejad, S.; Vahedpoor, Z.; Asemi, Z. The Effects of Curcumin-containing Supplements on Biomarkers of Inflammation and Oxidative Stress: A Systematic Review and Meta-Analysis of Randomized Controlled Trials. Phytother. Res. 2019, 33, 253–262. [Google Scholar] [CrossRef] [PubMed]
  4. Shao, J.; Pan, X.; Yin, X.; Fan, G.; Tan, C.; Yao, Y.; Xin, Y.; Sun, C. Curcumin: A Naturally Occurring Modulator of Adipokines in Diabetes. J. Cell. Physiol. 2019, 234, 14909–14921. [Google Scholar] [CrossRef]
  5. Sies, H.; Jones, D.P. Reactive oxygen species (ROS) as pleiotropic physiological signalling agents. Nat. Rev. Mol. Cell Biol. 2020, 21, 363–383. [Google Scholar] [CrossRef]
  6. Zhao, R.Z.; Jiang, S.; Zhang, L.; Yu, Z.B. Mitochondrial electron transport chain, ROS generation and uncoupling. Int. J. Mol. Med. 2019, 44, 3–15. [Google Scholar] [CrossRef]
  7. Zorov, D.B.; Plotnikov, E.Y.; Silachev, D.N.; Zorova, L.D.; Pevzner, I.B.; Zorov, S.D.; Babenko, V.A.; Jankauskas, S.S.; Popkov, V.A.; Savina, P.S. Microbiota and Mitobiota. Putting an Equal Sign Between Mitochondria and Bacteria. Biochemistry 2014, 79, 1017–1031. [Google Scholar] [CrossRef]
  8. Murphy, M.P.; Hartley, R.C. Mitochondria as a therapeutic target for common pathologies. Nat. Rev. Drug Discov. 2018, 17, 865–886. [Google Scholar] [CrossRef]
  9. Gebert, L.F.R.; MacRae, I.J. Regulation of microRNA function in animals. Nat. Rev. Mol. Cell Biol. 2019, 20, 21–37. [Google Scholar] [CrossRef]
  10. Ohishi, T.; Goto, S.; Monira, P.; Isemura, M.; Nakamura, Y. Involvement of microRNA modifications in anticancer effects of major polyphenols from green tea, coffee, wine, and curry. Crit. Rev. Food Sci. Nutr. 2023, 63, 7148–7179. [Google Scholar] [CrossRef]
  11. Collado, A.; Jin, H.; Pernow, J.; Zhou, Z. MicroRNA: A mediator of diet-induced cardiovascular protection. Curr. Opin. Pharmacol. 2021, 60, 183–192. [Google Scholar] [CrossRef]
  12. Zhao, P.; Ding, R.; Tao, Q.; Shang, X.; Lv, B.; Kong, Q. Safety and efficacy of curcumin in the treatment of ulcerative colitis: An updated systematic review and meta-analysis of randomized controlled trials. EXPLORE 2025, 21, 103083. [Google Scholar] [CrossRef]
  13. Manica, D.; Silva, G.B.d.; Silva, A.P.d.; Marafon, F.; Maciel, S.F.V.d.O.; Bagatini, M.D.; Moreno, M. Curcumin promotes apoptosis of human melanoma cells by caspase 3. Cell Biochem. Funct. 2023, 41, 1295–1304. [Google Scholar] [CrossRef]
  14. Yang, Z.; Qin, W.; Huo, J.; Zhuo, Q.; Wang, J.; Wang, L. MiR-22 modulates the expression of lipogenesis-related genes and promotes hepatic steatosis in vitro. FEBS Open Bio. 2021, 11, 322–332. [Google Scholar] [CrossRef] [PubMed]
  15. Shen, M.; Wu, Y.; Li, L.; Zhang, L.; Liu, G.; Wang, R. CircMAP3K5 promotes cardiomyocyte apoptosis in diabetic cardiomyopathy by regulating miR-22-3p/DAPK2 Axis. J. Diabetes. 2024, 16, e13471. [Google Scholar] [CrossRef]
  16. McGeary, S.E.; Lin, K.S.; Shi, C.Y.; Pham, T.M.; Bisaria, N.; Kelley, G.M.; Bartel, D.P. The biochemical basis of microRNA targeting efficacy. Science 2019, 366, eaav1741. [Google Scholar] [CrossRef]
  17. Chen, Y.; Wang, X. miRDB: An online database for prediction of functional microRNA targets. Nucleic Acids Res. 2020, 48, D127–D131. [Google Scholar] [CrossRef]
  18. Karagkouni, D.; Paraskevopoulou, M.D.; Chatzopoulos, S.; Vlachos, I.S.; Tastsoglou, S.; Kanellos, I.; Papadimitriou, D.; Kavakiotis, I.; Maniou, S.; Skoufos, G.; et al. DIANA-TarBase v8: A decade-long collection of experimentally supported miRNA–gene interactions. Nucleic Acids Res. 2018, 46, D239–D245. [Google Scholar] [CrossRef] [PubMed]
  19. Nowinski, S.M.; Solmonson, A.; Rusin, S.F.; Maschek, J.A.; Bensard, C.L.; Fogarty, S.; Jeong, M.-Y.; Lettlova, S.; Berg, J.A.; Morgan, J.T.; et al. Mitochondrial fatty acid synthesis coordinates oxidative metabolism in mammalian mitochondria. eLife 2020, 9, e58041. [Google Scholar] [CrossRef] [PubMed]
  20. Angerer, H.; Schönborn, S.; Gorka, J.; Bahr, U.; Karas, M.; Wittig, I.; Heidler, J.; Hoffmann, J.; Morgner, N.; Zickermann, V. Acyl modification and binding of mitochondrial ACP to multiprotein complexes. Biochim. Biophys. Acta Mol. Cell Res. 2017, 1864, 1913–1920. [Google Scholar] [CrossRef] [PubMed]
  21. Gupta, S.C.; Patchva, S.; Aggarwal, B.B. Therapeutic roles of curcumin: Lessons learned from clinical trials. AAPS J. 2013, 15, 195–218. [Google Scholar] [CrossRef]
  22. Song, X.; Tan, L.; Wang, M.; Ren, C.; Guo, C.; Yang, B.; Ren, Y.; Cao, Z.; Li, Y.; Pei, J. Myricetin: A review of the most recent research. Biomed. Pharmacother. 2021, 134, 111017. [Google Scholar] [CrossRef] [PubMed]
  23. Kuo, A.; Lee, M.Y.; Sessa, W.C. Lipid Droplet Biogenesis and Function in the Endothelium. Circ. Res. 2017, 120, 1289–1297. [Google Scholar] [CrossRef]
  24. Lopaschuk, G.D.; Karwi, Q.G.; Tian, R.; Wende, A.R.; Abel, E.D. Cardiac Energy Metabolism in Heart Failure. Circ. Res. 2021, 128, 1487–1513. [Google Scholar] [CrossRef] [PubMed]
  25. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  26. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Wittwer, C.T. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 66, 1012–1029. [Google Scholar] [CrossRef] [PubMed]
  27. Xiang, L.; Zhang, Q.; Chi, C.; Wu, G.; Lin, Z.; Li, J.; Gu, Q.; Chen, G. Curcumin analog A13 alleviates oxidative stress by activating Nrf2/ARE pathway and ameliorates fibrosis in the myocardium of high-fat-diet and streptozotocin-induced diabetic rats. Diabetol. Metab. Syndr. 2020, 12, 47. [Google Scholar] [CrossRef]
  28. Tonelli, C.; Chio, I.I.C.; Tuveson, D.A. Transcriptional Regulation by Nrf2. Antioxid. Redox Signal. 2018, 29, 1727–1745. [Google Scholar] [CrossRef]
  29. Wang, Y.; Zhang, R.; Li, J.; Han, X.; Lu, H.; Su, J.; Liu, Y.; Tian, X.; Wang, M.; Xiong, Y.; et al. MiR-22-3p and miR-29a-3p synergistically inhibit hepatic stellate cell activation by targeting AKT3. Exp. Biol. Med. 2022, 19, 1712–1713. [Google Scholar] [CrossRef]
  30. Xu, L.; Zhang, Y.; Tang, H.; Zhang, H.; He, X. Quercetin regulates oxidative stress and mitochondrial biogenesis via the miR-22-3p/SIRT1 axis to ameliorate diabetic endothelial dysfunction. Biofactors 2021, 47, 984–997. [Google Scholar] [CrossRef]
  31. Duarte, F.V.; Palmeira, C.M.; Rolo, A.P. The role of MicroRNAs in mitochondria: Small players acting wide. Genes 2014, 5, 865–886. [Google Scholar] [CrossRef] [PubMed]
  32. Singh, D.D.; Kim, Y.; Choi, S.A.; Han, I.; Yadav, D.K. Clinical significance of microRNAs, long non-coding RNAs, and circRNAs in cardiovascular diseases. Cells 2023, 12, 1629. [Google Scholar] [CrossRef] [PubMed]
Foods 15 00670 g001
Figure 1. Detection of ROS levels by flow cytometry. Representative flow cytometry curves showing intracellular ROS levels detected by the fluorescent probe DCFH-DA. LO2 cells were transfected with: a negative control inhibitor (NC), a miR-22-3p-specific inhibitor (miR-22-3p inh.), a microRNA negative control (miR-NC), or an MCAT overexpression plasmid (pCMV-MCAT). Cells were analyzed 48 h post-transfection. Data are representative of three independent biological replicates (n = 3).
Figure 1. Detection of ROS levels by flow cytometry. Representative flow cytometry curves showing intracellular ROS levels detected by the fluorescent probe DCFH-DA. LO2 cells were transfected with: a negative control inhibitor (NC), a miR-22-3p-specific inhibitor (miR-22-3p inh.), a microRNA negative control (miR-NC), or an MCAT overexpression plasmid (pCMV-MCAT). Cells were analyzed 48 h post-transfection. Data are representative of three independent biological replicates (n = 3).
Foods 15 00670 g001
Foods 15 00670 g002
Figure 2. Effects of modulating the miR-22-3p/MCAT axis on antioxidant parameters in LO2 cells. (a) Total reducing capacity measured by ABTS and FRAP assays. (b) Activities of the antioxidant enzymes GPx, SOD, and CAT. Data are presented as mean ± SD of three independent biological replicates (n = 3). Statistical significance was determined by one-way ANOVA followed by Duncan’s post-hoc test. * p < 0.05, ** p < 0.01 vs. the respective control group (miR-NC for miRNA-related groups, or Control for plasmid transfection groups).
Figure 2. Effects of modulating the miR-22-3p/MCAT axis on antioxidant parameters in LO2 cells. (a) Total reducing capacity measured by ABTS and FRAP assays. (b) Activities of the antioxidant enzymes GPx, SOD, and CAT. Data are presented as mean ± SD of three independent biological replicates (n = 3). Statistical significance was determined by one-way ANOVA followed by Duncan’s post-hoc test. * p < 0.05, ** p < 0.01 vs. the respective control group (miR-NC for miRNA-related groups, or Control for plasmid transfection groups).
Foods 15 00670 g002
Foods 15 00670 g003aFoods 15 00670 g003b
Figure 3. Analysis of ADP/ATP ratio and mitochondrial membrane potential (ΔΨm) following modulation of the miR-22-3p/MCAT axis in LO2 cells. (a,b) Cellular ADP/ATP ratio after transfection with: (a) a microRNA negative control (miR-NC) or a miR-22-3p-specific inhibitor (miR-22-3p inh.); (b) an empty vector control (Control) or an MCAT overexpression plasmid (pCMV-MCAT). Cells were analyzed 48 h post-transfection. (c,d) Mitochondrial membrane potential (ΔΨm) assessed using the JC-1 fluorescent probe under the same treatment conditions as in (a) and (b), respectively. The ratio of JC-1 fluorescence intensity (J-aggregates to monomers) is shown. Data are presented as the mean ± SD of three independent biological replicates (n = 3). Statistical significance was determined by one-way ANOVA followed by Duncan’s post-hoc test. * p < 0.05 vs. the respective control group (miR-NC for miRNA-related groups, or Control for plasmid transfection groups).
Figure 3. Analysis of ADP/ATP ratio and mitochondrial membrane potential (ΔΨm) following modulation of the miR-22-3p/MCAT axis in LO2 cells. (a,b) Cellular ADP/ATP ratio after transfection with: (a) a microRNA negative control (miR-NC) or a miR-22-3p-specific inhibitor (miR-22-3p inh.); (b) an empty vector control (Control) or an MCAT overexpression plasmid (pCMV-MCAT). Cells were analyzed 48 h post-transfection. (c,d) Mitochondrial membrane potential (ΔΨm) assessed using the JC-1 fluorescent probe under the same treatment conditions as in (a) and (b), respectively. The ratio of JC-1 fluorescence intensity (J-aggregates to monomers) is shown. Data are presented as the mean ± SD of three independent biological replicates (n = 3). Statistical significance was determined by one-way ANOVA followed by Duncan’s post-hoc test. * p < 0.05 vs. the respective control group (miR-NC for miRNA-related groups, or Control for plasmid transfection groups).
Foods 15 00670 g003aFoods 15 00670 g003b
Foods 15 00670 g004
Figure 4. Bioinformatic prediction of miR-22-3p binding to the 3′–UTR of human MCAT mRNA. The prediction was performed using TargetScanHuman (release 8.0) and miRanda (August 2022 release).
Figure 4. Bioinformatic prediction of miR-22-3p binding to the 3′–UTR of human MCAT mRNA. The prediction was performed using TargetScanHuman (release 8.0) and miRanda (August 2022 release).
Foods 15 00670 g004
Foods 15 00670 g005
Figure 5. Analysis of miR-22-3p interaction with the MCAT 3′-UTR and its effect on MCAT mRNA levels. (a) Dual-luciferase reporter assay in LO2 cells. Cells were co-transfected with a miR-22-3p mimic or a negative control mimic (miR-NC) and a reporter plasmid containing either the wild-type (psiCHECK2-MCAT-wt) or a mutant (psiCHECK2-MCAT-mut) 3′-untranslated region (3′-UTR) of MCAT. Luciferase activity was measured 48 h post-transfection. Data are expressed as a percentage of the activity in the miR-NC group for each reporter (set as 100%). (b) Quantitative RT-PCR (qRT-PCR) analysis of MCAT mRNA expression. LO2 cells were transfected with an empty vector control (Control) or an MCAT overexpression plasmid (pCMV-MCAT) for 48 h. The expression level in the Control group was set as 1.0. Data are presented as the mean ± SD of three independent biological replicates (n = 3). ** p < 0.01 vs. the corresponding control group.
Figure 5. Analysis of miR-22-3p interaction with the MCAT 3′-UTR and its effect on MCAT mRNA levels. (a) Dual-luciferase reporter assay in LO2 cells. Cells were co-transfected with a miR-22-3p mimic or a negative control mimic (miR-NC) and a reporter plasmid containing either the wild-type (psiCHECK2-MCAT-wt) or a mutant (psiCHECK2-MCAT-mut) 3′-untranslated region (3′-UTR) of MCAT. Luciferase activity was measured 48 h post-transfection. Data are expressed as a percentage of the activity in the miR-NC group for each reporter (set as 100%). (b) Quantitative RT-PCR (qRT-PCR) analysis of MCAT mRNA expression. LO2 cells were transfected with an empty vector control (Control) or an MCAT overexpression plasmid (pCMV-MCAT) for 48 h. The expression level in the Control group was set as 1.0. Data are presented as the mean ± SD of three independent biological replicates (n = 3). ** p < 0.01 vs. the corresponding control group.
Foods 15 00670 g005
Foods 15 00670 g006
Figure 6. Effects of curcumin treatment on miR-22-3p expression, MCAT mRNA levels, and intracellular ROS in LO2 cells. (a) miR-22-3p expression levels quantified by qRT-PCR. Cells were treated with the indicated concentrations of curcumin (5, 10, 20 µM) or vehicle control (Control) for 24 h. (b) MCAT mRNA levels quantified by qRT-PCR in cells treated as in (a). (c) Intracellular reactive oxygen species (ROS) levels measured using the DCFH-DA probe following the same treatment regimen. For all panels, data are presented as the mean ± SD from three independent biological replicates (n = 3). Expression data in (a) and (b) are normalized to U6 snRNA and β-actin, respectively, and shown as relative fold change versus the Control group (set as 1.0). ROS data in (c) are expressed as a percentage of the Control group (set as 100%). Statistical significance was determined by one-way ANOVA followed by Duncan’s post-hoc test. * p < 0.05, ** p < 0.01 vs. the Control group.
Figure 6. Effects of curcumin treatment on miR-22-3p expression, MCAT mRNA levels, and intracellular ROS in LO2 cells. (a) miR-22-3p expression levels quantified by qRT-PCR. Cells were treated with the indicated concentrations of curcumin (5, 10, 20 µM) or vehicle control (Control) for 24 h. (b) MCAT mRNA levels quantified by qRT-PCR in cells treated as in (a). (c) Intracellular reactive oxygen species (ROS) levels measured using the DCFH-DA probe following the same treatment regimen. For all panels, data are presented as the mean ± SD from three independent biological replicates (n = 3). Expression data in (a) and (b) are normalized to U6 snRNA and β-actin, respectively, and shown as relative fold change versus the Control group (set as 1.0). ROS data in (c) are expressed as a percentage of the Control group (set as 100%). Statistical significance was determined by one-way ANOVA followed by Duncan’s post-hoc test. * p < 0.05, ** p < 0.01 vs. the Control group.
Foods 15 00670 g006
Foods 15 00670 g007
Figure 7. MCAT mRNA levels and intracellular ROS following MCAT knockdown and curcumin treatment in LO2 cells. (a) MCAT mRNA levels quantified by qRT-PCR. Cells were transfected with control siRNA (Control) or MCAT-specific siRNA (si-MCAT) for 24 h. (b) Intracellular reactive oxygen species (ROS) levels measured using the DCFH-DA probe. Following siRNA transfection, cells were treated with or without 20 μM curcumin (Cur) for an additional 24 h. For both panels, data are expressed as a percentage of the Control siRNA group (set as 100%) and presented as the mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA followed by Duncan’s post-hoc test. * p < 0.05, ** p < 0.01 versus the Control group; # p < 0.01 for the comparison between the Curcumin and Curcumin + si-MCAT groups.
Figure 7. MCAT mRNA levels and intracellular ROS following MCAT knockdown and curcumin treatment in LO2 cells. (a) MCAT mRNA levels quantified by qRT-PCR. Cells were transfected with control siRNA (Control) or MCAT-specific siRNA (si-MCAT) for 24 h. (b) Intracellular reactive oxygen species (ROS) levels measured using the DCFH-DA probe. Following siRNA transfection, cells were treated with or without 20 μM curcumin (Cur) for an additional 24 h. For both panels, data are expressed as a percentage of the Control siRNA group (set as 100%) and presented as the mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA followed by Duncan’s post-hoc test. * p < 0.05, ** p < 0.01 versus the Control group; # p < 0.01 for the comparison between the Curcumin and Curcumin + si-MCAT groups.
Foods 15 00670 g007
Foods 15 00670 g008
Figure 8. Proposed model for the dual-pathway mechanism of curcumin in enhancing cellular antioxidant defense.
Figure 8. Proposed model for the dual-pathway mechanism of curcumin in enhancing cellular antioxidant defense.
Foods 15 00670 g008
Table 1. The primer sequences used in this study.
Table 1. The primer sequences used in this study.
GeneForward (5′-3′)Reverse (5′-3′)
MCATCGCGGTCTGCTCAACTACCCACTAGGGCTGCAAACTCTCC
CATGTGCGGAGATTCAACACTGCCACGGCAATGTTCTCACACAGACG
SOD-2GCTGCACCACAGCAAGCACCCCAGCAACTCCCCTTTGGGT
GPx-1GTGCTCGGCTTCCCGTGCAACCTCGAAGAGCATGAAGTTGGGC
β-actinGGCTGTATTCCCCTCCATCGCCAGTTGGTAACAATGCCATGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, H.; Lin, Y.; Li, Y.; Huang, S.; Li, G. Curcumin, the Bioactive Compound of Turmeric, Boosts Cellular Antioxidant Defense via the miR-22-3p/MCAT Axis. Foods 2026, 15, 670. https://doi.org/10.3390/foods15040670

AMA Style

Wang H, Lin Y, Li Y, Huang S, Li G. Curcumin, the Bioactive Compound of Turmeric, Boosts Cellular Antioxidant Defense via the miR-22-3p/MCAT Axis. Foods. 2026; 15(4):670. https://doi.org/10.3390/foods15040670

Chicago/Turabian Style

Wang, Haiqi, Yanqi Lin, Yuanyuan Li, Shiying Huang, and Guiling Li. 2026. "Curcumin, the Bioactive Compound of Turmeric, Boosts Cellular Antioxidant Defense via the miR-22-3p/MCAT Axis" Foods 15, no. 4: 670. https://doi.org/10.3390/foods15040670

APA Style

Wang, H., Lin, Y., Li, Y., Huang, S., & Li, G. (2026). Curcumin, the Bioactive Compound of Turmeric, Boosts Cellular Antioxidant Defense via the miR-22-3p/MCAT Axis. Foods, 15(4), 670. https://doi.org/10.3390/foods15040670

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop